snOPY snoRNA Orthological Gene Database

Family: SNORA3

CLUSTAL W (1.83) multiple sequence alignment C_elegans300088 ----------------AACGAGGTCCAGAGTCACC------TTTTCAGCA C_elegans300111 ----------------TACGAGGTCCAGAGTCACC------TCTGAGAAT C_familiaris300475 ----------------ATCGAGGCT-AGAGTCACG------CTTGGGTAT C_familiaris300476 ----------------CTTGAGGCT-AGAGTCACA------TCCTGACAC C_porcellus300091 ----------------ATCAAGGCT-AGAGTCATG------CTTGACTGC C_porcellus300433 ----------------ATCAAGGCT-AGAGTCACA------CTTGGGTAT C_porcellus300925 ----------------GCCGAGACC-AGAGTCACA------TCCTGACAC D_rerio300042 ----------------AGCGAGACT-AGAGTCACA------TCCTGACGT D_rerio300043 ----------------AGCGAGACT-AGAGTCACA------TTCTGATGT D_rerio300044 ----------------AGTGAGACT-AGAGTCACA------TCCTGATGT D_rerio300045 ----------------TGTGAGACT-AGAGTCACA------TCCTGATGT D_novemcinctus300155 ----------------TCCGAGACT-AGAATCACA------TGCTGACAC D_novemcinctus300183 ----------------ATCGAGGCT-AGAGTCACA------CTTGGGTAT D_novemcinctus300320 ----------------ATCGAGGCT-AGAGTCATG------CTTGGGTAT D_novemcinctus300454 ----------------CCTGAGACT-AGAGTCACA------TCTTGATAC D_novemcinctus300517 ----------------ATCGAGGCT-AGAGTCACG------CTTGGGTAT D_novemcinctus300576 ----------------ATCGAGGCT-AGAGTCATG------CTTGGGTAT E_telfairi300057 ----------------GTTGAGGCT-AGAGTCACG------CTTGGGTCC E_telfairi300207 ----------------TCCGAGACT-AGAGTCACA------TCCTGACAC E_telfairi300294 ----------------ATCGAGGCG-AGAGTCATG------CTGAGGTAC E_telfairi300308 ---------------AAAGAGGACT-AGAGTCGCA------TCATGCCAC E_telfairi300334 ----------------GTCGAGGCT-AGAGTCACG------CTTGGGTCC E_telfairi300366 ----------------TCAGAGACT-ATAGTCACA------TCTGGACAC E_telfairi300483 ----------------CCCGAGACT--GAGTCCCA------TCCTGACAC E_telfairi300502 ----------------GTCGAGGCT-AGAGGCACG------CTTGGGTCC E_telfairi300786 ----------------GTCGAGGCT-AGAGTCACG------CTTGGGTAC E_telfairi300787 ----------------TCTGAGACT-GGAGTCACA------TCCTGACAC E_caballus300178 ----------------CCTGATACT-AGAGTCACA------AGCTGACAT E_caballus300307 ----------------GTCGAGGCT-AGAGTCACG------CTTGGGTAT E_caballus300308 ----------------CCCGAGACT-AGAGTCACA------TCCTGACAC E_europaeus300120 ----------------ACTGAGGCT-AGAGTCTTG------CTCG----- E_europaeus300121 ----------------GGCGAGGCT-AGAGTCTTG------CCAGGGCAT E_europaeus300131 ----------------ATTGAAACT-AGAGTCATT------CTTGGGTAC E_europaeus300149 ----------------CACGAGGCT-AGAGTCTCG------CCCAGGCAC E_europaeus300165 ----------------ATTGAAACC-AGAGTCATT------CTTGGGTAC E_europaeus300173 ----------------GGCGAGGCT-GGAGTCTCG------CCCGGACAT E_europaeus300180 ----------------ATTGAAACC-AGAGTCATT------CTTGGGTAC E_europaeus300222 ----------------ATTGAGACT-A--GTCACG------CTTGGGTAT E_europaeus300231 ----------------ATTGAAACT-AGAGTCATT------CTTGGGTAC E_europaeus300258 ----------------ATTGAAACT-AGAGTCATT------CTTGGGTAC E_europaeus300274 ----------------ATTGAAACG-AGAGTCATT------CTTGGGTAC E_europaeus300324 ----------------GGCCATGAT-AGAGTCTTG------CCCGGGCAT E_europaeus300371 ---------------------AACG-AGAGTCATT------CTTGGGTAC E_europaeus300387 ----------------ATTGAAACT-AGAGTCATT------CTTGGGTAC E_europaeus300435 ----------------ATCGAGACT-AGAGTCATG------CTTCGGTAT E_europaeus300442 ----------------GGCGAGGCT-AGACTCTCA------CCCGGGCAT E_europaeus300463 ----------------ATTGAAACC-AGAGTCATT------CTTGGGTAC E_europaeus300486 ----------------ATTGAAACG-AGAGTCATT------CTTGGGTAC E_europaeus300585 ----------------TACGAGGCT-AGAGTCTTG------CCTGGGCAT E_europaeus300594 ----------------GACGAGGCT-AGAGTCTCG------CCTGGGCAT E_europaeus300620 ----------------TGTGAGGCT-AGAGTCTCA------CCGAGGCAT E_europaeus300667 ----------------ATTGAAACC-AGAGTCAT-------CTTTGGTAC E_europaeus300722 ----------------GCTGAGGCT-AGAGTCTCG------CCCGGGCAT G_aculeatus300111 ----------------ATAGAGACT-AGAGTCTCA------CCTTGACAT G_aculeatus300112 ----------------AGCGAGGCT-AGAGTCACG------CCTGGATAC G_aculeatus300113 ----------------AGCGAGGCT-AGAGTCACG------CTTGGACAC H_sapiens300733 ----------------ATCGAGGCT-AGAGTCACG------CTTGGGTAT H_sapiens300734 ----------------GCCGAGACT-AGAGTCACA------TCCTGACAC L_africana300488 ----------------CTCGAGACT-AGAGTCACA------TCTCGACAC M_mulatta300050 ----------------ACCAAGACT-CAAGTCACA------GTCCGA--- M_mulatta300264 ----------------GCTGACACC-AGAGTAACA------TCCTGACAC M_mulatta300307 ------------------ACAGGCA-GCATTCAAG------TTCAAAAAA M_mulatta300447 ----------------TCTGAGACT-AGGGTCACA------TCCTAACAG M_mulatta300650 ----------------GCCGAGACT-AGAGTCACA------TCCTGACAC M_mulatta300651 ----------------ATCGAGGCT-AGAGTCACG------CTTGGGTAT M_murinus300070 ----------------ATCGAGGCT-AGAGTCATG------CTTGGGTAT M_murinus300240 ---------------------TATA-AGATT-AAA------AAAAAAAAT M_murinus300335 ----------------ATCGAGGCT-AGAGTCACA------CTTGGTTAT M_murinus300407 ----------------ATCGAGGCT-AAAGTCACA------CTTAGGTAT M_murinus300442 -----------------------------CTCGTG------CTAGAGTCC M_murinus300535 ----------------ATCGAGGCT-AGAGTCACG------CTTGGGTAT M_murinus300536 ----------------GCCGAGACT-AGAGTCACA------TCTTGACAC M_domestica300174 ----------------ACCGAGACTTAGAGTCACA------TCTAGGC-A M_domestica300175 ----------------CCCGAGACT-AGAGTCACA------TCCTGACAA M_musculus300363 --------------------------ATCCTGACA------TGGTGCTTT M_musculus300468 ----------------GCCAAGGCT-AGAGTCACA------TCCTGACAT M_musculus300761 ----------------TCCGAGGCT-AGAGTCACG------CTCAGGTAT M_musculus300762 ----------------GCCGAGGCT-AGAGTCACA------TCCTGACAT M_musculus300805 ----------------TCCGAGGCT-AGAGTCACG------CTCTGGTAT M_lucifugus300235 -----------------GACAGAAT-TTAAATAGA------ACATAAGAA M_lucifugus300395 ---------------------CTCT-AGAGTCATG------CTTGGGTAT M_lucifugus300491 ----------------CCTGAGACT-AGAGTCGCA------TCTTGACAG M_lucifugus300606 ----------------CCCGAGACT-AGAGTCACA------TCTTGACAG M_lucifugus300747 ----------------ATCGAGGCT-AGAGTCACG------CTTGGGTAT M_lucifugus300984 ----------------CCTGAGACT-AGAGTCGCA------TCTTGACAG M_lucifugus300985 ----------------CCCGAGACT-AGAGTCACA------TCTTGACAG O_anatinus303418 ----------------ACCGAGACC-AGAGTCACA------TCCTGACAC O_anatinus304530 ----------------CTCGAGACTTAGAGTCACA------TCTGGATTA O_anatinus304531 ----------------ACCGAGACT-AGAGTCACA------TCCTGACAC O_cuniculus300314 ----------------ATCCAGACT-ATAGTCATA------CCTGGATAT O_cuniculus300324 ----------------ATTGAGGCG-AGAGTCATG------CTTGGGTAT O_cuniculus300471 ----------------ATCGAGGCT-AGAGTCACG------CTTGGGTAT O_cuniculus300472 ----------------GCCGAGACT-AGAGTCACA------TCCCGACAC O_latipes300060 ----------------AGCGAGGCT-AGAGTCACA------CCCTGACAT O_garnettii300318 ----------------ATCGAGGCT-AGAGTCACT------CCTGGGTAT O_garnettii300380 ----------------GCCGAGACT-AGAGTCACA------TCTTGACAC O_garnettii300494 ----------------ATGGCGGCT-AGAGCCATG------CTTGTATAT O_garnettii300665 ---------------------GGCT-AGAATAATG------CTTGGGTTT O_garnettii300719 ----------------GCCGAGACT-AGAGTCACA------TCTTGACAC O_garnettii300751 ----------------GCCGAGACT-AGAGTCACA------TCTTGACAC P_troglodytes300077 ----------------TCTGAGACT-AGAGTCACA------TCCTGACA- P_troglodytes300213 ----------------GCTGACACT-AGAGTAACA------TCCTGACAC P_troglodytes300255 ----------------ACCAAGACT-CAAGTCACA------TTCTGA--- P_troglodytes300659 ----------------ATCGAGGCT-AGAGTCACG------CTTGGGTAT P_troglodytes300660 ----------------GCCGAGACT-AGAGTCACA------TCCTGACAC P_pygmaeus300144 ----------------ACCAAGACT-CAAGTCACA------TTTCGA--- P_pygmaeus300187 ----------------GCCGAGACT-AGAGTCACA------TCCTGACAC P_pygmaeus300188 ----------------ATCGAGGCT-AGAGTCACG------CTTGGGTAT P_pygmaeus300218 ----------------GCCGAGACT-ACAGCCACA------TCCTGACAC P_pygmaeus300363 ----------------TCTGAGACT-AGAGTCACA------TCCTGACA- P_pygmaeus300381 ----------------GCTGACACT-AGAGTAACA------TCCTGACAC R_norvegicus300055 ----------------GCTGAGACT-TTGGTCACA------TCCTGACAT R_norvegicus300554 -----------------------CT-AGAGTCACA------GCCTGGTAC R_norvegicus300893 ----------------ATTGAGACT-AGAGTCACA------TCCTGACAT R_norvegicus301086 ----------------TCCGAGGCT-AGAGTCACG------CTCAGGTAT R_norvegicus301087 ----------------ATCGAGACT-AGAGTCACA------TCCTGACAT S_cerevisiae300047 AATAATGTCTTTTATAATAGACACCCAGAGTCACGATTCGTCTTGGTTTT S_araneus300033 ----------------ATTAATACC-ATCGTCACA------TTGTCACA- S_araneus300174 ----------------CTCGAGACT-AGAGTCAGA------CTTAGGTGT S_araneus300423 ----------------CTCGAGACT-AGAGTCAGG------CTGAGGTAT S_araneus300520 --------------------AGAG--AGAGTCACA------CTTAG-TAT S_araneus301030 ----------------CTCGAGACT-AGAGTCACG------CTTAGGTAT S_araneus301031 ----------------GCCGAGACT-AGAGTCACA------TCCTGACAC S_tridecemlineatus300109 ----------------GCTGAGACT-GCAGTCACA------TCCCGACCC S_tridecemlineatus300140 ----------------GCTGAGACT-AGAGTCACA------TGCTGACAC S_tridecemlineatus300239 ----------------GCTAAGACT-AGAATCAAA------TCCTGACAT S_tridecemlineatus300296 ----------------CCCGAGACA-CGAGTCACA------TCCCAACAT T_nigroviridis300121 ----------------CGTGAGGCA-AGAGTCACT------CCTGGACAT T_nigroviridis300122 ----------------AGCGAGGCT-AGAGTCACG------CCTGAACAC T_belangeri300062 ----------------ACCAAGACT-AGAGTCACA------TTCTGACAC T_belangeri300199 ----------------CTCGAGG-T-AGATTCACG------CATGGGTAT T_belangeri300211 -------------------AAGACT-AGCATTGGA------TCCTGACAC T_belangeri300426 ----------------CCCGAGGCT-AGAGTCACG------CTTGGGTAT T_belangeri300427 ----------------ACCGAGACT-AGAGTCACA------TCCTGACAC X_tropicalis300005 ----------------GCTGAGACT-AGAGTCACA------TCTTGGCAT X_tropicalis300014 ----------------GCTGAGACT-AGAGTCACA------TCTTGGCAT X_tropicalis300015 ----------------CCCGAGACT-AGAGTCACA------TCCTGACAT X_tropicalis300060 ----------------GCTGAGACT-AGAGTCACA------TCTTGGCAT X_tropicalis300130 ----------------CCCGAGACT-AGAGTCACA------TCCTGACAT C_elegans300088 A-------AATGCAGTTAGGGTGC-----TAGGATTTCTCGAAAATGAAA C_elegans300111 A-------TGTATCTCTTCGGTGC-----TAGGATTGCTCGAAAATGAA- C_familiaris300475 C---AGCT-ATTGCCTTAGTGTGC-----TAGAG-TCCTCGAAGAGTAAT C_familiaris300476 -----ATTTCTTGTCCTGGTGTGC-----TAGAG-TCCTCAGAGAGAATC C_porcellus300091 T---GGCT-ACTGCCTTAGTGGGC-----TACAG-TTCTCAAAAAGTAAC C_porcellus300433 T---GACT-GTTGCCTCAGTATGC-----TAGAG-TCCTTGAAGAGTAAA C_porcellus300925 -----AGCTCTTGTCCTGGTGTGC-----TAGAG-TTCTCGGAGAGAATC D_rerio300042 T---GCTCG-TTGTCTTGGTGTGC-----TATAG-TACTCGCAGAATAAC D_rerio300043 T---GCTTG-TTGTCTTTGTGTGC-----TATAG-TACTCGCAGAATAAT D_rerio300044 T---GCTCA-TCATTTTGGTGTGC-----TATAG-TTCTCACAGAATGAT D_rerio300045 T---ACTTG-TTGTCTTGGTGTGC-----TATAG-TACTCACAGAATAAA D_novemcinctus300155 ----AGCT-CTTGTCCTGCTGTGC-----TAGCG-TCCTTGGAGACAATC D_novemcinctus300183 T---GGCT-GCTGCCTTAGTGTGC-----TAGAG-TCCTTGAAGAATAAC D_novemcinctus300320 T---GGCT-GTTGCCTTAGTGTGC-----TAGAG-TCCTCGAAGAGTAAC D_novemcinctus300454 ----AGCT-CTTGTCCTGGTGGGC-----AAGAG-TCCTTGGAGAGAATC D_novemcinctus300517 T---GGCT-GTTGTCTTAGTGTGC-----TAGAG-TCCTCGAAGAGTAAC D_novemcinctus300576 T---GGCTTGTTGCCTTAGTGTGC-----TAGAG-TCCTCGAAGAGTAAC E_telfairi300057 T---GGTT-GTTGCCTTGGTGTGC-----TAGAG-TCCTTGAAGAGTA-A E_telfairi300207 ----AACT-CTTGTCTTGGTGTGC-----TACGG-TTCTTGGAGAAGCTC E_telfairi300294 T---GGTT-ATTGCCTTGGTGTGC-----TAGAG-TCCTCGAAGAGTA-A E_telfairi300308 ----AACT-CTTGTCCTGGTGTGC-----TAGGG-TCCTCGGAGAGGATC E_telfairi300334 T---GGTT-ATTGCCTTGGTGCGC-----TAGAG-TCCTCGAAGAGTA-A E_telfairi300366 ----AGGT-CTTGTCCTGGTGTGC-----GAGCG-TCCACGGAGAGAATG E_telfairi300483 ----AACT-CTTGTCTTGGTGTGC-----TAGGG-TCCTCGGAGAGGACC E_telfairi300502 T---GGTT-ATTGCCTGGGGGTGT-----TAGGGGTCCTCGAAGAACACA E_telfairi300786 T---GGTT-ATTGCCTTGGTGTGC-----TAGAG-TCCTCGAAGAGTA-A E_telfairi300787 ----AACT-CTTGTCTTGGTGTGC-----TAGAG-TCCTCGGAGAGGGTC E_caballus300178 ----AGCT-CTGGTCCTGGTGTGC-----TGGAG-TCTTTGGAGAGAATC E_caballus300307 C---AGCT-ATTGCCTTAGTGTGC-----TAGAG-TCCTCGAAGAGTAAC E_caballus300308 ----AGCT-CTTGTCCTGGTGTGC-----TAGAG-TCCTCGGAGAAAATC E_europaeus300120 -----CAT---TGCCCTGGTGTGC-----TGAAG-TCCTCGGAGAGCAGC E_europaeus300121 G---GCGT---TGCCCCGGCGTGC-----TGGAG-TCTTCGGAGAGCAGC E_europaeus300131 C---ATCT-TTTGTCTTAGTGTGC-----TTGGG-TCCTTGGAGTATCAC E_europaeus300149 A---GCTT---TGCCCCGGCGTGC-----GGGAG-TCCTCGGAGAGCAGC E_europaeus300165 C---ATCT-TTTGTCTTAGTGTGC-----TAGGG-TCCTTGGAGGGTCAC E_europaeus300173 G---GTGT---TGCACCGGCGTGC-----TAGAG-TCCTTGGAGAGCAGC E_europaeus300180 C---ATCT-TTTGTCTTAGTGTGC-----TAGGG-TCCTTGGAGGGTCAC E_europaeus300222 C---ACCC-GTGGCCTTAGTGTGC-----TAGAG-TCCTTGAAGAGTAAC E_europaeus300231 C---ATCT-TTTGTCTTAGTGTGC-----TTGGG-TCCTTGGAGTATCAC E_europaeus300258 C---ATCT-TTTGTCTTAGTGTGC-----TTGGG-TCCTTGGAGTATCAC E_europaeus300274 C---ATCT-TTTGTCTTAGTGTGC-----TTGGG-TCCTTGGAGTATCAC E_europaeus300324 G---CTGT---TGCCTCGACATGC-----TGGAG-TCTTCGGAGAGCAGC E_europaeus300371 C---ATCT-TTTGTCTTAGTGTGC-----TTGGG-TCCTTGGAGTATCAC E_europaeus300387 C---ATCT-TTTGTCTTAGTGTGC-----TTGGG-TCCTTGGAGTATCAC E_europaeus300435 C---ACTT-GTTGCCTTAGTGTGC-----TAGAG-TCCTCGAATAGTAAC E_europaeus300442 G---GCGT---TGCCCTAGCATGC-----TGGAG-TCCTCGGAGGGCAGC E_europaeus300463 C---ATCT-TTTGTCTTAGTGTGC-----TAGGG-TCCTTGGAGGGTCAC E_europaeus300486 C---ATCT-TTTGTCTTAGTGTGC-----TTGGG-TCCTTGGAGTATCAC E_europaeus300585 G---GCGT---TGTCCGGGTGTGC-----TGGAG-TCCTCGGAGAGCAGC E_europaeus300594 G---GCGT---TGCCCCGGCGTGC-----TGGAG-TCCTCGGAGAGCAGC E_europaeus300620 G---ACGT---TGCCCCGGCGTGC-----TGGAG-TCCTCGGAGAGCAGC E_europaeus300667 C---ATCT-TTTGTCTTAGTGTGC-----TAGGG-TCCTTGGAGGGTCAC E_europaeus300722 G---GTGT---TGCCCCGGTGTGC-----TGGAG-TCCTCAGAGAGCAGC G_aculeatus300111 A----ACTCATTGGCTTGGTGTGC-----TAGAG-TACTCTTAGATTGAA G_aculeatus300112 G---TCCCA-TTGTCCTGGTGTGC-----TAGAG-TGCTCGCAGAGTAAA G_aculeatus300113 A---TCCCA-TTGTCCTGGTGTGC-----TAGAG-TGCTCGTAGAGTAAA H_sapiens300733 C---GGCT-ATTGCCTGAGTGTGC-----TAGAG-TCCTCGAAGAGTAAC H_sapiens300734 ----AACT-CTTGTCCTGGTGTGC-----TAGAG-TACTCGAAGAGAATC L_africana300488 ----AGCT-CTCGTCCTGGTGTGC-----TAGAG-TCCTCGGAGAGAATC M_mulatta300050 ----G------TGTCCTGGTGTGC-----TAGGG-CACTTGCAGAGAATC M_mulatta300264 -----AGCTCTTGTCCTGGTGTGC-----TAGAG-TTCTCGAT--GAATC M_mulatta300307 C---T-TT-ACTTTTTTGATATT----------A-TCCTGGAAGAGTAAT M_mulatta300447 CTCACAGC-TCTTCTCTAGTGTGC-----TGGAG-TCCTC----AGAATC M_mulatta300650 ----AACT-CTTGTCCTGGTGTGC-----TAGAG-TACTCGAAGAGAATC M_mulatta300651 C---GGCT-ATTGCCTGAGTGTGC-----TAGAG-TCCTCGGAGAGTAAC M_murinus300070 T---GGTT-ATTGCCTTAGTGTGT-----TACAG-TCCTTGAAGACTAAC M_murinus300240 C---T-TT-ATTGCCTTAGTGTGC-----TAGAG-TCCTCAAAGAGTAAC M_murinus300335 T---GGCT-ATTACCTTAGAGTGC-----TAGAG-TCCTTGGAAAGTAAC M_murinus300407 T---GGTT-ATTGCCGTAGTGTGC-----TAGAG-TCTTCAAAGAGTAAC M_murinus300442 T---A-AA-GCTAACCTAGTGTT-------AGAG-TCCTCGAAGAGTAAC M_murinus300535 T---GGTT-ATTGCCTCAGTGTGC-----TAGAG-TCCTCGAAGAGTAAC M_murinus300536 -----CACTCTTGTCCTGGTGTGC-----TAGAG-TTCTCGAAGAGAATC M_domestica300174 T---TGCCTGTTGTCGTGGTGTGC-----TAAAG-TCCTCGAAAAGTAAC M_domestica300175 ----TGACTGTTGTTTTGGTGTGC-----TAGAG-TCTTCGGAGAAAATC M_musculus300363 -----GGTACTTTCCCTGGTGCTC-----CAGAG-TTCTGGAGGAGGATC M_musculus300468 -----GGTACTTGTCCTGGTGTGC-----TAGAG-TTCTCGAGGAGAATC M_musculus300761 T---GCTT-GTTGCCTTAGTGTGC-----TTAAG-TCCTCGAAGAATAAC M_musculus300762 -----GGTGCTTGTCCTGGTGTGC-----TACAG-TTCTCGGAGAGAATC M_musculus300805 T---GCTT-GTTGCCTTAGTGTGC-----TAGAG-TCCTCGAAGAATAAC M_lucifugus300235 -----AA-ATATTTGATGGTGTGC-----TAGAG-TTCTTGGAGAGAATC M_lucifugus300395 T---AGCT-ATTGCCTTATTGTGC-----TAGAG-TCCTCCAAGAGCAAC M_lucifugus300491 -------CTGTGGTCCTGGTGTGC-----TAGAG-TTCTCGCAGAGAATC M_lucifugus300606 -------CTATTGTCCTGGTGTGC-----TACAG-TTCTCGGAGAGAATC M_lucifugus300747 T---TGCT-GTTGCCTTAGTGTGC-----TAGAG-TCCTCGAAGAGCAAC M_lucifugus300984 -------CTGTGGTCCTGGTGTGC-----TAGAG-TTCTCGCAGAGAATC M_lucifugus300985 -------CTGTTGTCCTGGTGTGC-----TAGAG-TTCTCAGAGAGAATC O_anatinus303418 ----CGTTGGTTGTCCCGGTGTGC-----AAGCG-TCCTCGCAGAGAATC O_anatinus304530 C---TTCCCGTTGCCGTGGTGTGC-----TAAAG-TCCTCGAAGAGTAAC O_anatinus304531 ----CGTTGGTTGTCTTGGCGTGC-----TAGAG-TCCTCGCAGAGAATC O_cuniculus300314 T---GGCT-ATTGCCTTAGTGTGC-----TACAG-TTCTGGAAGAGTAAC O_cuniculus300324 T---AGCT-ATTGCCTTAGTGTGC-----TAGAG-TCCTTGAAGAGTAAG O_cuniculus300471 T---GGCT-GTTGCCTTAGTGTGC-----TAGAG-TCCTCGAAGAGTAAC O_cuniculus300472 ----AACC-CTTGTCGTGGTGTGC-----TAGCG-TCCTCGGAGAGAATC O_latipes300060 A---GATCGGTTGTCCCGGTGTGC-----TAGAG-TGCTCGCAGAGGAAA O_garnettii300318 T---GGTT-ATTGCCCTAGTGTGC-----TAGAG-TCCTCGAAGAGTAAC O_garnettii300380 -----AACTCTTGTCCCGGTGTGC-----TAGAG-TCCTTGAAGAGAATC O_garnettii300494 T---GATT-ACTGTCTAAGTGTGC-----TAGAG-TCCTCGAGGAGTAAC O_garnettii300665 T---GGTT-ATTGCCTAAGTGTGC-----TAAAG-CCTCCCAAGAGTAAC O_garnettii300719 -----AACCCTTGTCCTGGTGTGCTGTACTAGAG-TCCTCGAAGAGAATC O_garnettii300751 -----AACTCTTGTCCTGGTGTGC-----TAGAG-TCCTCGAAGAGAATC P_troglodytes300077 ----CGGC-TCTTCTCCAATGTGC-----TGGAG-TCCTC----AGCATC P_troglodytes300213 -----AGCTCTTGTCCTGGTGTGC-----TAGAG-TTCTCGAT--GAATC P_troglodytes300255 ----G------TGTCCCGGTGTGC-----TAGGG-CACTTGCAGAGAATC P_troglodytes300659 C---GGCT-ATTGCCTGAGTGTGC-----TAGAG-TCCTCGGAGAGTAAC P_troglodytes300660 ----AACT-CTTGTCCTGGTGTGC-----TAGAG-TACTCGAAGAGAATC P_pygmaeus300144 ----G------TGTCCCGGTGTGT-----TAGGG-CACTTGCAGAGAATC P_pygmaeus300187 ----AACT-CTTGTCCTGGTGTGC-----TAGAG-TACTCGAAGAGAATC P_pygmaeus300188 C---GGCT-ATTGCCTGAGTGTGC-----TAGAG-TCCTCGGAGAGTAAC P_pygmaeus300218 ----A------GCTCTTGGTGTGC-----TACTG-TACTTGGAGAGAATC P_pygmaeus300363 ----TGGC-TCTTCTCCAATGTGC-----TGGAG-TCCTC----AGAATC P_pygmaeus300381 -----AGCTCTTGTCCTGGTGTGC-----TAGAG-TTCTCGAT--GAATC R_norvegicus300055 -----GGCACTTATCCTGGCGTGC-----TAGAG-CTCTTGAAGAAAATC R_norvegicus300554 -----AGCATATGTCCTGGTG-AA-----TAGAA-TTCTCTGAGAGAATC R_norvegicus300893 -----GGCACTTGTCCTGGTGTGC-----TAGAG-TTCTCGTAGAAAATC R_norvegicus301086 T---GCTT-GTTGCCTCAGTGTGC-----TAGAG-TCCTCGAAGAAAAAC R_norvegicus301087 -----GGCACTTGTCCTGGTGTGC-----TAGAG-TTCTCGTAGAAAATC S_cerevisiae300047 AGAGATTCTGTTTCGACAGTTTTTTTAGGCGGTGGACGTATATAGTTTAC S_araneus300033 --------TCTGGACCCAGAGTGC-----TACAG-TTCTCA-AGAGAATC S_araneus300174 C-----CC-ATTGATT-GGTGTGC-----TACAG-TGCTCGAGGAGTAAC S_araneus300423 C-----CC-GTCGCCTCGGTGTTT-----GGGAG-TCCTCAGAGAGTCAC S_araneus300520 C-----CG-GTTGCCCTGGGGTGC-----TAGAG-TCCTCAGAGAGTCAC S_araneus301030 C-----CT-GTTGCCTTGGTGTGC-----TAGAG-TCCTCGAAGAGTAAC S_araneus301031 -----CTTGCTTGTCCTGGTGTGC-----TAGAG-TTCTCGGAGAGAATA S_tridecemlineatus300109 ----AGGA-CTTGTCCTGGTGTGC-----CACAG-TTCTCGGAGAGAATT S_tridecemlineatus300140 ----AGAA-CATGTCCTGGTGTGC-----TACAG-ATCTCAGAGAGAATT S_tridecemlineatus300239 -----AGCACTTGTCCTGTTGTAC-----TAGAG-TCCTAAGACAAAATC S_tridecemlineatus300296 -----GGCTCTTGTCCTGATGTGC-----TGGAG-TCCTTGGAGAGGATC T_nigroviridis300121 G---GATTTGTTGGCCTGGTGTGC-----TATAG-ACCTCGCAGAGAAAA T_nigroviridis300122 A---GCCCG-TTGTCCTGGTGTGC-----TAGAG-CACTCGCAGAGGAAA T_belangeri300062 ----AGCTATTTGTCCCGGTGTGC-----TAGAG-TTCTCAGAGAGAATC T_belangeri300199 C---CACA-GTTGCCTTAGTGTGC-----TAGAG-CCCTCTGAGAATAAC T_belangeri300211 ----ACCT-CTTGTCCTGGTGTGC-----TTGAG-TTCTGGTAGAGAACA T_belangeri300426 C---CACT-GTTGCCTTAGTGTGC-----TAGAG-CCCTCGGAGAGTAAC T_belangeri300427 ----AGCT-CTTGTCCCGGTGTGC-----TAGAG-TTCTCGGAGAGAATC X_tropicalis300005 T----TCTGATTGCCTTGGTGTGC-----TAGAG-TACTCGGAGATAAAC X_tropicalis300014 T----TCTGATTGCCTTGGTGTGC-----TAGAG-TACTCGGAGATAAAC X_tropicalis300015 T----CCTTATTGTTTTGGTGTGC-----TAGAG-TTCTCGGAGAGAAAT X_tropicalis300060 T----TCTGATTGCCTTGGTGTGC-----TAGAG-TACTCGGAGATAAAC X_tropicalis300130 T----CCTTATTGTTTTGGTGTGC-----TAGAG-TTCTCGGAGAGAAAT C_elegans300088 TTGGTCGTATTATGCAAGTAGGGCTTG-----------------CTTTTG C_elegans300111 TTAGGTACTTTATGCAAACAGTTCTTG-----------------CGTT-A C_familiaris300475 -TGCT-G-ACCTTATTCACTGG-CTGT------------GACCCTT---A C_familiaris300476 -TGCT-GGTCTTGATTCACTGGCGAGGG---------------CAGTTGG C_porcellus300091 -TGCT-G-ACCTTATTCACTGA-CTGT------------GAGCTTT---G C_porcellus300433 GTGCT-G-ACCTTATTCACTGG-CTGT------------GGACTTC---G C_porcellus300925 -CGCT-GACCTTGATTCACTGGCGGGGG---------------CAATGAG D_rerio300042 ---CTCTCTGCTTATTCATTGGCTGCTGC--------------TTTCC-A D_rerio300043 ---CTCTGTACTTATTCATTGGCTGCTGC--------------TTTCC-A D_rerio300044 ---ATCTCTGCTTATTCATTGGCTGCTGC--------------TTTCC-A D_rerio300045 ---TTCTGTGCTTATTCGTTGGCTGCTGC--------------TTTCC-A D_novemcinctus300155 -TGCT-GATCTTGATTCACTGGTGGGGGTGGGGAGTGGGGCGGTGATTAG D_novemcinctus300183 -TGCT-G-ACCTTATTCACTGG-CTGT------------CAGCCTA---A D_novemcinctus300320 -AGCT-G-GCCTTATTCCCTGG-CTGT------------GACCCTC---A D_novemcinctus300454 -TACT-GGTCTTGATTCACTG----------------------------G D_novemcinctus300517 -TGCT-G-ACCTTATTCACTGG-CTGT------------GACCCTC---A D_novemcinctus300576 -TGCT-G-ACCTTATTCACTGG-CTGT------------AACCCTC---A E_telfairi300057 GTGCT-T-ACCCGATTCACTGG-CTGT------------GTGTCTC---G E_telfairi300207 -CGCT-GGCCTGGATCCACTGGTGGGG----------------CAAACAG E_telfairi300294 GTGCT-G-ATCTTATTCACTGG-CTGT------------GCGTCTC---G E_telfairi300308 -TGCT-GGCCTTGACCTATTGGTGGGG----------------CAGACAG E_telfairi300334 GTGCT-G-ACCTTATTCACTGG-CTGT------------GCGTCTT---G E_telfairi300366 -TGCT-GGTCTTGATTCACTGGCAGGG----------------CAGTCAG E_telfairi300483 -CGCT-GGCCTTGATTCCCTGGTGGGG----------------CAAACAA E_telfairi300502 GTGCT-GGACCTTATTCACCGGGCTGT------------GCGTCTC---G E_telfairi300786 GCGCT-G-ACCTTATTCACTGG-CTGT------------GCGTCTC---G E_telfairi300787 -TGCT-GGCCTTGATTCACTGGTGGGG----------------CAATCAA E_caballus300178 -TGCT-GCTCTTGATTCACCAGTGAGGG---------------CAATCAG E_caballus300307 -TGCT-G-ACCTTATTCACTGG-CTGT------------GGCCCTC---G E_caballus300308 -TGCT-GGTCTTGATTCACTGGCGAGGG---------------CAGTCTG E_europaeus300120 -CCCT-G-GCCTTATTCACTGG-CTGT------------GGCCCC----A E_europaeus300121 -CGCT-G-GCCTTATTCGCTGG-CTGT------------GGCCCC----A E_europaeus300131 -TGCT-G-ACCTTATTCTCTTG-CTAT------------GGCCCTC---C E_europaeus300149 -CGCT-G-GCCTTATTCGCTGG-CTGT------------GGCCCC----G E_europaeus300165 -TGCT-G-ACCTTATTCTCTTG-CTGT------------GGCCTTC---C E_europaeus300173 -CGCT-G-GCCTTATTCACTGG-CTGC------------GGCCCC----G E_europaeus300180 -TGCT-G-ACCTTATTCTCTTG-CTGT------------GGCCTTC---C E_europaeus300222 -TGCT-G-ACATTATTCACTGG-CTGT------------GGCCCTC---A E_europaeus300231 -TGCT-G-ACCTTATTCTCTTG-CTAT------------GGCCCTC---C E_europaeus300258 -TGCT-G-ACCTTATTCTCTTG-CTAT------------GGCCCTC---C E_europaeus300274 -TGCT-G-ACCTTATTCTCTTG-CTAT------------GGCCCTC---C E_europaeus300324 -TACT-G-GCCTTATTCACTGG-CTGT------------GACCCC----G E_europaeus300371 -TGCT-G-ACCTTATTCTCTTG-CTAT------------GGCCCTC---C E_europaeus300387 -TGCT-G-ACCTTATTCTCTTG-CTAT------------GGCCCTC---C E_europaeus300435 -TGCT-A-ACCTTATTCACTGG-CTGT------------GGCCCTC---A E_europaeus300442 -TGCT-G-GCCTCATTCGCTGG-CTGT------------GGCCCC----A E_europaeus300463 -TGCT-G-ACCTTATTCTCTTG-CTGT------------GGCCTTC---C E_europaeus300486 -TGCT-G-ACCTTATTCTCTTG-CTAT------------GGCCCTC---C E_europaeus300585 -CACT-G-GCCTTATTCGCTGG-CTGT------------GGCCGT----G E_europaeus300594 -CGCT-G-GCCTTATTCGCTGG-CTAT------------GGCTCT----G E_europaeus300620 -CGCT-G-GCCTTATTCCCTGG-CTGT------------GGCCCC----G E_europaeus300667 -TGCT-G-ACCTTATTCTCTTG-CTGT------------GGCCTTC---C E_europaeus300722 -TGCT-G-GCCTTATTCGCTGG-CTGT------------GGCCCC----G G_aculeatus300111 -GACT-GCTCCT-ATTCACCGACTGGCC--------------CTTTTTCG G_aculeatus300112 --TGTCTTTGCTTATTCATTGGCTGTAGT--------------CTTGTTG G_aculeatus300113 --TGTCTTTGCTTATTCATTGGCTGTAGT--------------CTTGTTG H_sapiens300733 -TGCT-G-ACCTTATTCACTGG-CTGT------------GGGCCTT---A H_sapiens300734 -TACT-GGTCTTGATTCACTGGTGGGGG---------------CAGTCGG L_africana300488 -TGCT-GGTCTTGATTCATTGGTGGGG----------------CAGTCAG M_mulatta300050 -TGCT-GGTCTTGATTCACTGGTGGAGA---------------CAATCG- M_mulatta300264 -TACT-GGTCTTGATTCACTGGCAAAGA---------------CAATCAG M_mulatta300307 -TGCT-G-ACCTTATTCACTGG-CAGT------------GGGCCT--T-A M_mulatta300447 -TGCT-GGTCTTGATTCACTGATGGGGG---------------CAACCAG M_mulatta300650 -TTCT-GGTCTTGATTCACTGGTGGGGG---------------CAGTTGG M_mulatta300651 -TGCT-G-ATCTTATTCACTGG-CTGT------------GGGCCTT---A M_murinus300070 -TGCT-G-ACCCTATTCACTGG-CTAT------------GGTCCTC---A M_murinus300240 -TGCT-G-ACCTTGTTAACTGG-CTGT------------GGCTCC--C-A M_murinus300335 -TGCT-G-ACCTTGTTCACTGG-CTAT------------GGCCCTC---A M_murinus300407 -TGCT-G-AACTTATTCATTGG-CTGT------------GGCCCTC---A M_murinus300442 -TGCT-G-ACCTTATTCACTGT-CTGT------------GCCCCT--C-A M_murinus300535 -TGCT-G-ACCTTATTCACTGG-CTGT------------GGTCCTC---A M_murinus300536 -TGCT-GGTCTTGATTCACTGGCGGGGG---------------CAATCAG M_domestica300174 -AGCT-A-ACTCTATTCACTGG-CTGGTC-----------ATCTT----G M_domestica300175 -TTCT-GACCTTTATTCACTGGCCTTGG---------------CATCTGG M_musculus300363 -TACA-GGTCTTGATTCACTGGTGGAAG---------------TCTTCAG M_musculus300468 -TGCT-GGTCTTGATTTATTGGTAGGGG---------------CCTTCAG M_musculus300761 -TGCT-G-ACCTTATTCACTGG-CTGTGT----------GGACTTT---C M_musculus300762 --GCT-GGTCTTGATTCATTGGTAGGGG---------------CCTTCAG M_musculus300805 -TGCT-G-ACCTTATTCACTGG-CTGT------------GGACTTT---C M_lucifugus300235 -TGCT-GGTCTTGATTCACTGGCGTGGG---------------CAGTAAG M_lucifugus300395 -TCTT-G-ACCTTATAAACTGA-CTGT------------GGCCCTACT-A M_lucifugus300491 -TGCT-GGTCTCG-TTCACTGGCAAGGG---------------CAGTAAG M_lucifugus300606 -TGCT-GGTCTTGATTCACTGGCGTGGG---------------CAGTAAG M_lucifugus300747 -TGCT-A-CCCTTATTCACTGA-CTGT------------GGGCCCC--TG M_lucifugus300984 -TGCT-GGCTTCG-TTCACTGGCAAGGG---------------CAGTAAG M_lucifugus300985 -TGCC-GGTCTTGGTTCACTGGCGAGTG---------------CAGTAAG O_anatinus303418 -CCCG-GCTCTTTATTCACCGGCTGAGG---------------------- O_anatinus304530 -TGCT-C-TCTCTATTCACTGG-CTGTTC----------GATCTC----G O_anatinus304531 -CCCCTGCTCTTTATTCACCGGCCGAGGGC-------------CGTCCCG O_cuniculus300314 -TGCT-G-ACCTTATTCACTGG-CTGC------------GGGCCTC---G O_cuniculus300324 -TGTT-G-ATTTTATTCACTGG-CTGT------------AGGCCT--C-A O_cuniculus300471 -TGCT-G-ACCTTATTCACTGG-CTGT------------GGGCCTC---A O_cuniculus300472 -TGCT-GGTCTTGATTCACTGGTGGGG----------------CAGCCAG O_latipes300060 -GCATCTCTGCTTATTCGTTGACTGAAGT--------------CTCAT-G O_garnettii300318 -TGCT-G-TCCTTATTCACTGG-CTGT------------GGCCCTG---A O_garnettii300380 -TGCT-GGTCTTGATTCACTGGCAGGGG---------------CAATCAG O_garnettii300494 -TGCT-G-ACCTGACCCGCTGG-CTCT------------GGCCCT--C-A O_garnettii300665 -TGCT-G-ACCTTATTTGCTGG-TGGT------------GGCCCT--C-A O_garnettii300719 -TGCT-GGTCTTGATTCACTAGCAGGGG---------------AAATCAG O_garnettii300751 -TGCT-GGTCTTGATTCACTGGCAGGGG---------------CAGTCAG P_troglodytes300077 -TGCT-GGTCTTGATTCACTGATGGGGG---------------CAACCAG P_troglodytes300213 -TACT-GGTCTTGATTCACTGGCAGGAG---------------CAAACAG P_troglodytes300255 -TGCT-GGTCTTGATTCACTGGTGGGGG---------------CAATCG- P_troglodytes300659 -TGCT-G-ACCTTATTCACTGG-CTGT------------GGGCCTT---A P_troglodytes300660 -TACT-GGTCTTGATTCACTGGTGGGGG---------------CAGTCGG P_pygmaeus300144 -TGCT-GGTCTTGATTCACTGGTGGGGG---------------CAATCG- P_pygmaeus300187 -TACT-GGTCTTGATTCACTGGTGGGGG---------------CAGTCGG P_pygmaeus300188 -TGCT-G-ACCTTATTCACTGG-CTGT------------GGGCCTT---A P_pygmaeus300218 -TACT-TGTCTTGATTCACTGGTGGGGG---------------CAGTCGT P_pygmaeus300363 -TGCT-GGTCTTGATTCACTGATGGGGG---------------CAACCAG P_pygmaeus300381 -TACT-GGTCTTGATTCACTGGCAGGAG---------------CAATCAG R_norvegicus300055 -TGCT-GGTCTTCATTCACTGATAGGCG---------------TCTTCAG R_norvegicus300554 -TGCT-GGTCTTGGTACACTGGAAGGGA---------------CACCCAG R_norvegicus300893 -TGCT-GGTCTTGATTCACTGGTAGGGG---------------CTTTCAG R_norvegicus301086 -TACT-G-ACCTTATTCACTGG-CTGT------------GGACTTT---A R_norvegicus301087 -TGCT-GGTCTTGATTCACTGGTAGGGG---------------CTTTCAG S_cerevisiae300047 TTAATCGTTTACTATACGGTGGAGTACTAATAC----TATTTCACTGTCG S_araneus300033 -TGCT-GGTCTTGATTCACTGGCAGGGG---------------CAACTAG S_araneus300174 -TGCT-G-ACCGTATTCACTGG-CTGT------------TGCCCTC---A S_araneus300423 -CGCT-G-ACCGTACTCACTGG-CCGT------------GGCCCTC---G S_araneus300520 -TGCT-G-ACCTTATTCACCAG-CTGT------------GGCCCTC---A S_araneus301030 -TGCT-G-ACCTTATTCACTGG-CTGT------------GGCCCTC---A S_araneus301031 -CGCT-GATCTAGATTCACTGGCGGAGG---------------CAACCAG S_tridecemlineatus300109 -TCCT-GGTTTTGATTCACTGGAGGGGA---------------CAGTTAA S_tridecemlineatus300140 -TGCT-GGTCTTGATTCACTAGTGGGGAGGAAG--------GGTAGTCAG S_tridecemlineatus300239 -AGCT-GGCCTTGATTCACTGGTAGGGG---------------CAATC-- S_tridecemlineatus300296 -TGCT-GATCTTGATTCACTGGTGGAGG---------------CAATCAG T_nigroviridis300121 --TGTCTTTGTTTATTCATTGACTGTAGT--------------CT-GTTA T_nigroviridis300122 --T--CTTTGCTTATTCATTG----------------------------- T_belangeri300062 -TCTT-GGTCTTGATTCACTGGTGGGGGTG---------------GTCAG T_belangeri300199 -TGCT-G-GCCTTACTCGCTAG-CTGT------------GGGCCTT---G T_belangeri300211 -TGCT-GGTCTTGACTCGCTAGTGGGGGCA---------------ATCGA T_belangeri300426 -GGCT-G-GCCTTATTCACTGG-CTGT------------GGGCCTC---G T_belangeri300427 -TCCT-GGTCTTGATTCACTGGTGGGGGCA---------------GTCAG X_tropicalis300005 -TACT-GGTCTTTATTCACTGTTTGGAT--------------GTCATT-G X_tropicalis300014 -TACT-GGTCTTTATTCACTGTTTGGAT--------------GTCATT-G X_tropicalis300015 -TACT-GATCTTTATTCACTGATTGGTT--------------CTCTAT-G X_tropicalis300060 -TACT-GGTCTTTATTCACTGTTTGGAT--------------GTCATT-G X_tropicalis300130 -TACT-GATCTTTATTCACTGATTGGTT--------------CTCTAT-G C_elegans300088 CGCTCCCCGACTTCACCTCATTCCCAAACATTT----------------- C_elegans300111 TGCTCATCTGTTTCACCTCCGTTTCTGACAAAA----------------- C_familiaris300475 TG-GCATAGTCAGTCACCAGGTTAGTGACATGC----------------- C_familiaris300476 TG-CCCCCGGTAGTGCCCAGATCAGAAACATGT----------------- C_porcellus300091 TG-GCACAGTCAGTTACTACGGCAGTAACATGT----------------- C_porcellus300433 TG-GCACAGTCAGCCTCCAGGGTAGTAACATGC----------------- C_porcellus300925 TG-CCCCCGTTAGCGCCCAGGTCAGGAACATCC----------------- D_rerio300042 TT-GCCCAGCCAATCACCAGCTCTGAAACATGC----------------- D_rerio300043 TT-GCCCAGCCAATCACCAGCTCAGAGACATGC----------------- D_rerio300044 TT-GCTAGGCCAATCACCAGCTCAGAAACATCC----------------- D_rerio300045 TT-GCCCAGCCAGTCACCAGCTCAGAAACATGC----------------- D_novemcinctus300155 TG-CCCCTGCCAGTCCCCTGATCAGAAACATTT----------------- D_novemcinctus300183 TG-GCATAGTCAGTCACCAGGTCAGTGACAAAT----------------- D_novemcinctus300320 TG-GCATAGTCAGTCACCAGGTCAGTGACAAGT----------------- D_novemcinctus300454 TG-TCCCCATTAGTGCCCTGATCCTAAACATGG----------------- D_novemcinctus300517 TG-GCATAGTCAGTCACCAGATCAGTGACAAGT----------------- D_novemcinctus300576 TG-GCATAGTCAGTCACCAGGTCAGTGACAAGT----------------- E_telfairi300057 TG-GCACAGTCAGTCACCAAGTAAGCGACATGC----------------- E_telfairi300207 TG-CCTCCACTAGTGCCCTGGTCAGAAACATGC----------------- E_telfairi300294 TG-GCACAGTCAGTCACCAGTGTAGCGACATGC----------------- E_telfairi300308 TG-CCTCCACGAGTGCCCTGCTCAGAAACGTGC----------------- E_telfairi300334 TG-GCACTGTCAGTCACCAGGTTAGCGACATGC----------------- E_telfairi300366 TG-TCCTGGCTAGTGCCCTGGTCAGAAAGGTGC----------------- E_telfairi300483 GG-CCTCCACTAGCGCCCTGCTCAGAAACATGC----------------- E_telfairi300502 TG-GCACACTCAGTCACCAGGTTAGCGACATGC----------------- E_telfairi300786 TG-GCACAGTCAGTCACCAGGTTAGCCACATGC----------------- E_telfairi300787 TG-CCTCCACTAGTGCCCTGGTCAGAAACATGC----------------- E_caballus300178 TG-CCCCCAGTAGTGCCCAGATCAGAG-CATGT----------------- E_caballus300307 TG-GCACAGTCAGTCACCGGGTTAGTGACATGT----------------- E_caballus300308 TG-CCCCCACTAGTGCCCAGATCAGAAACATGC----------------- E_europaeus300120 TG-GCCGAGCCAGTCACCAGGCCAAGGACAGGG----------------- E_europaeus300121 TG-GCCGATCCAGTCACCAGGCCAGGGACAGGC----------------- E_europaeus300131 TG-GCATAGTCAA----CAGGGCAGGGACATGC----------------- E_europaeus300149 TG-GCCGGGCCGGTCACCAGGCCGGTGACAGGT----------------- E_europaeus300165 TG-GCATAGTCAGTCACCAGGGCAGGGATATGC----------------- E_europaeus300173 TG-GCCGAGCCGGTCACCAGGCAAGGGACAAGC----------------- E_europaeus300180 TG-GCATAGTCAGTCACCAGGGCAGGGATATGC----------------- E_europaeus300222 TG-CTATAGCCAGGCGTCAGGTTAGTGACATGT----------------- E_europaeus300231 TG-GCATAGTCAA----CAGGGCAGGGACATGC----------------- E_europaeus300258 TG-GCATAGTCAA----CAGGGCAGGGACATGC----------------- E_europaeus300274 TG-GCATAGTCAA----CAGGGCAGGGACATGC----------------- E_europaeus300324 TG-GCCGAACTGGTCAACAGGCCAGGGACAGGC----------------- E_europaeus300371 TG-GCATAGTCAA----CAGGGCAGGGACATGC----------------- E_europaeus300387 TG-GCATAGTCAA----CAGGGCAGGGACATGC----------------- E_europaeus300435 TG-GCACAGTCAGCCACCAGGTTAGTTACATAT----------------- E_europaeus300442 TG-GCCGAGCCAGTCACCAGGCCAGAGACAAGT----------------- E_europaeus300463 TG-GCATAGTCAGTCACCAGGGCAGGGATATGC----------------- E_europaeus300486 TG-GCATAGTCAA----CAGGGCAGGGACATGC----------------- E_europaeus300585 TG-GCCTGGCTGGTCACCAGGCCAGGAACAGGT----------------- E_europaeus300594 TG-GCCGAGCCGGTCTCCAGGCCAGGGACAGGC----------------- E_europaeus300620 TG-GCCGGGCCGGTCACCAGGCCAGGGACAGGC----------------- E_europaeus300667 TG-GCATAGTCAGTCACCAGGGCAGGGGCATGC----------------- E_europaeus300722 TG-GCCGAGCCAGTCACCAGGCCAGGGACAGGC----------------- G_aculeatus300111 TA-GGGCAGTCACCCACATGGTCAGTTACAAAC----------------- G_aculeatus300112 TG-ACCCAGTCAACCACCGACTCAGACACATTA----------------- G_aculeatus300113 TG-ACCCAGTCAACCACCAACTCAGACACATTA----------------- H_sapiens300733 TG-GCACAGTCAGTCACCAGGTTAGAGACATGC----------------- H_sapiens300734 TG-CCCCCGTTAGTGCCCAGATCAGAAACATAC----------------- L_africana300488 TG-CCCCTACTAGTGCCCTGGTCAGAAACATGC----------------- M_mulatta300050 ------------GCGCCCAGATTAGAAACATGC----------------- M_mulatta300264 CG-GCTATGTCAGTACAAGTATCTAAAACATGG----------------- M_mulatta300307 TG-GCACAGTGAATCACCAGGTTAGAGACACGT----------------- M_mulatta300447 TG-TCCCCTTA-GTGTCCGGG-CAGAAACATAC----------------- M_mulatta300650 TG-CCCCCATTAGTGCCCAGATCAGAAACATAC----------------- M_mulatta300651 TG-GCACAGTCAGTCACCAGGTTAGAGACATGC----------------- M_murinus300070 TG-GCACAGTCA----CCAGGTTAGTAACATCC----------------- M_murinus300240 TG-GCAGAGTCAGTCTCCAGGTCAGTGACATGC----------------- M_murinus300335 TG-GCACAGTCAGTCACCAGGTTAGTGACATGC----------------- M_murinus300407 TG-GCATATTCAGTTACCAGGTTAGTGACATGC----------------- M_murinus300442 TG-ACACAATCAGTCACCAGTCTAGTGACATGC----------------- M_murinus300535 TG-GCACAGTCAGTCACCAGGTTAGTAACATCC----------------- M_murinus300536 TG-CCCCCATTAGTGCCCAGGTCAGTAACACAT----------------- M_domestica300174 TG-ATCCACTCAGTCACCGGGTTAGGAATAAAA----------------- M_domestica300175 TG-CCACAGTCAGTCACCGGGTCAGTTACATTG----------------- M_musculus300363 TG-CCCCTGTTAGTACCCAGACCAGAAACATGT----------------- M_musculus300468 TG-TCCCTTCTAGTGCCCAGATCAGAAACATGG----------------- M_musculus300761 TG-GCACAGTCAGTCACCAGGTTAGTGACATAT----------------- M_musculus300762 TG-TCCCTTCTAGTGCCCAGATCAGAAACATGG----------------- M_musculus300805 TG-GCACAGTCAGTCACCAGGTTAGTGACATCC----------------- M_lucifugus300235 TG-CCCCCGATAGTGCCCAGATCAGAAACATAG----------------- M_lucifugus300395 TG-GAATAGTCAGTCACCAGGCTAGTGACATGC----------------- M_lucifugus300491 GG-CCCCCGGTAGTGCCCAGATCAGAAACATAG----------------- M_lucifugus300606 TG-CCCCCGGTAGTGCCCAGATCAGAAACATAG----------------- M_lucifugus300747 TG-GCACAGTCAGTCACCAGGCTAGTGACACCA----------------- M_lucifugus300984 GG-CCCCCGGTAGTGCCCAGATCAGAAACATAG----------------- M_lucifugus300985 TG-CCCCCGGTAGTGCCCAGATCAGAAACATAG----------------- O_anatinus303418 -------------TCACCGGATCGGGAACGTCA----------------- O_anatinus304530 TG-GTGCAGTCAGTCACCGGGTTAGTAACATCG----------------- O_anatinus304531 TG-CCTCGGCCGGTCACCGGATCGGGAACATCG----------------- O_cuniculus300314 TG-GCACAGCCAGTCACCA-GGTAGTGACATAT----------------- O_cuniculus300324 AG-GCACAGTCAGTCACCAGGTTAGTGACAGAC----------------- O_cuniculus300471 TG-GCACAGTCAGTCACCAGGTTAGTGACATAC----------------- O_cuniculus300472 TG-CCCGCGTTAGTGCCCAGATCAGAAACATGC----------------- O_latipes300060 TG-ACCCAGCCAATCACCAGCTCAGATACATCA----------------- O_garnettii300318 TG-GCACAGTCAGTCACCAGGTTAGTGACATGG----------------- O_garnettii300380 TG-CCCCCGTTAGTGCCCAGATCAGTAACATTC----------------- O_garnettii300494 TG-GCACAGCCAGTCAGCAGGCGAGTGACAGGG----------------- O_garnettii300665 TG-GCACAGTCAGTCACCAGGTTAGTGATATGG----------------- O_garnettii300719 TG-CCCCTGTTAGTGCCCAGATCAGTAACATTC----------------- O_garnettii300751 TG-CCCCTGTTAGTGCCCAGATCAGTAACATTC----------------- P_troglodytes300077 TG-TCCCCTTAAGTGTCCGGG-CAGAAACATAC----------------- P_troglodytes300213 TG-ACTGTGTTAGTATGCGTATCTAAAACATGG----------------- P_troglodytes300255 ------------GTGCCCAGATTATGAACATGC----------------- P_troglodytes300659 TG-GCACAGTCAGTCACCAGGTTAGAGACATGC----------------- P_troglodytes300660 TG-CCCCCGTTAGTGCCCAGATCAGAAACATAC----------------- P_pygmaeus300144 ------------GTGCCCAGATTAGAAACATGC----------------- P_pygmaeus300187 TG-CCCCCATTAGTGCCCAGATCAGAAACATAC----------------- P_pygmaeus300188 TG-GCACAGTCAGTCACCAGGTTAGAGACATGC----------------- P_pygmaeus300218 TG-CTTCCTTTAGTGCCCAGATCAGAAACATAC----------------- P_pygmaeus300363 TG-TCCCCTTA-GTGTCCGGG-AAGAAACATAC----------------- P_pygmaeus300381 TG-GCTGT--TAGTATGCATATCTAAAACATGG----------------- R_norvegicus300055 TG-TCCCTGTTAGTGCCCAGATTAGAAACATGT----------------- R_norvegicus300554 TG-CCTT-GTTAGTGACCAGTGCAGAAAAATGT----------------- R_norvegicus300893 TG-ACCCCATTAGTGCTCAGATCAGAAACATAA----------------- R_norvegicus301086 TG-GCGCAGTCAGTCACCAGGTTAGTGACATAC----------------- R_norvegicus301087 TG-ACCCCATTAGTGCTCAGATCAGAAACATAA----------------- S_cerevisiae300047 TGCTCGCGGTTGAT--CTTAGATAAATATATTTCTTTTTCATAAAGAAAG S_araneus300033 TG-CCCTGGTTAGTGCCGAGGTCAGAAACATCC----------------- S_araneus300174 CG-GCATAGGCATTCACCCGATTAGTCGCAGGT----------------- S_araneus300423 GG-GCATAGTCGGTCACCGGGTTAGTGACATGT----------------- S_araneus300520 TG-GCATAGCCAGTCACCAGGTTAGTGACATGT----------------- S_araneus301030 TG-GCACAGTCGGTCACCGGGTTAGTGACATGT----------------- S_araneus301031 TG-CCTCCGTTAGTGCCCAGGTCAGAAACATGC----------------- S_tridecemlineatus300109 TG-TCCACATAACTGCCCAGATCAGAAAAGTAG----------------- S_tridecemlineatus300140 TG-TCTTCATTAGTGCCCAGATCAGAAACATAC----------------- S_tridecemlineatus300239 CA-GGTAAA-AAACATGA-------------------------------- S_tridecemlineatus300296 TG-CCCCAGTTAGTACCCAGGTCAGAAACATGC----------------- T_nigroviridis300121 TG-GTCCAGTCAATCACCAACTCAGATACACGA----------------- T_nigroviridis300122 -------------------------------------------------- T_belangeri300062 TG-TTCCTGCTAGTGCCCA-ATCAGAAACATGT----------------- T_belangeri300199 TG-GCGCAGTCA----CCGGGTTAGTGACAGGC----------------- T_belangeri300211 TG-CCCCTGCCAGGGCCCAGATTGGAAATATAT----------------- T_belangeri300426 TG-GCACAGTCAGTCACCAGGTTAGTGACATGC----------------- T_belangeri300427 TGGTCCCTGCTAGTGCCCAGATCAGAAACATGT----------------- X_tropicalis300005 TC-TTCCAACCAGCCACCTGTTCAGTGACAAGT----------------- X_tropicalis300014 TC-TTCCAACCAGCCACCTGTTCAGTGACAAGT----------------- X_tropicalis300015 TA-GCTCAATCAGTCACCGGTTCAGTGACATGT----------------- X_tropicalis300060 TC-TTCCAACCAGCCACCTGTTCAGTGACAAGT----------------- X_tropicalis300130 TA-GCTCAATCAGTCACCGGTTCAGTGACATGT----------------- C_elegans300088 -------------------------------------------------- C_elegans300111 -------------------------------------------------- C_familiaris300475 -------------------------------------------------- C_familiaris300476 -------------------------------------------------- C_porcellus300091 -------------------------------------------------- C_porcellus300433 -------------------------------------------------- C_porcellus300925 -------------------------------------------------- D_rerio300042 -------------------------------------------------- D_rerio300043 -------------------------------------------------- D_rerio300044 -------------------------------------------------- D_rerio300045 -------------------------------------------------- D_novemcinctus300155 -------------------------------------------------- D_novemcinctus300183 -------------------------------------------------- D_novemcinctus300320 -------------------------------------------------- D_novemcinctus300454 -------------------------------------------------- D_novemcinctus300517 -------------------------------------------------- D_novemcinctus300576 -------------------------------------------------- E_telfairi300057 -------------------------------------------------- E_telfairi300207 -------------------------------------------------- E_telfairi300294 -------------------------------------------------- E_telfairi300308 -------------------------------------------------- E_telfairi300334 -------------------------------------------------- E_telfairi300366 -------------------------------------------------- E_telfairi300483 -------------------------------------------------- E_telfairi300502 -------------------------------------------------- E_telfairi300786 -------------------------------------------------- E_telfairi300787 -------------------------------------------------- E_caballus300178 -------------------------------------------------- E_caballus300307 -------------------------------------------------- E_caballus300308 -------------------------------------------------- E_europaeus300120 -------------------------------------------------- E_europaeus300121 -------------------------------------------------- E_europaeus300131 -------------------------------------------------- E_europaeus300149 -------------------------------------------------- E_europaeus300165 -------------------------------------------------- E_europaeus300173 -------------------------------------------------- E_europaeus300180 -------------------------------------------------- E_europaeus300222 -------------------------------------------------- E_europaeus300231 -------------------------------------------------- E_europaeus300258 -------------------------------------------------- E_europaeus300274 -------------------------------------------------- E_europaeus300324 -------------------------------------------------- E_europaeus300371 -------------------------------------------------- E_europaeus300387 -------------------------------------------------- E_europaeus300435 -------------------------------------------------- E_europaeus300442 -------------------------------------------------- E_europaeus300463 -------------------------------------------------- E_europaeus300486 -------------------------------------------------- E_europaeus300585 -------------------------------------------------- E_europaeus300594 -------------------------------------------------- E_europaeus300620 -------------------------------------------------- E_europaeus300667 -------------------------------------------------- E_europaeus300722 -------------------------------------------------- G_aculeatus300111 -------------------------------------------------- G_aculeatus300112 -------------------------------------------------- G_aculeatus300113 -------------------------------------------------- H_sapiens300733 -------------------------------------------------- H_sapiens300734 -------------------------------------------------- L_africana300488 -------------------------------------------------- M_mulatta300050 -------------------------------------------------- M_mulatta300264 -------------------------------------------------- M_mulatta300307 -------------------------------------------------- M_mulatta300447 -------------------------------------------------- M_mulatta300650 -------------------------------------------------- M_mulatta300651 -------------------------------------------------- M_murinus300070 -------------------------------------------------- M_murinus300240 -------------------------------------------------- M_murinus300335 -------------------------------------------------- M_murinus300407 -------------------------------------------------- M_murinus300442 -------------------------------------------------- M_murinus300535 -------------------------------------------------- M_murinus300536 -------------------------------------------------- M_domestica300174 -------------------------------------------------- M_domestica300175 -------------------------------------------------- M_musculus300363 -------------------------------------------------- M_musculus300468 -------------------------------------------------- M_musculus300761 -------------------------------------------------- M_musculus300762 -------------------------------------------------- M_musculus300805 -------------------------------------------------- M_lucifugus300235 -------------------------------------------------- M_lucifugus300395 -------------------------------------------------- M_lucifugus300491 -------------------------------------------------- M_lucifugus300606 -------------------------------------------------- M_lucifugus300747 -------------------------------------------------- M_lucifugus300984 -------------------------------------------------- M_lucifugus300985 -------------------------------------------------- O_anatinus303418 -------------------------------------------------- O_anatinus304530 -------------------------------------------------- O_anatinus304531 -------------------------------------------------- O_cuniculus300314 -------------------------------------------------- O_cuniculus300324 -------------------------------------------------- O_cuniculus300471 -------------------------------------------------- O_cuniculus300472 -------------------------------------------------- O_latipes300060 -------------------------------------------------- O_garnettii300318 -------------------------------------------------- O_garnettii300380 -------------------------------------------------- O_garnettii300494 -------------------------------------------------- O_garnettii300665 -------------------------------------------------- O_garnettii300719 -------------------------------------------------- O_garnettii300751 -------------------------------------------------- P_troglodytes300077 -------------------------------------------------- P_troglodytes300213 -------------------------------------------------- P_troglodytes300255 -------------------------------------------------- P_troglodytes300659 -------------------------------------------------- P_troglodytes300660 -------------------------------------------------- P_pygmaeus300144 -------------------------------------------------- P_pygmaeus300187 -------------------------------------------------- P_pygmaeus300188 -------------------------------------------------- P_pygmaeus300218 -------------------------------------------------- P_pygmaeus300363 -------------------------------------------------- P_pygmaeus300381 -------------------------------------------------- R_norvegicus300055 -------------------------------------------------- R_norvegicus300554 -------------------------------------------------- R_norvegicus300893 -------------------------------------------------- R_norvegicus301086 -------------------------------------------------- R_norvegicus301087 -------------------------------------------------- S_cerevisiae300047 TGAGTGGATCTTCCCTGGAAGTACGAATAATGTACTTATGATTAGATTCT S_araneus300033 -------------------------------------------------- S_araneus300174 -------------------------------------------------- S_araneus300423 -------------------------------------------------- S_araneus300520 -------------------------------------------------- S_araneus301030 -------------------------------------------------- S_araneus301031 -------------------------------------------------- S_tridecemlineatus300109 -------------------------------------------------- S_tridecemlineatus300140 -------------------------------------------------- S_tridecemlineatus300239 -------------------------------------------------- S_tridecemlineatus300296 -------------------------------------------------- T_nigroviridis300121 -------------------------------------------------- T_nigroviridis300122 -------------------------------------------------- T_belangeri300062 -------------------------------------------------- T_belangeri300199 -------------------------------------------------- T_belangeri300211 -------------------------------------------------- T_belangeri300426 -------------------------------------------------- T_belangeri300427 -------------------------------------------------- X_tropicalis300005 -------------------------------------------------- X_tropicalis300014 -------------------------------------------------- X_tropicalis300015 -------------------------------------------------- X_tropicalis300060 -------------------------------------------------- X_tropicalis300130 -------------------------------------------------- C_elegans300088 -------------- C_elegans300111 -------------- C_familiaris300475 -------------- C_familiaris300476 -------------- C_porcellus300091 -------------- C_porcellus300433 -------------- C_porcellus300925 -------------- D_rerio300042 -------------- D_rerio300043 -------------- D_rerio300044 -------------- D_rerio300045 -------------- D_novemcinctus300155 -------------- D_novemcinctus300183 -------------- D_novemcinctus300320 -------------- D_novemcinctus300454 -------------- D_novemcinctus300517 -------------- D_novemcinctus300576 -------------- E_telfairi300057 -------------- E_telfairi300207 -------------- E_telfairi300294 -------------- E_telfairi300308 -------------- E_telfairi300334 -------------- E_telfairi300366 -------------- E_telfairi300483 -------------- E_telfairi300502 -------------- E_telfairi300786 -------------- E_telfairi300787 -------------- E_caballus300178 -------------- E_caballus300307 -------------- E_caballus300308 -------------- E_europaeus300120 -------------- E_europaeus300121 -------------- E_europaeus300131 -------------- E_europaeus300149 -------------- E_europaeus300165 -------------- E_europaeus300173 -------------- E_europaeus300180 -------------- E_europaeus300222 -------------- E_europaeus300231 -------------- E_europaeus300258 -------------- E_europaeus300274 -------------- E_europaeus300324 -------------- E_europaeus300371 -------------- E_europaeus300387 -------------- E_europaeus300435 -------------- E_europaeus300442 -------------- E_europaeus300463 -------------- E_europaeus300486 -------------- E_europaeus300585 -------------- E_europaeus300594 -------------- E_europaeus300620 -------------- E_europaeus300667 -------------- E_europaeus300722 -------------- G_aculeatus300111 -------------- G_aculeatus300112 -------------- G_aculeatus300113 -------------- H_sapiens300733 -------------- H_sapiens300734 -------------- L_africana300488 -------------- M_mulatta300050 -------------- M_mulatta300264 -------------- M_mulatta300307 -------------- M_mulatta300447 -------------- M_mulatta300650 -------------- M_mulatta300651 -------------- M_murinus300070 -------------- M_murinus300240 -------------- M_murinus300335 -------------- M_murinus300407 -------------- M_murinus300442 -------------- M_murinus300535 -------------- M_murinus300536 -------------- M_domestica300174 -------------- M_domestica300175 -------------- M_musculus300363 -------------- M_musculus300468 -------------- M_musculus300761 -------------- M_musculus300762 -------------- M_musculus300805 -------------- M_lucifugus300235 -------------- M_lucifugus300395 -------------- M_lucifugus300491 -------------- M_lucifugus300606 -------------- M_lucifugus300747 -------------- M_lucifugus300984 -------------- M_lucifugus300985 -------------- O_anatinus303418 -------------- O_anatinus304530 -------------- O_anatinus304531 -------------- O_cuniculus300314 -------------- O_cuniculus300324 -------------- O_cuniculus300471 -------------- O_cuniculus300472 -------------- O_latipes300060 -------------- O_garnettii300318 -------------- O_garnettii300380 -------------- O_garnettii300494 -------------- O_garnettii300665 -------------- O_garnettii300719 -------------- O_garnettii300751 -------------- P_troglodytes300077 -------------- P_troglodytes300213 -------------- P_troglodytes300255 -------------- P_troglodytes300659 -------------- P_troglodytes300660 -------------- P_pygmaeus300144 -------------- P_pygmaeus300187 -------------- P_pygmaeus300188 -------------- P_pygmaeus300218 -------------- P_pygmaeus300363 -------------- P_pygmaeus300381 -------------- R_norvegicus300055 -------------- R_norvegicus300554 -------------- R_norvegicus300893 -------------- R_norvegicus301086 -------------- R_norvegicus301087 -------------- S_cerevisiae300047 CTTCACGCACATAC S_araneus300033 -------------- S_araneus300174 -------------- S_araneus300423 -------------- S_araneus300520 -------------- S_araneus301030 -------------- S_araneus301031 -------------- S_tridecemlineatus300109 -------------- S_tridecemlineatus300140 -------------- S_tridecemlineatus300239 -------------- S_tridecemlineatus300296 -------------- T_nigroviridis300121 -------------- T_nigroviridis300122 -------------- T_belangeri300062 -------------- T_belangeri300199 -------------- T_belangeri300211 -------------- T_belangeri300426 -------------- T_belangeri300427 -------------- X_tropicalis300005 -------------- X_tropicalis300014 -------------- X_tropicalis300015 -------------- X_tropicalis300060 -------------- X_tropicalis300130 --------------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved