snOPY snoRNA Orthological Gene Database

Family: SNORA3

CLUSTAL 2.0.10 multiple sequence alignment C_elegans300088 ----------------AACGAGGTCCAGAGTCACCTTTTCAGCAA----- C_elegans300111 ----------------TACGAGGTCCAGAGTCACCTCTGAGAATA----- C_familiaris300475 ----------------ATCGAGGCT-AGAGTCACGCTTGGGTATC----- C_familiaris300476 ----------------CTTGAGGCT-AGAGTCACATCCTGACAC------ C_porcellus300091 ----------------ATCAAGGCT-AGAGTCATGCTTGACTGCT----- C_porcellus300433 ----------------ATCAAGGCT-AGAGTCACACTTGGGTATT----- C_porcellus300925 ----------------GCCGAGACC-AGAGTCACATCCTGACAC------ D_rerio300042 ----------------AGCGAGACT-AGAGTCACATCCTGACGTT----- D_rerio300043 ----------------AGCGAGACT-AGAGTCACATTCTGATGTT----- D_rerio300044 ----------------AGTGAGACT-AGAGTCACATCCTGATGTT----- D_rerio300045 ----------------TGTGAGACT-AGAGTCACATCCTGATGTT----- D_novemcinctus300155 ----------------TCCGAGACT-AGAATCACATGCTGACAC------ D_novemcinctus300183 ----------------ATCGAGGCT-AGAGTCACACTTGGGTATT----- D_novemcinctus300320 ----------------ATCGAGGCT-AGAGTCATGCTTGGGTATT----- D_novemcinctus300454 ----------------CCTGAGACT-AGAGTCACATCTTGATAC------ D_novemcinctus300517 ----------------ATCGAGGCT-AGAGTCACGCTTGGGTATT----- D_novemcinctus300576 ----------------ATCGAGGCT-AGAGTCATGCTTGGGTATT----- E_telfairi300057 ----------------GTTGAGGCT-AGAGTCACGCTTGGGTCCT----- E_telfairi300207 ----------------TCCGAGACT-AGAGTCACATCCTGACAC------ E_telfairi300294 ----------------ATCGAGGCG-AGAGTCATGCTGAGGTACT----- E_telfairi300308 ---------------AAAGAGGACT-AGAGTCGCATCATGCCAC------ E_telfairi300334 ----------------GTCGAGGCT-AGAGTCACGCTTGGGTCCT----- E_telfairi300366 ----------------TCAGAGACT-ATAGTCACATCTGGACAC------ E_telfairi300483 ----------------CCCGAGACT--GAGTCCCATCCTGACAC------ E_telfairi300502 ----------------GTCGAGGCT-AGAGGCACGCTTGGGTCCT----- E_telfairi300786 ----------------GTCGAGGCT-AGAGTCACGCTTGGGTACT----- E_telfairi300787 ----------------TCTGAGACT-GGAGTCACATCCTGACAC------ E_caballus300178 ----------------CCTGATACT-AGAGTCACAAGCTGACAT------ E_caballus300307 ----------------GTCGAGGCT-AGAGTCACGCTTGGGTATC----- E_caballus300308 ----------------CCCGAGACT-AGAGTCACATCCTGACAC------ E_europaeus300120 ----------------ACTGAGGCT-AGAGTCTTGCTCG----------- E_europaeus300121 ----------------GGCGAGGCT-AGAGTCTTGCCAGGGCATG----- E_europaeus300131 ----------------ATTGAAACT-AGAGTCATTCTTGGGTACC----- E_europaeus300149 ----------------CACGAGGCT-AGAGTCTCGCCCAGGCACA----- E_europaeus300165 ----------------ATTGAAACC-AGAGTCATTCTTGGGTACC----- E_europaeus300173 ----------------GGCGAGGCT-GGAGTCTCGCCCGGACATG----- E_europaeus300180 ----------------ATTGAAACC-AGAGTCATTCTTGGGTACC----- E_europaeus300222 ----------------ATTGAGACT-A--GTCACGCTTGGGTATC----- E_europaeus300231 ----------------ATTGAAACT-AGAGTCATTCTTGGGTACC----- E_europaeus300258 ----------------ATTGAAACT-AGAGTCATTCTTGGGTACC----- E_europaeus300274 ----------------ATTGAAACG-AGAGTCATTCTTGGGTACC----- E_europaeus300324 ----------------GGCCATGAT-AGAGTCTTGCCCGGGCATG----- E_europaeus300371 ---------------------AACG-AGAGTCATTCTTGGGTACC----- E_europaeus300387 ----------------ATTGAAACT-AGAGTCATTCTTGGGTACC----- E_europaeus300435 ----------------ATCGAGACT-AGAGTCATGCTTCGGTATC----- E_europaeus300442 ----------------GGCGAGGCT-AGACTCTCACCCGGGCATG----- E_europaeus300463 ----------------ATTGAAACC-AGAGTCATTCTTGGGTACC----- E_europaeus300486 ----------------ATTGAAACG-AGAGTCATTCTTGGGTACC----- E_europaeus300585 ----------------TACGAGGCT-AGAGTCTTGCCTGGGCATG----- E_europaeus300594 ----------------GACGAGGCT-AGAGTCTCGCCTGGGCATG----- E_europaeus300620 ----------------TGTGAGGCT-AGAGTCTCACCGAGGCATG----- E_europaeus300667 ----------------ATTGAAACC-AGAGTCAT-CTTTGGTACC----- E_europaeus300722 ----------------GCTGAGGCT-AGAGTCTCGCCCGGGCATG----- G_aculeatus300111 ----------------ATAGAGACT-AGAGTCTCACCTTGACATA----- G_aculeatus300112 ----------------AGCGAGGCT-AGAGTCACGCCTGGATACG----- G_aculeatus300113 ----------------AGCGAGGCT-AGAGTCACGCTTGGACACA----- H_sapiens300733 ----------------ATCGAGGCT-AGAGTCACGCTTGGGTATC----- H_sapiens300734 ----------------GCCGAGACT-AGAGTCACATCCTGACAC------ L_africana300488 ----------------CTCGAGACT-AGAGTCACATCTCGACAC------ M_mulatta300050 ----------------ACCAAGACT-CAAGTCACAGTCCGA--------- M_mulatta300264 ----------------GCTGACACC-AGAGTAACATCCTGACAC------ M_mulatta300307 ------------------ACAGGCA-GCATTCAAGTTCAAAAAAC----- M_mulatta300447 ----------------TCTGAGACT-AGGGTCACATCCTAACAGCTCA-- M_mulatta300650 ----------------GCCGAGACT-AGAGTCACATCCTGACAC------ M_mulatta300651 ----------------ATCGAGGCT-AGAGTCACGCTTGGGTATC----- M_murinus300070 ----------------ATCGAGGCT-AGAGTCATGCTTGGGTATT----- M_murinus300240 ---------------------TATA-AGATT-AAAAAAAAAAATC----- M_murinus300335 ----------------ATCGAGGCT-AGAGTCACACTTGGTTATT----- M_murinus300407 ----------------ATCGAGGCT-AAAGTCACACTTAGGTATT----- M_murinus300442 -----------------------------CTCGTGCTAGAGTCCT----- M_murinus300535 ----------------ATCGAGGCT-AGAGTCACGCTTGGGTATT----- M_murinus300536 ----------------GCCGAGACT-AGAGTCACATCTTGACAC------ M_domestica300174 ----------------ACCGAGACTTAGAGTCACATCTAGGC-AT----- M_domestica300175 ----------------CCCGAGACT-AGAGTCACATCCTGACAA------ M_musculus300363 --------------------------ATCCTGACATGGTGCTTT------ M_musculus300468 ----------------GCCAAGGCT-AGAGTCACATCCTGACAT------ M_musculus300761 ----------------TCCGAGGCT-AGAGTCACGCTCAGGTATT----- M_musculus300762 ----------------GCCGAGGCT-AGAGTCACATCCTGACAT------ M_musculus300805 ----------------TCCGAGGCT-AGAGTCACGCTCTGGTATT----- O_anatinus303418 ----------------ACCGAGACC-AGAGTCACATCCTGACAC------ O_anatinus304530 ----------------CTCGAGACTTAGAGTCACATCTGGATTAC----- O_anatinus304531 ----------------ACCGAGACT-AGAGTCACATCCTGACAC------ O_cuniculus300314 ----------------ATCCAGACT-ATAGTCATACCTGGATATT----- O_cuniculus300324 ----------------ATTGAGGCG-AGAGTCATGCTTGGGTATT----- O_cuniculus300471 ----------------ATCGAGGCT-AGAGTCACGCTTGGGTATT----- O_cuniculus300472 ----------------GCCGAGACT-AGAGTCACATCCCGACAC------ O_latipes300060 ----------------AGCGAGGCT-AGAGTCACACCCTGACATA----- O_garnettii300318 ----------------ATCGAGGCT-AGAGTCACTCCTGGGTATT----- O_garnettii300380 ----------------GCCGAGACT-AGAGTCACATCTTGACAC------ O_garnettii300494 ----------------ATGGCGGCT-AGAGCCATGCTTGTATATT----- O_garnettii300665 ---------------------GGCT-AGAATAATGCTTGGGTTTT----- O_garnettii300719 ----------------GCCGAGACT-AGAGTCACATCTTGACAC------ O_garnettii300751 ----------------GCCGAGACT-AGAGTCACATCTTGACAC------ P_troglodytes300077 ----------------TCTGAGACT-AGAGTCACATCCTGACA------- P_troglodytes300213 ----------------GCTGACACT-AGAGTAACATCCTGACAC------ P_troglodytes300255 ----------------ACCAAGACT-CAAGTCACATTCTGA--------- P_troglodytes300659 ----------------ATCGAGGCT-AGAGTCACGCTTGGGTATC----- P_troglodytes300660 ----------------GCCGAGACT-AGAGTCACATCCTGACAC------ P_pygmaeus300144 ----------------ACCAAGACT-CAAGTCACATTTCGA--------- P_pygmaeus300187 ----------------GCCGAGACT-AGAGTCACATCCTGACAC------ P_pygmaeus300188 ----------------ATCGAGGCT-AGAGTCACGCTTGGGTATC----- P_pygmaeus300218 ----------------GCCGAGACT-ACAGCCACATCCTGACAC------ P_pygmaeus300363 ----------------TCTGAGACT-AGAGTCACATCCTGACA------- P_pygmaeus300381 ----------------GCTGACACT-AGAGTAACATCCTGACAC------ R_norvegicus300055 ----------------GCTGAGACT-TTGGTCACATCCTGACAT------ R_norvegicus300554 -----------------------CT-AGAGTCACAGCCTGGTAC------ R_norvegicus300893 ----------------ATTGAGACT-AGAGTCACATCCTGACAT------ R_norvegicus301086 ----------------TCCGAGGCT-AGAGTCACGCTCAGGTATT----- R_norvegicus301087 ----------------ATCGAGACT-AGAGTCACATCCTGACAT------ S_cerevisiae300047 AATAATGTCTTTTATAATAGACACCCAGAGTCACGATTCGTCTTGGTTTT S_araneus300033 ----------------ATTAATACC-ATCGTCACATTGTCACA------- S_araneus300174 ----------------CTCGAGACT-AGAGTCAGACTTAGGTGTC----- S_araneus300423 ----------------CTCGAGACT-AGAGTCAGGCTGAGGTATC----- S_araneus300520 --------------------AGAG--AGAGTCACACTTAG-TATC----- S_araneus301030 ----------------CTCGAGACT-AGAGTCACGCTTAGGTATC----- S_araneus301031 ----------------GCCGAGACT-AGAGTCACATCCTGACAC------ S_tridecemlineatus300109 ----------------GCTGAGACT-GCAGTCACATCCCGACCC------ S_tridecemlineatus300140 ----------------GCTGAGACT-AGAGTCACATGCTGACAC------ S_tridecemlineatus300239 ----------------GCTAAGACT-AGAATCAAATCCTGACAT------ S_tridecemlineatus300296 ----------------CCCGAGACA-CGAGTCACATCCCAACAT------ T_nigroviridis300121 ----------------CGTGAGGCA-AGAGTCACTCCTGGACATG----- T_nigroviridis300122 ----------------AGCGAGGCT-AGAGTCACGCCTGAACACA----- T_belangeri300062 ----------------ACCAAGACT-AGAGTCACATTCTGACAC------ T_belangeri300199 ----------------CTCGAGG-T-AGATTCACGCATGGGTATC----- T_belangeri300211 -------------------AAGACT-AGCATTGGATCCTGACAC------ T_belangeri300426 ----------------CCCGAGGCT-AGAGTCACGCTTGGGTATC----- T_belangeri300427 ----------------ACCGAGACT-AGAGTCACATCCTGACAC------ X_tropicalis300005 ----------------GCTGAGACT-AGAGTCACATCTTGGCATT----- X_tropicalis300014 ----------------GCTGAGACT-AGAGTCACATCTTGGCATT----- X_tropicalis300015 ----------------CCCGAGACT-AGAGTCACATCCTGACATT----- X_tropicalis300060 ----------------GCTGAGACT-AGAGTCACATCTTGGCATT----- X_tropicalis300130 ----------------CCCGAGACT-AGAGTCACATCCTGACATT----- C_elegans300088 -----AATGCAGTTAGGGTGC-----TAGGATTTCTCGAAAATGAAATTG C_elegans300111 -----TGTATCTCTTCGGTGC-----TAGGATTGCTCGAAAATGAA-TTA C_familiaris300475 -AGCT-ATTGCCTTAGTGTGC-----TAGAG-TCCTCGAAGAGTA-ATTG C_familiaris300476 --ATTTCTTGTCCTGGTGTGC-----TAGAG-TCCTCAGAGAGAA-TCTG C_porcellus300091 -GGCT-ACTGCCTTAGTGGGC-----TACAG-TTCTCAAAAAGTAAC-TG C_porcellus300433 -GACT-GTTGCCTCAGTATGC-----TAGAG-TCCTTGAAGAGTAAAGTG C_porcellus300925 --AGCTCTTGTCCTGGTGTGC-----TAGAG-TTCTCGGAGAGAA-TCCG D_rerio300042 -GCTCG-TTGTCTTGGTGTGC-----TATAG-TACTCGCAGAATA-AC-- D_rerio300043 -GCTTG-TTGTCTTTGTGTGC-----TATAG-TACTCGCAGAATA-AT-- D_rerio300044 -GCTCA-TCATTTTGGTGTGC-----TATAG-TTCTCACAGAATG-AT-- D_rerio300045 -ACTTG-TTGTCTTGGTGTGC-----TATAG-TACTCACAGAATA-AA-- D_novemcinctus300155 -AGCT-CTTGTCCTGCTGTGC-----TAGCG-TCCTTGGAGACAA-TCTG D_novemcinctus300183 -GGCT-GCTGCCTTAGTGTGC-----TAGAG-TCCTTGAAGAATA-ACTG D_novemcinctus300320 -GGCT-GTTGCCTTAGTGTGC-----TAGAG-TCCTCGAAGAGTA-ACAG D_novemcinctus300454 -AGCT-CTTGTCCTGGTGGGC-----AAGAG-TCCTTGGAGAGAA-TCTA D_novemcinctus300517 -GGCT-GTTGTCTTAGTGTGC-----TAGAG-TCCTCGAAGAGTA-ACTG D_novemcinctus300576 -GGCTTGTTGCCTTAGTGTGC-----TAGAG-TCCTCGAAGAGTA-ACTG E_telfairi300057 -GGTT-GTTGCCTTGGTGTGC-----TAGAG-TCCTTGAAGAGTA-AGTG E_telfairi300207 -AACT-CTTGTCTTGGTGTGC-----TACGG-TTCTTGGAGAAGC-TCCG E_telfairi300294 -GGTT-ATTGCCTTGGTGTGC-----TAGAG-TCCTCGAAGAGTA-AGTG E_telfairi300308 -AACT-CTTGTCCTGGTGTGC-----TAGGG-TCCTCGGAGAGGA-TCTG E_telfairi300334 -GGTT-ATTGCCTTGGTGCGC-----TAGAG-TCCTCGAAGAGTA-AGTG E_telfairi300366 -AGGT-CTTGTCCTGGTGTGC-----GAGCG-TCCACGGAGAGAA-TGTG E_telfairi300483 -AACT-CTTGTCTTGGTGTGC-----TAGGG-TCCTCGGAGAGGA-CCCG E_telfairi300502 -GGTT-ATTGCCTGGGGGTGT-----TAGGGGTCCTCGAAGAACACAGTG E_telfairi300786 -GGTT-ATTGCCTTGGTGTGC-----TAGAG-TCCTCGAAGAGTA-AGCG E_telfairi300787 -AACT-CTTGTCTTGGTGTGC-----TAGAG-TCCTCGGAGAGGG-TCTG E_caballus300178 -AGCT-CTGGTCCTGGTGTGC-----TGGAG-TCTTTGGAGAGAA-TCTG E_caballus300307 -AGCT-ATTGCCTTAGTGTGC-----TAGAG-TCCTCGAAGAGTA-ACTG E_caballus300308 -AGCT-CTTGTCCTGGTGTGC-----TAGAG-TCCTCGGAGAAAA-TCTG E_europaeus300120 --CAT---TGCCCTGGTGTGC-----TGAAG-TCCTCGGAGAGCA-GCCC E_europaeus300121 -GCGT---TGCCCCGGCGTGC-----TGGAG-TCTTCGGAGAGCA-GCCG E_europaeus300131 -ATCT-TTTGTCTTAGTGTGC-----TTGGG-TCCTTGGAGTATC-ACTG E_europaeus300149 -GCTT---TGCCCCGGCGTGC-----GGGAG-TCCTCGGAGAGCA-GCCG E_europaeus300165 -ATCT-TTTGTCTTAGTGTGC-----TAGGG-TCCTTGGAGGGTC-ACTG E_europaeus300173 -GTGT---TGCACCGGCGTGC-----TAGAG-TCCTTGGAGAGCA-GCCG E_europaeus300180 -ATCT-TTTGTCTTAGTGTGC-----TAGGG-TCCTTGGAGGGTC-ACTG E_europaeus300222 -ACCC-GTGGCCTTAGTGTGC-----TAGAG-TCCTTGAAGAGTA-ACTG E_europaeus300231 -ATCT-TTTGTCTTAGTGTGC-----TTGGG-TCCTTGGAGTATC-ACTG E_europaeus300258 -ATCT-TTTGTCTTAGTGTGC-----TTGGG-TCCTTGGAGTATC-ACTG E_europaeus300274 -ATCT-TTTGTCTTAGTGTGC-----TTGGG-TCCTTGGAGTATC-ACTG E_europaeus300324 -CTGT---TGCCTCGACATGC-----TGGAG-TCTTCGGAGAGCA-GCTA E_europaeus300371 -ATCT-TTTGTCTTAGTGTGC-----TTGGG-TCCTTGGAGTATC-ACTG E_europaeus300387 -ATCT-TTTGTCTTAGTGTGC-----TTGGG-TCCTTGGAGTATC-ACTG E_europaeus300435 -ACTT-GTTGCCTTAGTGTGC-----TAGAG-TCCTCGAATAGTA-ACTG E_europaeus300442 -GCGT---TGCCCTAGCATGC-----TGGAG-TCCTCGGAGGGCA-GCTG E_europaeus300463 -ATCT-TTTGTCTTAGTGTGC-----TAGGG-TCCTTGGAGGGTC-ACTG E_europaeus300486 -ATCT-TTTGTCTTAGTGTGC-----TTGGG-TCCTTGGAGTATC-ACTG E_europaeus300585 -GCGT---TGTCCGGGTGTGC-----TGGAG-TCCTCGGAGAGCA-GCCA E_europaeus300594 -GCGT---TGCCCCGGCGTGC-----TGGAG-TCCTCGGAGAGCA-GCCG E_europaeus300620 -ACGT---TGCCCCGGCGTGC-----TGGAG-TCCTCGGAGAGCA-GCCG E_europaeus300667 -ATCT-TTTGTCTTAGTGTGC-----TAGGG-TCCTTGGAGGGTC-ACTG E_europaeus300722 -GTGT---TGCCCCGGTGTGC-----TGGAG-TCCTCAGAGAGCA-GCTG G_aculeatus300111 --ACTCATTGGCTTGGTGTGC-----TAGAG-TACTCTTAGATTG-AAGA G_aculeatus300112 -TCCCA-TTGTCCTGGTGTGC-----TAGAG-TGCTCGCAGAGTA-AA-T G_aculeatus300113 -TCCCA-TTGTCCTGGTGTGC-----TAGAG-TGCTCGTAGAGTA-AA-T H_sapiens300733 -GGCT-ATTGCCTGAGTGTGC-----TAGAG-TCCTCGAAGAGTA-ACTG H_sapiens300734 -AACT-CTTGTCCTGGTGTGC-----TAGAG-TACTCGAAGAGAA-TCTA L_africana300488 -AGCT-CTCGTCCTGGTGTGC-----TAGAG-TCCTCGGAGAGAA-TCTG M_mulatta300050 -G------TGTCCTGGTGTGC-----TAGGG-CACTTGCAGAGAA-TCTG M_mulatta300264 -AGCT-CTTGTCCTGGTGTGC-----TAGAG-TTCTCGAT--GAA-TCTA M_mulatta300307 -T-TT-ACTTTTTTGATATT----------A-TCCTGGAAGAGTA-ATTG M_mulatta300447 -CAGC-TCTTCTCTAGTGTGC-----TGGAG-TCCTC----AGAA-TCTG M_mulatta300650 -AACT-CTTGTCCTGGTGTGC-----TAGAG-TACTCGAAGAGAA-TCTT M_mulatta300651 -GGCT-ATTGCCTGAGTGTGC-----TAGAG-TCCTCGGAGAGTA-ACTG M_murinus300070 -GGTT-ATTGCCTTAGTGTGT-----TACAG-TCCTTGAAGACTA-ACTG M_murinus300240 -T-TT-ATTGCCTTAGTGTGC-----TAGAG-TCCTCAAAGAGTA-ACTG M_murinus300335 -GGCT-ATTACCTTAGAGTGC-----TAGAG-TCCTTGGAAAGTA-ACTG M_murinus300407 -GGTT-ATTGCCGTAGTGTGC-----TAGAG-TCTTCAAAGAGTA-ACTG M_murinus300442 -A-AA-GCTAACCTAGTGTT-------AGAG-TCCTCGAAGAGTA-ACTG M_murinus300535 -GGTT-ATTGCCTCAGTGTGC-----TAGAG-TCCTCGAAGAGTA-ACTG M_murinus300536 --CACTCTTGTCCTGGTGTGC-----TAGAG-TTCTCGAAGAGAA-TCTG M_domestica300174 -TGCCTGTTGTCGTGGTGTGC-----TAAAG-TCCTCGAAAAGTA-ACAG M_domestica300175 -TGACTGTTGTTTTGGTGTGC-----TAGAG-TCTTCGGAGAAAA-TCTT M_musculus300363 --GGTACTTTCCCTGGTGCTC-----CAGAG-TTCTGGAGGAGGA-TCTA M_musculus300468 --GGTACTTGTCCTGGTGTGC-----TAGAG-TTCTCGAGGAGAA-TCTG M_musculus300761 -GCTT-GTTGCCTTAGTGTGC-----TTAAG-TCCTCGAAGAATA-ACTG M_musculus300762 --GGTGCTTGTCCTGGTGTGC-----TACAG-TTCTCGGAGAGAA-TC-G M_musculus300805 -GCTT-GTTGCCTTAGTGTGC-----TAGAG-TCCTCGAAGAATA-ACTG O_anatinus303418 -CGTTGGTTGTCCCGGTGTGC-----AAGCG-TCCTCGCAGAGAA-TCCC O_anatinus304530 -TTCCCGTTGCCGTGGTGTGC-----TAAAG-TCCTCGAAGAGTA-ACTG O_anatinus304531 -CGTTGGTTGTCTTGGCGTGC-----TAGAG-TCCTCGCAGAGAA-TCCC O_cuniculus300314 -GGCT-ATTGCCTTAGTGTGC-----TACAG-TTCTGGAAGAGTAAC-TG O_cuniculus300324 -AGCT-ATTGCCTTAGTGTGC-----TAGAG-TCCTTGAAGAGTA-AGTG O_cuniculus300471 -GGCT-GTTGCCTTAGTGTGC-----TAGAG-TCCTCGAAGAGTA-ACTG O_cuniculus300472 -AACC-CTTGTCGTGGTGTGC-----TAGCG-TCCTCGGAGAGAA-TCTG O_latipes300060 -GATCGGTTGTCCCGGTGTGC-----TAGAG-TGCTCGCAGAGGA-AAGC O_garnettii300318 -GGTT-ATTGCCCTAGTGTGC-----TAGAG-TCCTCGAAGAGTA-ACTG O_garnettii300380 --AACTCTTGTCCCGGTGTGC-----TAGAG-TCCTTGAAGAGAA-TCTG O_garnettii300494 -GATT-ACTGTCTAAGTGTGC-----TAGAG-TCCTCGAGGAGTA-ACTG O_garnettii300665 -GGTT-ATTGCCTAAGTGTGC-----TAAAG-CCTCCCAAGAGTA-ACTG O_garnettii300719 --AACCCTTGTCCTGGTGTGCTGTACTAGAG-TCCTCGAAGAGAA-TCTG O_garnettii300751 --AACTCTTGTCCTGGTGTGC-----TAGAG-TCCTCGAAGAGAA-TCTG P_troglodytes300077 -CGGC-TCTTCTCCAATGTGC-----TGGAG-TCCTC----AGCA-TCTG P_troglodytes300213 -AGCT-CTTGTCCTGGTGTGC-----TAGAG-TTCTCGAT--GAA-TCTA P_troglodytes300255 -G------TGTCCCGGTGTGC-----TAGGG-CACTTGCAGAGAA-TCTG P_troglodytes300659 -GGCT-ATTGCCTGAGTGTGC-----TAGAG-TCCTCGGAGAGTA-ACTG P_troglodytes300660 -AACT-CTTGTCCTGGTGTGC-----TAGAG-TACTCGAAGAGAA-TCTA P_pygmaeus300144 -G------TGTCCCGGTGTGT-----TAGGG-CACTTGCAGAGAA-TCTG P_pygmaeus300187 -AACT-CTTGTCCTGGTGTGC-----TAGAG-TACTCGAAGAGAA-TCTA P_pygmaeus300188 -GGCT-ATTGCCTGAGTGTGC-----TAGAG-TCCTCGGAGAGTA-ACTG P_pygmaeus300218 -A------GCTCTTGGTGTGC-----TACTG-TACTTGGAGAGAA-TCTA P_pygmaeus300363 -TGGC-TCTTCTCCAATGTGC-----TGGAG-TCCTC----AGAA-TCTG P_pygmaeus300381 -AGCT-CTTGTCCTGGTGTGC-----TAGAG-TTCTCGAT--GAA-TCTA R_norvegicus300055 --GGCACTTATCCTGGCGTGC-----TAGAG-CTCTTGAAGAAAA-TCTG R_norvegicus300554 -AGCA-TATGTCCTGGTGAA------TAGAA-TTCTCTGAGAGAA-TCTG R_norvegicus300893 -GGCA-CTTGTCCTGGTGTGC-----TAGAG-TTCTCGTAGAAAA-TCTG R_norvegicus301086 -GCTT-GTTGCCTCAGTGTGC-----TAGAG-TCCTCGAAGAAAA-ACTA R_norvegicus301087 -GGCA-CTTGTCCTGGTGTGC-----TAGAG-TTCTCGTAGAAAA-TCTG S_cerevisiae300047 AGAGATTCTGTTTCGACAGTTTTTTTAGGCGGTGGACGTATATAG-TTTA S_araneus300033 ----T-CTGGACCCAGAGTGC-----TACAG-TTCTCAAG-AGAA-TCTG S_araneus300174 ---CC-ATTGATT-GGTGTGC-----TACAG-TGCTCGAGGAGTA-ACTG S_araneus300423 ---CC-GTCGCCTCGGTGTTT-----GGGAG-TCCTCAGAGAGTC-ACCG S_araneus300520 ---CG-GTTGCCCTGGGGTGC-----TAGAG-TCCTCAGAGAGTC-ACTG S_araneus301030 ---CT-GTTGCCTTGGTGTGC-----TAGAG-TCCTCGAAGAGTA-ACTG S_araneus301031 --CTTGCTTGTCCTGGTGTGC-----TAGAG-TTCTCGGAGAGAA-TACG S_tridecemlineatus300109 -AGGA-CTTGTCCTGGTGTGC-----CACAG-TTCTCGGAGAGAA-TTTC S_tridecemlineatus300140 -AGAA-CATGTCCTGGTGTGC-----TACAG-ATCTCAGAGAGAA-TTTG S_tridecemlineatus300239 -AGCA-CTTGTCCTGTTGTAC-----TAGAG-TCCTAAGACAAAA-TCAG S_tridecemlineatus300296 --GGCTCTTGTCCTGATGTGC-----TGGAG-TCCTTGGAGAGGA-TCTG T_nigroviridis300121 -GATTTGTTGGCCTGGTGTGC-----TATAG-ACCTCGCAGAGAA-AA-T T_nigroviridis300122 -GCCCG-TTGTCCTGGTGTGC-----TAGAG-CACTCGCAGAGGA-AA-T T_belangeri300062 -AGCTATTTGTCCCGGTGTGC-----TAGAG-TTCTCAGAGAGAA-TCTC T_belangeri300199 -CACA-GTTGCCTTAGTGTGC-----TAGAG-CCCTCTGAGAATA-ACTG T_belangeri300211 -ACCT-CTTGTCCTGGTGTGC-----TTGAG-TTCTGGTAGAGAA-CATG T_belangeri300426 -CACT-GTTGCCTTAGTGTGC-----TAGAG-CCCTCGGAGAGTA-ACGG T_belangeri300427 -AGCT-CTTGTCCCGGTGTGC-----TAGAG-TTCTCGGAGAGAA-TCTC X_tropicalis300005 --TCTGATTGCCTTGGTGTGC-----TAGAG-TACTCGGAGATAA-ACTA X_tropicalis300014 --TCTGATTGCCTTGGTGTGC-----TAGAG-TACTCGGAGATAA-ACTA X_tropicalis300015 --CCTTATTGTTTTGGTGTGC-----TAGAG-TTCTCGGAGAGAA-ATTA X_tropicalis300060 --TCTGATTGCCTTGGTGTGC-----TAGAG-TACTCGGAGATAA-ACTA X_tropicalis300130 --CCTTATTGTTTTGGTGTGC-----TAGAG-TTCTCGGAGAGAA-ATTA C_elegans300088 GTCGTATTATGCAAGTAGGGCTTG-----------------CTTTTGCGC C_elegans300111 GGTACTTTATGCAAACAGTTCTTG-----------------CGTT-ATGC C_familiaris300475 CT-G-ACCTTATTCACTGG-CTGT---------------GACCCTTATG- C_familiaris300476 CT-GGTCTTGATTCACTGGCGAGGG---------------CAGTTGGTG- C_porcellus300091 CT-G-ACCTTATTCACTGA-CTGT---------------GAGCTTTGTG- C_porcellus300433 CT-G-ACCTTATTCACTGG-CTGT---------------GGACTTCGTG- C_porcellus300925 CT-GACCTTGATTCACTGGCGGGGG---------------CAATGAGTG- D_rerio300042 CTCTCTGCTTATTCATTGGCTGCTGC--------------TTTCC-ATT- D_rerio300043 CTCTGTACTTATTCATTGGCTGCTGC--------------TTTCC-ATT- D_rerio300044 ATCTCTGCTTATTCATTGGCTGCTGC--------------TTTCC-ATT- D_rerio300045 TTCTGTGCTTATTCGTTGGCTGCTGC--------------TTTCC-ATT- D_novemcinctus300155 CT-GATCTTGATTCACTGGTGGGGGTGGGGAGTGGGGCGGTGATTAGTG- D_novemcinctus300183 CT-G-ACCTTATTCACTGG-CTGT---------------CAGCCTAATG- D_novemcinctus300320 CT-G-GCCTTATTCCCTGG-CTGT---------------GACCCTCATG- D_novemcinctus300454 CT-GGTCTTGATTCACTG----------------------------GTG- D_novemcinctus300517 CT-G-ACCTTATTCACTGG-CTGT---------------GACCCTCATG- D_novemcinctus300576 CT-G-ACCTTATTCACTGG-CTGT---------------AACCCTCATG- E_telfairi300057 CT-T-ACCCGATTCACTGG-CTGT---------------GTGTCTCGTG- E_telfairi300207 CT-GGCCTGGATCCACTGGTGGGG----------------CAAACAGTG- E_telfairi300294 CT-G-ATCTTATTCACTGG-CTGT---------------GCGTCTCGTG- E_telfairi300308 CT-GGCCTTGACCTATTGGTGGGG----------------CAGACAGTG- E_telfairi300334 CT-G-ACCTTATTCACTGG-CTGT---------------GCGTCTTGTG- E_telfairi300366 CT-GGTCTTGATTCACTGGCAGGG----------------CAGTCAGTG- E_telfairi300483 CT-GGCCTTGATTCCCTGGTGGGG----------------CAAACAAGG- E_telfairi300502 CT-GGACCTTATTCACCGGGCTGT---------------GCGTCTCGTG- E_telfairi300786 CT-G-ACCTTATTCACTGG-CTGT---------------GCGTCTCGTG- E_telfairi300787 CT-GGCCTTGATTCACTGGTGGGG----------------CAATCAATG- E_caballus300178 CT-GCTCTTGATTCACCAGTGAGGG---------------CAATCAGTG- E_caballus300307 CT-G-ACCTTATTCACTGG-CTGT---------------GGCCCTCGTG- E_caballus300308 CT-GGTCTTGATTCACTGGCGAGGG---------------CAGTCTGTG- E_europaeus300120 CT-G-GCCTTATTCACTGG-CTGT----------------GGCCCCATG- E_europaeus300121 CT-G-GCCTTATTCGCTGG-CTGT----------------GGCCCCATG- E_europaeus300131 CT-G-ACCTTATTCTCTTG-CTAT---------------GGCCCTCCTG- E_europaeus300149 CT-G-GCCTTATTCGCTGG-CTGT----------------GGCCCCGTG- E_europaeus300165 CT-G-ACCTTATTCTCTTG-CTGT---------------GGCCTTCCTG- E_europaeus300173 CT-G-GCCTTATTCACTGG-CTGC----------------GGCCCCGTG- E_europaeus300180 CT-G-ACCTTATTCTCTTG-CTGT---------------GGCCTTCCTG- E_europaeus300222 CT-G-ACATTATTCACTGG-CTGT---------------GGCCCTCATG- E_europaeus300231 CT-G-ACCTTATTCTCTTG-CTAT---------------GGCCCTCCTG- E_europaeus300258 CT-G-ACCTTATTCTCTTG-CTAT---------------GGCCCTCCTG- E_europaeus300274 CT-G-ACCTTATTCTCTTG-CTAT---------------GGCCCTCCTG- E_europaeus300324 CT-G-GCCTTATTCACTGG-CTGT----------------GACCCCGTG- E_europaeus300371 CT-G-ACCTTATTCTCTTG-CTAT---------------GGCCCTCCTG- E_europaeus300387 CT-G-ACCTTATTCTCTTG-CTAT---------------GGCCCTCCTG- E_europaeus300435 CT-A-ACCTTATTCACTGG-CTGT---------------GGCCCTCATG- E_europaeus300442 CT-G-GCCTCATTCGCTGG-CTGT----------------GGCCCCATG- E_europaeus300463 CT-G-ACCTTATTCTCTTG-CTGT---------------GGCCTTCCTG- E_europaeus300486 CT-G-ACCTTATTCTCTTG-CTAT---------------GGCCCTCCTG- E_europaeus300585 CT-G-GCCTTATTCGCTGG-CTGT----------------GGCCGTGTG- E_europaeus300594 CT-G-GCCTTATTCGCTGG-CTAT----------------GGCTCTGTG- E_europaeus300620 CT-G-GCCTTATTCCCTGG-CTGT----------------GGCCCCGTG- E_europaeus300667 CT-G-ACCTTATTCTCTTG-CTGT---------------GGCCTTCCTG- E_europaeus300722 CT-G-GCCTTATTCGCTGG-CTGT----------------GGCCCCGTG- G_aculeatus300111 CT-GCTCCT-ATTCACCGACTGGCC--------------CTTTTTCGTA- G_aculeatus300112 GTCTTTGCTTATTCATTGGCTGTAGT--------------CTTGTTGTG- G_aculeatus300113 GTCTTTGCTTATTCATTGGCTGTAGT--------------CTTGTTGTG- H_sapiens300733 CT-G-ACCTTATTCACTGG-CTGT---------------GGGCCTTATG- H_sapiens300734 CT-GGTCTTGATTCACTGGTGGGGG---------------CAGTCGGTG- L_africana300488 CT-GGTCTTGATTCATTGGTGGGG----------------CAGTCAGTG- M_mulatta300050 CT-GGTCTTGATTCACTGGTGGAGA---------------CAATCG---- M_mulatta300264 CT-GGTCTTGATTCACTGGCAAAGA---------------CAATCAGCG- M_mulatta300307 CT-G-ACCTTATTCACTGG-CAGT---------------GGGCCTTATG- M_mulatta300447 CT-GGTCTTGATTCACTGATGGGGG---------------CAACCAGTG- M_mulatta300650 CT-GGTCTTGATTCACTGGTGGGGG---------------CAGTTGGTG- M_mulatta300651 CT-G-ATCTTATTCACTGG-CTGT---------------GGGCCTTATG- M_murinus300070 CT-G-ACCCTATTCACTGG-CTAT---------------GGTCCTCATG- M_murinus300240 CT-G-ACCTTGTTAACTGG-CTGT---------------GGCTCCCATG- M_murinus300335 CT-G-ACCTTGTTCACTGG-CTAT---------------GGCCCTCATG- M_murinus300407 CT-G-AACTTATTCATTGG-CTGT---------------GGCCCTCATG- M_murinus300442 CT-G-ACCTTATTCACTGT-CTGT---------------GCCCCTCATG- M_murinus300535 CT-G-ACCTTATTCACTGG-CTGT---------------GGTCCTCATG- M_murinus300536 CT-GGTCTTGATTCACTGGCGGGGG---------------CAATCAGTG- M_domestica300174 CT-A-ACTCTATTCACTGG-CTGGT--------------C-ATCTTGTG- M_domestica300175 CT-GACCTTTATTCACTGGCCTTGG---------------CATCTGGTG- M_musculus300363 CA-GGTCTTGATTCACTGGTGGAAG---------------TCTTCAGTG- M_musculus300468 CT-GGTCTTGATTTATTGGTAGGGG---------------CCTTCAGTG- M_musculus300761 CT-G-ACCTTATTCACTGG-CTGTGT-------------GGACTTTCTG- M_musculus300762 CT-GGTCTTGATTCATTGGTAGGGG---------------CCTTCAGTG- M_musculus300805 CT-G-ACCTTATTCACTGG-CTGT---------------GGACTTTCTG- O_anatinus303418 CG-GCTCTTTATTCACCGGCTGAGG------------------------- O_anatinus304530 CT-C-TCTCTATTCACTGG-CTGTT--------------CGATCTCGTG- O_anatinus304531 CCTGCTCTTTATTCACCGGCCGAGGGC-------------CGTCCCGTG- O_cuniculus300314 CT-G-ACCTTATTCACTGG-CTGC---------------GGGCCTCGTG- O_cuniculus300324 TT-G-ATTTTATTCACTGG-CTGT---------------AGGCCTCAAG- O_cuniculus300471 CT-G-ACCTTATTCACTGG-CTGT---------------GGGCCTCATG- O_cuniculus300472 CT-GGTCTTGATTCACTGGTGGGG----------------CAGCCAGTG- O_latipes300060 ATCTCTGCTTATTCGTTGACTGAAGT--------------CTCAT-GTG- O_garnettii300318 CT-G-TCCTTATTCACTGG-CTGT---------------GGCCCTGATG- O_garnettii300380 CT-GGTCTTGATTCACTGGCAGGGG---------------CAATCAGTG- O_garnettii300494 CT-G-ACCTGACCCGCTGG-CTCT---------------GGCCCTCATG- O_garnettii300665 CT-G-ACCTTATTTGCTGG-TGGT---------------GGCCCTCATG- O_garnettii300719 CT-GGTCTTGATTCACTAGCAGGGG---------------AAATCAGTG- O_garnettii300751 CT-GGTCTTGATTCACTGGCAGGGG---------------CAGTCAGTG- P_troglodytes300077 CT-GGTCTTGATTCACTGATGGGGG---------------CAACCAGTG- P_troglodytes300213 CT-GGTCTTGATTCACTGGCAGGAG---------------CAAACAGTG- P_troglodytes300255 CT-GGTCTTGATTCACTGGTGGGGG---------------CAATCG---- P_troglodytes300659 CT-G-ACCTTATTCACTGG-CTGT---------------GGGCCTTATG- P_troglodytes300660 CT-GGTCTTGATTCACTGGTGGGGG---------------CAGTCGGTG- P_pygmaeus300144 CT-GGTCTTGATTCACTGGTGGGGG---------------CAATCG---- P_pygmaeus300187 CT-GGTCTTGATTCACTGGTGGGGG---------------CAGTCGGTG- P_pygmaeus300188 CT-G-ACCTTATTCACTGG-CTGT---------------GGGCCTTATG- P_pygmaeus300218 CT-TGTCTTGATTCACTGGTGGGGG---------------CAGTCGTTG- P_pygmaeus300363 CT-GGTCTTGATTCACTGATGGGGG---------------CAACCAGTG- P_pygmaeus300381 CT-GGTCTTGATTCACTGGCAGGAG---------------CAATCAGTG- R_norvegicus300055 CT-GGTCTTCATTCACTGATAGGCG---------------TCTTCAGTG- R_norvegicus300554 CT-GGTCTTGGTACACTGGAAGGGA---------------CACCCAGTG- R_norvegicus300893 CT-GGTCTTGATTCACTGGTAGGGG---------------CTTTCAGTG- R_norvegicus301086 CT-G-ACCTTATTCACTGG-CTGT---------------GGACTTTATG- R_norvegicus301087 CT-GGTCTTGATTCACTGGTAGGGG---------------CTTTCAGTG- S_cerevisiae300047 CTTAATCGTTTACTATACGGTGGAGTACTAATACTATTTCACTGTCGTGC S_araneus300033 CT-GGTCTTGATTCACTGGCAGGGG---------------CAACTAGTG- S_araneus300174 CT-G-ACCGTATTCACTGG-CTGT---------------TGCCCTCACG- S_araneus300423 CT-G-ACCGTACTCACTGG-CCGT---------------GGCCCTCGGG- S_araneus300520 CT-G-ACCTTATTCACCAG-CTGT---------------GGCCCTCATG- S_araneus301030 CT-G-ACCTTATTCACTGG-CTGT---------------GGCCCTCATG- S_araneus301031 CT-GATCTAGATTCACTGGCGGAGG---------------CAACCAGTG- S_tridecemlineatus300109 CT-GGTTTTGATTCACTGGAGGGGA---------------CAGTTAATG- S_tridecemlineatus300140 CT-GGTCTTGATTCACTAGTGGGGAGGAAG--------GGTAGTCAGTG- S_tridecemlineatus300239 CT-GGCCTTGATTCACTGGTAGGGG---------------CAATCCAGG- S_tridecemlineatus300296 CT-GATCTTGATTCACTGGTGGAGG---------------CAATCAGTG- T_nigroviridis300121 GTCTTTGTTTATTCATTGACTGTAGT--------------CT-GTTATG- T_nigroviridis300122 --CTTTGCTTATTCATTG-------------------------------- T_belangeri300062 TT-GGTCTTGATTCACTGGTGGGGGTG---------------GTCAGTG- T_belangeri300199 CT-G-GCCTTACTCGCTAG-CTGT---------------GGGCCTTGTG- T_belangeri300211 CT-GGTCTTGACTCGCTAGTGGGGGCA---------------ATCGATG- T_belangeri300426 CT-G-GCCTTATTCACTGG-CTGT---------------GGGCCTCGTG- T_belangeri300427 CT-GGTCTTGATTCACTGGTGGGGGCA---------------GTCAGTGG X_tropicalis300005 CT-GGTCTTTATTCACTGTTTGGAT--------------GTCATT-GTC- X_tropicalis300014 CT-GGTCTTTATTCACTGTTTGGAT--------------GTCATT-GTC- X_tropicalis300015 CT-GATCTTTATTCACTGATTGGTT--------------CTCTAT-GTA- X_tropicalis300060 CT-GGTCTTTATTCACTGTTTGGAT--------------GTCATT-GTC- X_tropicalis300130 CT-GATCTTTATTCACTGATTGGTT--------------CTCTAT-GTA- C_elegans300088 TCCCCGACTTCACCTCATTCCCAAACATTT-------------------- C_elegans300111 TCATCTGTTTCACCTCCGTTTCTGACAAAA-------------------- C_familiaris300475 GCATAGTCAGTCACCAGGTTAGTGACATGC-------------------- C_familiaris300476 CCCCCGGTAGTGCCCAGATCAGAAACATGT-------------------- C_porcellus300091 GCACAGTCAGTTACTACGGCAGTAACATGT-------------------- C_porcellus300433 GCACAGTCAGCCTCCAGGGTAGTAACATGC-------------------- C_porcellus300925 CCCCCGTTAGCGCCCAGGTCAGGAACATCC-------------------- D_rerio300042 GCCCAGCCAATCACCAGCTCTGAAACATGC-------------------- D_rerio300043 GCCCAGCCAATCACCAGCTCAGAGACATGC-------------------- D_rerio300044 GCTAGGCCAATCACCAGCTCAGAAACATCC-------------------- D_rerio300045 GCCCAGCCAGTCACCAGCTCAGAAACATGC-------------------- D_novemcinctus300155 CCCCTGCCAGTCCCCTGATCAGAAACATTT-------------------- D_novemcinctus300183 GCATAGTCAGTCACCAGGTCAGTGACAAAT-------------------- D_novemcinctus300320 GCATAGTCAGTCACCAGGTCAGTGACAAGT-------------------- D_novemcinctus300454 TCCCCATTAGTGCCCTGATCCTAAACATGG-------------------- D_novemcinctus300517 GCATAGTCAGTCACCAGATCAGTGACAAGT-------------------- D_novemcinctus300576 GCATAGTCAGTCACCAGGTCAGTGACAAGT-------------------- E_telfairi300057 GCACAGTCAGTCACCAAGTAAGCGACATGC-------------------- E_telfairi300207 CCTCCACTAGTGCCCTGGTCAGAAACATGC-------------------- E_telfairi300294 GCACAGTCAGTCACCAGTGTAGCGACATGC-------------------- E_telfairi300308 CCTCCACGAGTGCCCTGCTCAGAAACGTGC-------------------- E_telfairi300334 GCACTGTCAGTCACCAGGTTAGCGACATGC-------------------- E_telfairi300366 TCCTGGCTAGTGCCCTGGTCAGAAAGGTGC-------------------- E_telfairi300483 CCTCCACTAGCGCCCTGCTCAGAAACATGC-------------------- E_telfairi300502 GCACACTCAGTCACCAGGTTAGCGACATGC-------------------- E_telfairi300786 GCACAGTCAGTCACCAGGTTAGCCACATGC-------------------- E_telfairi300787 CCTCCACTAGTGCCCTGGTCAGAAACATGC-------------------- E_caballus300178 CCCCCAGTAGTGCCCAGATCAGAG-CATGT-------------------- E_caballus300307 GCACAGTCAGTCACCGGGTTAGTGACATGT-------------------- E_caballus300308 CCCCCACTAGTGCCCAGATCAGAAACATGC-------------------- E_europaeus300120 GCCGAGCCAGTCACCAGGCCAAGGACAGGG-------------------- E_europaeus300121 GCCGATCCAGTCACCAGGCCAGGGACAGGC-------------------- E_europaeus300131 GCATAGTCAA----CAGGGCAGGGACATGC-------------------- E_europaeus300149 GCCGGGCCGGTCACCAGGCCGGTGACAGGT-------------------- E_europaeus300165 GCATAGTCAGTCACCAGGGCAGGGATATGC-------------------- E_europaeus300173 GCCGAGCCGGTCACCAGGCAAGGGACAAGC-------------------- E_europaeus300180 GCATAGTCAGTCACCAGGGCAGGGATATGC-------------------- E_europaeus300222 CTATAGCCAGGCGTCAGGTTAGTGACATGT-------------------- E_europaeus300231 GCATAGTCAA----CAGGGCAGGGACATGC-------------------- E_europaeus300258 GCATAGTCAA----CAGGGCAGGGACATGC-------------------- E_europaeus300274 GCATAGTCAA----CAGGGCAGGGACATGC-------------------- E_europaeus300324 GCCGAACTGGTCAACAGGCCAGGGACAGGC-------------------- E_europaeus300371 GCATAGTCAA----CAGGGCAGGGACATGC-------------------- E_europaeus300387 GCATAGTCAA----CAGGGCAGGGACATGC-------------------- E_europaeus300435 GCACAGTCAGCCACCAGGTTAGTTACATAT-------------------- E_europaeus300442 GCCGAGCCAGTCACCAGGCCAGAGACAAGT-------------------- E_europaeus300463 GCATAGTCAGTCACCAGGGCAGGGATATGC-------------------- E_europaeus300486 GCATAGTCAA----CAGGGCAGGGACATGC-------------------- E_europaeus300585 GCCTGGCTGGTCACCAGGCCAGGAACAGGT-------------------- E_europaeus300594 GCCGAGCCGGTCTCCAGGCCAGGGACAGGC-------------------- E_europaeus300620 GCCGGGCCGGTCACCAGGCCAGGGACAGGC-------------------- E_europaeus300667 GCATAGTCAGTCACCAGGGCAGGGGCATGC-------------------- E_europaeus300722 GCCGAGCCAGTCACCAGGCCAGGGACAGGC-------------------- G_aculeatus300111 GGGCAGTCACCCACATGGTCAGTTACAAAC-------------------- G_aculeatus300112 ACCCAGTCAACCACCGACTCAGACACATTA-------------------- G_aculeatus300113 ACCCAGTCAACCACCAACTCAGACACATTA-------------------- H_sapiens300733 GCACAGTCAGTCACCAGGTTAGAGACATGC-------------------- H_sapiens300734 CCCCCGTTAGTGCCCAGATCAGAAACATAC-------------------- L_africana300488 CCCCTACTAGTGCCCTGGTCAGAAACATGC-------------------- M_mulatta300050 ---------GCGCCCAGATTAGAAACATGC-------------------- M_mulatta300264 GCTATGTCAGTACAAGTATCTAAAACATGG-------------------- M_mulatta300307 GCACAGTGAATCACCAGGTTAGAGACACGT-------------------- M_mulatta300447 TCCCCTTA-GTGTCCGGG-CAGAAACATAC-------------------- M_mulatta300650 CCCCCATTAGTGCCCAGATCAGAAACATAC-------------------- M_mulatta300651 GCACAGTCAGTCACCAGGTTAGAGACATGC-------------------- M_murinus300070 GCACAGTCA----CCAGGTTAGTAACATCC-------------------- M_murinus300240 GCAGAGTCAGTCTCCAGGTCAGTGACATGC-------------------- M_murinus300335 GCACAGTCAGTCACCAGGTTAGTGACATGC-------------------- M_murinus300407 GCATATTCAGTTACCAGGTTAGTGACATGC-------------------- M_murinus300442 ACACAATCAGTCACCAGTCTAGTGACATGC-------------------- M_murinus300535 GCACAGTCAGTCACCAGGTTAGTAACATCC-------------------- M_murinus300536 CCCCCATTAGTGCCCAGGTCAGTAACACAT-------------------- M_domestica300174 ATCCACTCAGTCACCGGGTTAGGAATAAAA-------------------- M_domestica300175 CCACAGTCAGTCACCGGGTCAGTTACATTG-------------------- M_musculus300363 CCCCTGTTAGTACCCAGACCAGAAACATGT-------------------- M_musculus300468 TCCCTTCTAGTGCCCAGATCAGAAACATGG-------------------- M_musculus300761 GCACAGTCAGTCACCAGGTTAGTGACATAT-------------------- M_musculus300762 TCCCTTCTAGTGCCCAGATCAGAAACATGG-------------------- M_musculus300805 GCACAGTCAGTCACCAGGTTAGTGACATCC-------------------- O_anatinus303418 ----------TCACCGGATCGGGAACGTCA-------------------- O_anatinus304530 GTGCAGTCAGTCACCGGGTTAGTAACATCG-------------------- O_anatinus304531 CCTCGGCCGGTCACCGGATCGGGAACATCG-------------------- O_cuniculus300314 GCACAGCCAGTCACCA-GGTAGTGACATAT-------------------- O_cuniculus300324 GCACAGTCAGTCACCAGGTTAGTGACAGAC-------------------- O_cuniculus300471 GCACAGTCAGTCACCAGGTTAGTGACATAC-------------------- O_cuniculus300472 CCCGCGTTAGTGCCCAGATCAGAAACATGC-------------------- O_latipes300060 ACCCAGCCAATCACCAGCTCAGATACATCA-------------------- O_garnettii300318 GCACAGTCAGTCACCAGGTTAGTGACATGG-------------------- O_garnettii300380 CCCCCGTTAGTGCCCAGATCAGTAACATTC-------------------- O_garnettii300494 GCACAGCCAGTCAGCAGGCGAGTGACAGGG-------------------- O_garnettii300665 GCACAGTCAGTCACCAGGTTAGTGATATGG-------------------- O_garnettii300719 CCCCTGTTAGTGCCCAGATCAGTAACATTC-------------------- O_garnettii300751 CCCCTGTTAGTGCCCAGATCAGTAACATTC-------------------- P_troglodytes300077 TCCCCTTAAGTGTCCGGG-CAGAAACATAC-------------------- P_troglodytes300213 ACTGTGTTAGTATGCGTATCTAAAACATGG-------------------- P_troglodytes300255 ---------GTGCCCAGATTATGAACATGC-------------------- P_troglodytes300659 GCACAGTCAGTCACCAGGTTAGAGACATGC-------------------- P_troglodytes300660 CCCCCGTTAGTGCCCAGATCAGAAACATAC-------------------- P_pygmaeus300144 ---------GTGCCCAGATTAGAAACATGC-------------------- P_pygmaeus300187 CCCCCATTAGTGCCCAGATCAGAAACATAC-------------------- P_pygmaeus300188 GCACAGTCAGTCACCAGGTTAGAGACATGC-------------------- P_pygmaeus300218 CTTCCTTTAGTGCCCAGATCAGAAACATAC-------------------- P_pygmaeus300363 TCCCCTTA-GTGTCCGGG-AAGAAACATAC-------------------- P_pygmaeus300381 GCTGT--TAGTATGCATATCTAAAACATGG-------------------- R_norvegicus300055 TCCCTGTTAGTGCCCAGATTAGAAACATGT-------------------- R_norvegicus300554 -CCTTGTTAGTGACCAGTGCAGAAAAATGT-------------------- R_norvegicus300893 ACCCCATTAGTGCTCAGATCAGAAACATAA-------------------- R_norvegicus301086 GCGCAGTCAGTCACCAGGTTAGTGACATAC-------------------- R_norvegicus301087 ACCCCATTAGTGCTCAGATCAGAAACATAA-------------------- S_cerevisiae300047 TCGCGGTTGAT--CTTAGATAAATATATTTCTTTTTCATAAAGAAAGTGA S_araneus300033 CCCTGGTTAGTGCCGAGGTCAGAAACATCC-------------------- S_araneus300174 GCATAGGCATTCACCCGATTAGTCGCAGGT-------------------- S_araneus300423 GCATAGTCGGTCACCGGGTTAGTGACATGT-------------------- S_araneus300520 GCATAGCCAGTCACCAGGTTAGTGACATGT-------------------- S_araneus301030 GCACAGTCGGTCACCGGGTTAGTGACATGT-------------------- S_araneus301031 CCTCCGTTAGTGCCCAGGTCAGAAACATGC-------------------- S_tridecemlineatus300109 TCCACATAACTGCCCAGATCAGAAAAGTAG-------------------- S_tridecemlineatus300140 TCTTCATTAGTGCCCAGATCAGAAACATAC-------------------- S_tridecemlineatus300239 TAAAA---AACATGA----------------------------------- S_tridecemlineatus300296 CCCCAGTTAGTACCCAGGTCAGAAACATGC-------------------- T_nigroviridis300121 GTCCAGTCAATCACCAACTCAGATACACGA-------------------- T_nigroviridis300122 -------------------------------------------------- T_belangeri300062 TTCCTGCTAGTGCCCA-ATCAGAAACATGT-------------------- T_belangeri300199 GCGCAGTCA----CCGGGTTAGTGACAGGC-------------------- T_belangeri300211 CCCCTGCCAGGGCCCAGATTGGAAATATAT-------------------- T_belangeri300426 GCACAGTCAGTCACCAGGTTAGTGACATGC-------------------- T_belangeri300427 TCCCTGCTAGTGCCCAGATCAGAAACATGT-------------------- X_tropicalis300005 TTCCAACCAGCCACCTGTTCAGTGACAAGT-------------------- X_tropicalis300014 TTCCAACCAGCCACCTGTTCAGTGACAAGT-------------------- X_tropicalis300015 GCTCAATCAGTCACCGGTTCAGTGACATGT-------------------- X_tropicalis300060 TTCCAACCAGCCACCTGTTCAGTGACAAGT-------------------- X_tropicalis300130 GCTCAATCAGTCACCGGTTCAGTGACATGT-------------------- C_elegans300088 -------------------------------------------------- C_elegans300111 -------------------------------------------------- C_familiaris300475 -------------------------------------------------- C_familiaris300476 -------------------------------------------------- C_porcellus300091 -------------------------------------------------- C_porcellus300433 -------------------------------------------------- C_porcellus300925 -------------------------------------------------- D_rerio300042 -------------------------------------------------- D_rerio300043 -------------------------------------------------- D_rerio300044 -------------------------------------------------- D_rerio300045 -------------------------------------------------- D_novemcinctus300155 -------------------------------------------------- D_novemcinctus300183 -------------------------------------------------- D_novemcinctus300320 -------------------------------------------------- D_novemcinctus300454 -------------------------------------------------- D_novemcinctus300517 -------------------------------------------------- D_novemcinctus300576 -------------------------------------------------- E_telfairi300057 -------------------------------------------------- E_telfairi300207 -------------------------------------------------- E_telfairi300294 -------------------------------------------------- E_telfairi300308 -------------------------------------------------- E_telfairi300334 -------------------------------------------------- E_telfairi300366 -------------------------------------------------- E_telfairi300483 -------------------------------------------------- E_telfairi300502 -------------------------------------------------- E_telfairi300786 -------------------------------------------------- E_telfairi300787 -------------------------------------------------- E_caballus300178 -------------------------------------------------- E_caballus300307 -------------------------------------------------- E_caballus300308 -------------------------------------------------- E_europaeus300120 -------------------------------------------------- E_europaeus300121 -------------------------------------------------- E_europaeus300131 -------------------------------------------------- E_europaeus300149 -------------------------------------------------- E_europaeus300165 -------------------------------------------------- E_europaeus300173 -------------------------------------------------- E_europaeus300180 -------------------------------------------------- E_europaeus300222 -------------------------------------------------- E_europaeus300231 -------------------------------------------------- E_europaeus300258 -------------------------------------------------- E_europaeus300274 -------------------------------------------------- E_europaeus300324 -------------------------------------------------- E_europaeus300371 -------------------------------------------------- E_europaeus300387 -------------------------------------------------- E_europaeus300435 -------------------------------------------------- E_europaeus300442 -------------------------------------------------- E_europaeus300463 -------------------------------------------------- E_europaeus300486 -------------------------------------------------- E_europaeus300585 -------------------------------------------------- E_europaeus300594 -------------------------------------------------- E_europaeus300620 -------------------------------------------------- E_europaeus300667 -------------------------------------------------- E_europaeus300722 -------------------------------------------------- G_aculeatus300111 -------------------------------------------------- G_aculeatus300112 -------------------------------------------------- G_aculeatus300113 -------------------------------------------------- H_sapiens300733 -------------------------------------------------- H_sapiens300734 -------------------------------------------------- L_africana300488 -------------------------------------------------- M_mulatta300050 -------------------------------------------------- M_mulatta300264 -------------------------------------------------- M_mulatta300307 -------------------------------------------------- M_mulatta300447 -------------------------------------------------- M_mulatta300650 -------------------------------------------------- M_mulatta300651 -------------------------------------------------- M_murinus300070 -------------------------------------------------- M_murinus300240 -------------------------------------------------- M_murinus300335 -------------------------------------------------- M_murinus300407 -------------------------------------------------- M_murinus300442 -------------------------------------------------- M_murinus300535 -------------------------------------------------- M_murinus300536 -------------------------------------------------- M_domestica300174 -------------------------------------------------- M_domestica300175 -------------------------------------------------- M_musculus300363 -------------------------------------------------- M_musculus300468 -------------------------------------------------- M_musculus300761 -------------------------------------------------- M_musculus300762 -------------------------------------------------- M_musculus300805 -------------------------------------------------- O_anatinus303418 -------------------------------------------------- O_anatinus304530 -------------------------------------------------- O_anatinus304531 -------------------------------------------------- O_cuniculus300314 -------------------------------------------------- O_cuniculus300324 -------------------------------------------------- O_cuniculus300471 -------------------------------------------------- O_cuniculus300472 -------------------------------------------------- O_latipes300060 -------------------------------------------------- O_garnettii300318 -------------------------------------------------- O_garnettii300380 -------------------------------------------------- O_garnettii300494 -------------------------------------------------- O_garnettii300665 -------------------------------------------------- O_garnettii300719 -------------------------------------------------- O_garnettii300751 -------------------------------------------------- P_troglodytes300077 -------------------------------------------------- P_troglodytes300213 -------------------------------------------------- P_troglodytes300255 -------------------------------------------------- P_troglodytes300659 -------------------------------------------------- P_troglodytes300660 -------------------------------------------------- P_pygmaeus300144 -------------------------------------------------- P_pygmaeus300187 -------------------------------------------------- P_pygmaeus300188 -------------------------------------------------- P_pygmaeus300218 -------------------------------------------------- P_pygmaeus300363 -------------------------------------------------- P_pygmaeus300381 -------------------------------------------------- R_norvegicus300055 -------------------------------------------------- R_norvegicus300554 -------------------------------------------------- R_norvegicus300893 -------------------------------------------------- R_norvegicus301086 -------------------------------------------------- R_norvegicus301087 -------------------------------------------------- S_cerevisiae300047 GTGGATCTTCCCTGGAAGTACGAATAATGTACTTATGATTAGATTCTCTT S_araneus300033 -------------------------------------------------- S_araneus300174 -------------------------------------------------- S_araneus300423 -------------------------------------------------- S_araneus300520 -------------------------------------------------- S_araneus301030 -------------------------------------------------- S_araneus301031 -------------------------------------------------- S_tridecemlineatus300109 -------------------------------------------------- S_tridecemlineatus300140 -------------------------------------------------- S_tridecemlineatus300239 -------------------------------------------------- S_tridecemlineatus300296 -------------------------------------------------- T_nigroviridis300121 -------------------------------------------------- T_nigroviridis300122 -------------------------------------------------- T_belangeri300062 -------------------------------------------------- T_belangeri300199 -------------------------------------------------- T_belangeri300211 -------------------------------------------------- T_belangeri300426 -------------------------------------------------- T_belangeri300427 -------------------------------------------------- X_tropicalis300005 -------------------------------------------------- X_tropicalis300014 -------------------------------------------------- X_tropicalis300015 -------------------------------------------------- X_tropicalis300060 -------------------------------------------------- X_tropicalis300130 -------------------------------------------------- C_elegans300088 ----------- C_elegans300111 ----------- C_familiaris300475 ----------- C_familiaris300476 ----------- C_porcellus300091 ----------- C_porcellus300433 ----------- C_porcellus300925 ----------- D_rerio300042 ----------- D_rerio300043 ----------- D_rerio300044 ----------- D_rerio300045 ----------- D_novemcinctus300155 ----------- D_novemcinctus300183 ----------- D_novemcinctus300320 ----------- D_novemcinctus300454 ----------- D_novemcinctus300517 ----------- D_novemcinctus300576 ----------- E_telfairi300057 ----------- E_telfairi300207 ----------- E_telfairi300294 ----------- E_telfairi300308 ----------- E_telfairi300334 ----------- E_telfairi300366 ----------- E_telfairi300483 ----------- E_telfairi300502 ----------- E_telfairi300786 ----------- E_telfairi300787 ----------- E_caballus300178 ----------- E_caballus300307 ----------- E_caballus300308 ----------- E_europaeus300120 ----------- E_europaeus300121 ----------- E_europaeus300131 ----------- E_europaeus300149 ----------- E_europaeus300165 ----------- E_europaeus300173 ----------- E_europaeus300180 ----------- E_europaeus300222 ----------- E_europaeus300231 ----------- E_europaeus300258 ----------- E_europaeus300274 ----------- E_europaeus300324 ----------- E_europaeus300371 ----------- E_europaeus300387 ----------- E_europaeus300435 ----------- E_europaeus300442 ----------- E_europaeus300463 ----------- E_europaeus300486 ----------- E_europaeus300585 ----------- E_europaeus300594 ----------- E_europaeus300620 ----------- E_europaeus300667 ----------- E_europaeus300722 ----------- G_aculeatus300111 ----------- G_aculeatus300112 ----------- G_aculeatus300113 ----------- H_sapiens300733 ----------- H_sapiens300734 ----------- L_africana300488 ----------- M_mulatta300050 ----------- M_mulatta300264 ----------- M_mulatta300307 ----------- M_mulatta300447 ----------- M_mulatta300650 ----------- M_mulatta300651 ----------- M_murinus300070 ----------- M_murinus300240 ----------- M_murinus300335 ----------- M_murinus300407 ----------- M_murinus300442 ----------- M_murinus300535 ----------- M_murinus300536 ----------- M_domestica300174 ----------- M_domestica300175 ----------- M_musculus300363 ----------- M_musculus300468 ----------- M_musculus300761 ----------- M_musculus300762 ----------- M_musculus300805 ----------- O_anatinus303418 ----------- O_anatinus304530 ----------- O_anatinus304531 ----------- O_cuniculus300314 ----------- O_cuniculus300324 ----------- O_cuniculus300471 ----------- O_cuniculus300472 ----------- O_latipes300060 ----------- O_garnettii300318 ----------- O_garnettii300380 ----------- O_garnettii300494 ----------- O_garnettii300665 ----------- O_garnettii300719 ----------- O_garnettii300751 ----------- P_troglodytes300077 ----------- P_troglodytes300213 ----------- P_troglodytes300255 ----------- P_troglodytes300659 ----------- P_troglodytes300660 ----------- P_pygmaeus300144 ----------- P_pygmaeus300187 ----------- P_pygmaeus300188 ----------- P_pygmaeus300218 ----------- P_pygmaeus300363 ----------- P_pygmaeus300381 ----------- R_norvegicus300055 ----------- R_norvegicus300554 ----------- R_norvegicus300893 ----------- R_norvegicus301086 ----------- R_norvegicus301087 ----------- S_cerevisiae300047 CACGCACATAC S_araneus300033 ----------- S_araneus300174 ----------- S_araneus300423 ----------- S_araneus300520 ----------- S_araneus301030 ----------- S_araneus301031 ----------- S_tridecemlineatus300109 ----------- S_tridecemlineatus300140 ----------- S_tridecemlineatus300239 ----------- S_tridecemlineatus300296 ----------- T_nigroviridis300121 ----------- T_nigroviridis300122 ----------- T_belangeri300062 ----------- T_belangeri300199 ----------- T_belangeri300211 ----------- T_belangeri300426 ----------- T_belangeri300427 ----------- X_tropicalis300005 ----------- X_tropicalis300014 ----------- X_tropicalis300015 ----------- X_tropicalis300060 ----------- X_tropicalis300130 -----------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved