snOPY snoRNA Orthological Gene Database

Family: SNORA27

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300368 --TACCCCCTTTTCACTTT-GCCAATTGGACTT-----ATGTCTTTA--- C_porcellus300048 --AAAGCCCCTTTCACTTTGC-CAGTGGGAC--TTAA--TGTCTTCA--- C_porcellus300176 --ACACCCTCTGTCACTTTGC--CAGTGGAC--TTA---CATGTTTA--- D_novemcinctus300405 --TGCTCGCTTTCCACATTGC-CAGTTGGACAT-----ATGTCTTTA--- D_novemcinctus300419 --TTCTCACTTTTCACATAGC-CAATTGCAC-------ATGTCTTTA--- E_telfairi300188 --CTCCCCCTACTCATTTTGT-GAATTGGAC--TTA---GGTCTTTA--- E_telfairi300321 --CACCCCCTTTTCACTTT-GCCAATTGGACTT-----ATGTCTTTA--- E_telfairi300403 --CACCCCCTTTTCACGTT-GCTAATTGGACTT-----ATGTCTTTA--- E_telfairi300561 --CACCCCCTTTTCACTTT-GCCAATTGGACTT-----ATGTCTTTA--- E_telfairi300646 ---CCCCCTTTTTCACTTTTGCCAATTGGACTTT----ATGTCTTTA--- E_caballus300351 --TACCCCCTTTTCACTTT-GCCAATTGGACTT-----ATGTCTTTA--- E_europaeus300079 --CAGCCCCATCTCAATTTTC-AAATTGGAC--TTG---GGCCTTTA--- E_europaeus300080 --GTTCCCCCTTTTACTTTGC-CAATTGGACTT-----ATGTCTTTA--- E_europaeus300319 --TTTTCCCCTTTCACTTTGC-CAATTGGACT-------TGTCTTTA--- F_catus300245 --TACCCCCGTTTCACTTT-GCCAATTGGACTT-----ATGTCTTTA--- G_gallus300030 --CACCCTCCTTTCACTTTGC-CAGTTAGACACTTTT-TTGTCTTGA--- G_gorilla300859 --TACCCTCTTTCCACTTTGC-CAACTGGATGG-----ATGTCTTTA--- G_gorilla300018 --CACTCCCCTTTCATTTTAC-CATTGAGGC--TTA---TGTCTTTA--- G_gorilla300060 --TGCCCCCTTTTCACTTT-GCCAGTTGGACTT-----ATGTCTTTA--- G_gorilla300244 --AACCCCCTTTTCACTTT-GCCAATTGGACTT-----ATGTCTTTA--- G_gorilla300801 --AAACCCCTGTTCACTTTGC-CAAATGGAT--TTG---TGTCTTTA--- H_sapiens300598 --TACCCCCTTTTCACTTT-GCCAGTTGGACTT-----ATGTCTTTA--- L_africana300436 --TACCCGCTTTTCACTTT-GCCAATTGGACTT-----ATGTCTTTA--- M_mulatta300008 --AACCCCCTATTCACTTT-GCCAATTGGACTT-----ATGTCTTTA--- M_mulatta300025 --AACCCCCTGTTCACTTTTT-AAAATGGAT--TTA---TGTCTTTA--- M_mulatta300737 --TACCCCCTTTTCACTTT-GCCAATTGGACTT-----ATGTCTTTA--- M_mulatta300380 --TACCCTCTTTTTACTCTGC-CAACTGGATGT-----ATATAATTA--- M_murinus300366 --GACCCCATTTTCATTTT-GCCAATTGGACTT-----ATGTCTTTA--- M_murinus300425 --TACCCCCTTTTCACTTT-GCCAATCGGACTT-----ATGTCTTTA--- M_murinus300008 --AAACCCCTTTTCACTTT-GCCAATCGGACTT-----ATGTCTTTA--- M_murinus300074 --TGACCTCTTTTCACTTTGT-CAGTTGGAT--TTA---TGTCTTTA--- M_murinus300262 -------TAATTAAGGATCACTAA-TTGGACTT-----ATGTCTTTA--- M_domestica300154 --CTCCCCTCTTTCACTTTAC-CAATTAGACACATCA--TGTCTTTA--- M_musculus300779 --ACCCCCCCTTTCACTTTGC-CAATTGGAC--TTAA--TGTCTTCA--- M_lucifugus300150 --GTACTCCTTTTCACTTTGC-CCATTGGACTT-----ATGTCTTTA--- M_lucifugus300563 --------------AACTCATAAG-TCAAGGCC-----CCACTCTA---- M_lucifugus300640 --CACCCCCTTTTCACTTT-GTCAATTGGACTT-----ATGTCTT-A--- O_anatinus303878 --TCCCCCCCTTTCACTTTGC-CAGTTAGACATTTCTCTTGTCTTTA--- O_cuniculus300244 --CATCCCCTTTTCTCTTTGC-CAATTGAACCTTTA---TATCTTTA--- O_cuniculus300392 --TTTCCCCTTTTTACTTTGC-TAGCTGGAC--TTA---TGTCTTCA--- O_cuniculus300414 --CGCCCCCTTTTCACTTTGC-CAATTTGACTTTTT---TGTCTTTA--- O_garnettii300597 --TGCCCCCTTTTCACTTT-GCCAGTTGGACTT-----ATGTCTTTA--- O_garnettii300724 --TGCCCCCTTTGCACTTT-GCCAATTGGACTT-----ATGCCTTAA--- O_garnettii300725 --TATCCCCTTTTCACTTT-GCCAGTTGGACTT-----ATGTCTTTG--- O_garnettii300135 --TGCCCCCTTTTTACTTT-GCCAGTTAGACTT-----ATGTCTTTA--- O_garnettii300294 --TGCCCCCCTTTCACTTT-GCCAATTGGACTT-----ATGTCTTTA--- O_garnettii300324 --GCCCCCCTTTTCACTTT-GCCAGTTGGACTT-----ATGTCTTTA--- O_garnettii300449 -GTGCCTC-CTTTCACTTTAC-CGATTGGAC--TTA---GATCTTTA--- O_garnettii300531 --GCCCCCCTTTTCACTTT-GCCAGTTGGACTT-----ATGTCTTTA--- P_troglodytes300148 --TACCCTCTTTCCACTTTGC-CAACTGGATGG-----ATGTCTTTA--- P_troglodytes300351 --AAACCCCTGTTCACTTTGC-CAAATGGAT--TTG---TGTCTTTA--- P_troglodytes300382 --AACCCCCTTTTCACTTT-GCCAATTGGACTT-----ATGTCTTTA--- P_troglodytes300738 --TACCCCCTTTTCACTTT-GCCAGTTGGACTT-----ATGTCTTTA--- P_pygmaeus300209 --AACCCCCTTTTCACTTT-GCCAATTGGACTT-----ATGTCTTTA--- P_pygmaeus300310 --AAACCCCTGTTCACTTTGC-CAAATGGAT--TTG---TGTCTTTA--- P_pygmaeus300545 --AACCCCCTTTTCACTTT-GCCAATTGGACTT-----ATGTCTTTA--- P_pygmaeus300713 --TGCCCCCTTTTCACTTT-GCCAGTTGGACTT-----ATGTCTTTA--- P_pygmaeus300068 --TACCCTCTTTCCACTTTGC-CAACTGGATGT-----ATGTCTTTA--- R_norvegicus301019 --ACACCCCCTTTCACTTTGC-CAATTGGAC--TTAA--TGTCTTCA--- S_araneus300059 --TGCCCCTTTCTCACTTTGC-CAAGTGGACTT-----ATGTCTTAA--- S_araneus300086 --CCCCCCCTTTTCACTTTAC-CCACCGGAC-------TCATCTTTA--- S_araneus300504 --TACTCCCTTCGCATTTTGCCTATTTGAGTT------ATGTCTTTA--- S_araneus300590 --TGCCCCTGTCTCACTTTCC-CAATTGGATTT-----ATGTCTTTA--- S_araneus300630 ATGGCCCCGC--TCGCTTAGC-AAACTGAACTT-----ATGTCTTTA--- S_araneus300650 --TGCCCCCTTCTCACTTTGC-CAATTGGACTT-----ATGTCTTAA--- S_araneus300700 -ATG-CCTCTTCTCACTTTGT-CAATTGCACTT-----ATGTCTTAA--- S_araneus300723 --TGTCCCCTACTTCCTTTGC-CAATTCGACTT-----ATGTCTTAA--- S_araneus300808 --TGCATCCTTCTCATATTGC-TGACTAGACTC-----AAGTTTTCA--- S_araneus300889 ----------------ATCATGAGATTTAATTT-----ATACATAAAAAT S_araneus300912 --TGCCCCCTTCTCATTTTGC-CAATTGGACT------ATGTCTTAA--- S_araneus300589 --TGCCCACTTCTCACTAT-GTTAATTGGATTT-----GTGTCTTTA--- S_araneus301026 --TGCACCCTTCTCA--CTGC-CAGTTGGACTT-----AA-TCTTAG--- S_tridecemlineatus300172 --TGTCTCTCTTTCACTTTGCTCAAATGGAC--TGA---TGTCTTTA--- T_nigroviridis300051 --GGCCCCACCTTCACTTTGC-CACCAGGGCTGTTG--ATGTCGTGA--- T_belangeri300073 --CACCCCCTTTTCTCTTT-GCCAGTTGGACTT-----ATGTCTTTA--- T_belangeri300190 --AACCCCCTTTTCACTTT-GCCAGTTAGACTT-----ATGTCTTTA--- C_familiaris300368 TTGGTCATTCAAGTGGGG-CAAATGAAAT-ATCCT-TTTAAAACTCAAG- C_porcellus300048 TTGGTCATTCAAGTGGGG-CAAAGGAAATATCCTT--TTAAAACTCTGG- C_porcellus300176 TTAGTCATTCAAGTGGAG-CAAAGGAAATATCTTT--TTAAAATTCAGG- D_novemcinctus300405 TTGGTCATTCAGTTTGGG-CAAAAGAAACAGCCTT--TTAAAGCTCAGG- D_novemcinctus300419 TTGGTCATTCAAGTGGAG-CAAAGGAAACATCGTT-TT-AAAACTCAGG- E_telfairi300188 CCAGTCATTCAAGTAGGG-CAAAAGAAACATTCTT--TTAAAG-TCAGG- E_telfairi300321 TTGGTCATTCAAGTGGGG-CAAAAGAAATATCC-T-TTTAAAACTCAGG- E_telfairi300403 TTGGTCATTCAAGAGGAG-CAAAATAAATATCATGGGTGTTTGTCTTGG- E_telfairi300561 TTGGTCATTCAAGTGGGG-CAAAAGAAGTATCC-T-TTTCAAACTCAGA- E_telfairi300646 TTGGTCATTCAAGTGGGGGCAAAAGAAACATCCCT-TTTAAAACTCAGGG E_caballus300351 TTGGTCATTCAGGTGGGG-GAAAGGAAAAGATCCT-TTTAAAACTCAAG- E_europaeus300079 TTGGTCATTCAAACGGGG-CAAAAGAAATACCCTT--TTAAAACTCAGG- E_europaeus300080 TTGGTCATTCAACTGGGG-CAAACGAACTACCCTT--TTAAAACTCAGG- E_europaeus300319 TTGGTCATTCAAGTGAGG-CAAAGGAAATACCCTT--TTAAAACTCAGG- F_catus300245 TTGGTCATTCAAGTGGGG-CAAAGGAAAT-ATCCT-TTCAAAACTCAAG- G_gallus300030 TTGGTCATTCAAGGTGGG-TAAAGTATACATCCTT--TTAAAACCCAAG- G_gorilla300859 CTGGTCATTCCAGTGGGG-CAAACGAAATATCCTT-TTTAAAACTCAGG- G_gorilla300018 TTGGTTGTTCAAGTAGGG-CAAAGGAAATGGCCTT--TTAAAACTCAG-- G_gorilla300060 TTGGTCATTCAAGTGGGG-CAAAGGAAATA-TCCT-TTTAAAACTCAGG- G_gorilla300244 TTGATCATTCAAGTGA-G-CAAAGGAAATA-CGCT-TTAAAAACTCAGG- G_gorilla300801 TTGCTCATT-AATTAGGG-CAAAGGAAATATCCTT--TTAAAACTCAGG- H_sapiens300598 TTGGTCATTCAAGTGGGG-CAAAGGAAATA-TCCT-TTTAAAACTCAGG- L_africana300436 TTGGTCATTCAAGTGGGG-TAAAGGAAATATCC-T-TTTAAAACTCAGG- M_mulatta300008 TTGATCATTCAAGTGG-G-CAAAGGAAATA-TGCT-TCAAAAACTCAGG- M_mulatta300025 TTGCTCATT-AATTGGGG-CAAAGGAAATATCCTT--TTAAAACTCAGG- M_mulatta300737 TTGGTCATTCAAGTGGGG-CAAAGGAAATAATCCT-TTTAAAACTCAGG- M_mulatta300380 CTGGTCATTCCAGTGGGG-CAAAGGAAATATCCTT-TTTAAAACTCAGG- M_murinus300366 TTGGTCATTCAAGTGGGG-CAAAGGACACA-TCCA-TTTAAAACTCAGG- M_murinus300425 TTGGTCATTCAAGTGGGG-CAAAGGAAATA-TCCT-TTTAAAACTCAGG- M_murinus300008 TTGGTCATTCAAGTGGGG-CAAAGGAAATA-TCCT-TTTAAAACTCAGG- M_murinus300074 TTAGTCATTCAAGCGTGG-CAAAGGAAGTACCCTT--TTAAAACTCAGG- M_murinus300262 TTGGTCATTCAAGTGGGG-CAAAGGAAATATCCTT--TTAAAGCTCAGG- M_domestica300154 TTGGTCATTCAAGTGGGG-TAGAAGAAATATCCTT--TTAAAACTCAAG- M_musculus300779 TTGGCCATTCAAGTGGGG-CAAAGGAAATAACCTT--TTAAAACTCAGG- M_lucifugus300150 CTAGTCATTCCAATGGGG-CAAAGGCAATATCCTT--TTAAAACCCAAG- M_lucifugus300563 TTGGTCATTCATGTAGGG-CAAAGGAAATA-CCTT--TTAAAACTCAAG- M_lucifugus300640 TTGGTCATTCAAGTGGGG-CAAAGGAAATGTCCTT--TTAAAACTCAGG- O_anatinus303878 TTGGTCATTCAAATGGGG-TAAATTA-ATTTCCTT--TTAAAACTCAAG- O_cuniculus300244 TTGGTCATTCAATTGGGG-CAAAGGAACTATCCTT--TTAATATTCAGG- O_cuniculus300392 TTGGCCATTCAAGATGGG-CAGAGGAAATATTATT--TTAAGATTCAGG- O_cuniculus300414 TTGGTCATTCAAGTGGGG-CAAAGGAACTATCCTT--TTAAAACTCAAG- O_garnettii300597 TTGGTCATTCAAGTGGGG-CAAAGGAAATA-TCCT-TTTAAAACTCAGG- O_garnettii300724 TTGGTG--------GGGG-CAAAGGAAATA-TCCT-TTTAAAACTCAGG- O_garnettii300725 TTGGTCACTCAAGTGGGG-CCAAGGAAATA-TCCT-TTTAAAATGCAGG- O_garnettii300135 TTGGTCATGTAAGTGGGG-CAAAGCAAATA-TCCT-TTCAAAACTCAGG- O_garnettii300294 TTGGTCATTTAAGTAGGG-CCAAGCAAATA-TCCT-TTTAAAATTCAGG- O_garnettii300324 TTGGTCATTCAAGTGGGG-CAAAGAAAATA-TCCT-TTTAAAACTCAGG- O_garnettii300449 TTGGTCATTCAA-TGGG---AAAGGAAATGTT-----TTAAAACTTAGG- O_garnettii300531 TTGGTCATTCAAGTGGGG-CAAAGAAAATA-TCCT-TTTAAAACTCAGG- P_troglodytes300148 CTGGTCATTCCAGTGGGG-CAAATGAAATATCCTT-TTTAAAACTCAGG- P_troglodytes300351 TTGCTCATT-AATTGGGG-CAAAGGAAATATCCTT--TTAAAACTCAGG- P_troglodytes300382 TTGATCATTCAAGTGA-G-CAAAGGAAATA-CGCT-TTAAAAACTCAGG- P_troglodytes300738 TTGGTCATTCAAGTGGGG-CAAAGGAAATA-TCCT-TTTAAAACTCAGG- P_pygmaeus300209 TTGATCATTCAAGTGA-G-CAAAGGAAATAACGCT-TTAAAAACTCAAG- P_pygmaeus300310 TTGCTCATT-AATTGGGG-CAAAGGAAATATCCTT--TTAAAACTCAGG- P_pygmaeus300545 TTGATCATTCAAGTGA-G-CAAAGGAAATA-CGCT-TTAAAAACTCAGG- P_pygmaeus300713 TTGGTCATTCAAGTGGGG-CAAAGGAAATA-TCCT-TTTAAAACTCAGG- P_pygmaeus300068 CTGGTCATTCCAGTGGGG-CAAAGGAAATATCCTT-TTTAAAACTCAGG- R_norvegicus301019 TTGGCCATTCAAGTGGGG-CAAAGGAAATAACCTT--TTAAAACTCAGG- S_araneus300059 CTGCCCATTCA--TGGGG-CAAAGGAAGCC-TCCT--TGAAAACTCAAG- S_araneus300086 TTGGCCATTCAAGTGGAG-CAAAGGA-ATAACCTT--TTAAAACTCAAG- S_araneus300504 TTGGTTACTCAAGTGGAG-CAGGGGAAATATCCTT--TTATAATTTAAG- S_araneus300590 TTGGTCATTCAAGTGGGG-CAAAGGAAGTGTCCTT--TTAAAACTCAAG- S_araneus300630 GTAGCCATTCATGTGGGG-CAAAGGAAGTGCTCTG--TCCAAACTCAAG- S_araneus300650 TTG-TCATTCAAGTGGAG-CAAAGGAAGTGTCCTT--CTAAAACTCAGG- S_araneus300700 TTGGTCATTCAAGTGGGG-CAAAGGAAGTGCCCTT--TTAAA-CTCAAG- S_araneus300723 TTGGTCACTCAAGTGGGG-CGAACGAAGTGTTCTT--TTAAAATTCAAG- S_araneus300808 TTGGTAATTCTAGTGAGG-CAAAGGAAGTGTCCTT--TTAAAATTGAAG- S_araneus300889 CTCTGCATTCAAGTGGGG-TAAAGGGCATGTCCTT--TTAAAACTCAAG- S_araneus300912 TTGGTCATACAAGTGGGA-CAAAGGAAGCGTCCTT--TTAAAACTCAAG- S_araneus300589 CAGATCATTCAAGTGGGG-CAAAGGAAATATTAT--ATTAACACTCAAC- S_araneus301026 TTGGTCATTCAAATAGGG-CAAAGTAAG-GTCCTT--TTAAAACTCAAG- S_tridecemlineatus300172 TTGGTCATTCAAGTGGGG-CAAAGGAAATGTTCTTC-TTAAAACTCAGG- T_nigroviridis300051 GTGGTCATTCGTGTGGGG-AAAAGCATTTCATCCT--CGAACACCCCAG- T_belangeri300073 TTGGCCATTCAAATGGGG-CAAAGGAAATG-TCCT-TTTAAAACTCAAG- T_belangeri300190 TTGGCCATTCAA-TGGGA-CAAAGGAAATG-TCCT-TTGAAAACTCAGG- C_familiaris300368 CAAACTG--GGTGTTTGCCTTGT------ATCCTGTCAGAGG-AAACAAA C_porcellus300048 CAAACT---AGTGTTTG-TCCTG-----TAACCTGTCAGAG-GGAACAGT C_porcellus300176 CAAATT--GAGTGCTT-----TG-----GAAACTTTCAGAG-GAAATAAA D_novemcinctus300405 CAAACTA--AATGTTTGTCTTGT------ATCTTTTCAGAGGAATCCAAT D_novemcinctus300419 TGAAC------TGTTTGTCTTA------TATCCTGTCAG--GAAACAAAC E_telfairi300188 CAAGCT--GGGTGTTTG-TCCAG-----AGGAAAGAGGTGGAGGAAACAC E_telfairi300321 CAAACTG--GGTGTTTGTCTTGG------ATCCTGTCAGAGG-AAACAGG E_telfairi300403 CAAACTG--GGTGTTTGTCTTGG-----CT-CCTGTCAGAAGAGA-CAAC E_telfairi300561 CAAACTG--AGTATTTGGCTTGG------ATCCTGTCAGGGG-AAACAGG E_telfairi300646 CAAACTG--GGTGTTTGTCTTGG------ATCCTGTCAGAGG-AAACAGG E_caballus300351 CAAACTG--AGTGTTTGTCTTGT------ATCCTGTCAGAGG-AAACAAA E_europaeus300079 CAAACT----GTGTTTG-TCTTG-----T---ACCAGAGGAAATAAAC-- E_europaeus300080 CAAACTG--GGTGTTTG-TCTTA-----TATCCTGTCAGAGGAAACAAAA E_europaeus300319 CAAACTG--GGTGTTTG-TCTTG-----TATCCTGTCAGAGGAAACAAAA F_catus300245 CAAACTG--GGTGTTTGTCTTGT------ATCCTGTCAGAGG-AAACAAA G_gallus300030 CAAATGGTGGTCATTTG-TCTTG-----GATCCTGTCAGAGGAAACAGGT G_gorilla300859 CAAACTG--GGTGTTTGTCATGGTCATGTATCCTGTCAGAGAAAACAAAC G_gorilla300018 -AGGCC--AGGTAC------------------------------------ G_gorilla300060 CAAACTG--GGTGTTTGTCT-GT------ATCCTGTCAGAGG-AAACAAA G_gorilla300244 CAAAC-G--G-TGTTTGTCTTGT-----AT-CCCGTCAGAGGAAA-CAAA G_gorilla300801 CAAACT--GAGTGTTTG-TCTTG-----TATCCTGTCAGAGGAAAGAAAT H_sapiens300598 CAAACTG--GGTGTTTGTCT-GT------ATCCTGTCAGAGG-AAACAAA L_africana300436 CAAACTA--GGTGTTTGTCTTGT------ATCCTGTCAGAGG-AAACAAG M_mulatta300008 CAAACTG--GGTGTTTGTCTTGT-----AT-CCTGTCAGAGGAAG-CAAA M_mulatta300025 CAAACT--GAGTGTTTG-TCTTG-----TATCCTGTCAGAGGAAAGAAAT M_mulatta300737 CAAACTG--AGTGTTTGTCTTGT------ATCCTGTCAGAGG-AAACAAA M_mulatta300380 TAAACTT--GATGTTTGTCATAGTCATGTATCCTGTCAGAGAAAACAAAC M_murinus300366 CAAACT---GGTGTTTGTCTTGT------ATCCTGTCAAAGG-AAACAAA M_murinus300425 CAAACT---GGTGTTTGTCTTGT------ATCCTGTCAAAGG-AAACAAA M_murinus300008 CAAACT---GGTGTTTGTCTTGT------ATCCTGTCAACGG-AAACAAA M_murinus300074 CACACG--GAGTATTTG-TCTTG-----TATCTGGTCAGTGGAAACAAAT M_murinus300262 CAAACTA--G-TGTTTGTCTTAT------ATCCTGTCAAAGGAAACAAAT M_domestica300154 CAAACTG--GTTGTTTG-TCTTG-----CATCCTGTCAGAGGAAACAATC M_musculus300779 CAAACTT-AAGTGTTTG-TCTTG-----TAACCTGTCAGGG-GAAACATT M_lucifugus300150 CAAACTG--GGTGTTTG-ACTTG-----TATCCTGTCAGAGGTAACAAAT M_lucifugus300563 CAAACTG--GGTGTTTCTCTTGT------ATCCTGTCAGAGGAAACAAAA M_lucifugus300640 CAAACGG--GGTGTTTGTTTTGT------ATCCTGTCAGAGG-AAACAAA O_anatinus303878 CAAACAA-ATTTGTTTG-TCTTG-----TATCCTATCAGGGGAGACATTT O_cuniculus300244 CAAACT--GAGTGTCTT-GTAAC-----TGTCAGAGGAAAAAAAA----- O_cuniculus300392 CAAACT--GGGTGTCTG-TCTTG-----TAATCTGTCAGAG-GAAATAAA O_cuniculus300414 CAAGCT--GAGTGTTTG-TCTTG-----T--AACCTGTCAGAGGAAACAA O_garnettii300597 CAAACT---GGTGTTTGTCTTGT------ATCCTGTCAAAGG-AAACAAA O_garnettii300724 CAAACT---GGTGTTTGTCTTGT------ATCCTGTCAAAGG-AAACAAA O_garnettii300725 CAAACT---GGT----GTCTTGT------ATCCTGTCAAAGG-AAACAAA O_garnettii300135 CAAACT---GGTGTTTGTCTTGA------ATCTTGTCAAAGG-AAACAAA O_garnettii300294 CAAAAT---GGTGTTTGTTTTGG-----TACCTTGTCAAAGGGAAACAAA O_garnettii300324 CAAACT---GGTGTTTGTCTTGT------ATCCTATCAAAGG-AAAAAAA O_garnettii300449 CTAACT--G-GTGTTTA-TCTTG-----TA-TCTGTCATAG-GAAATAAA O_garnettii300531 CAAACT---GGTGTTTGTCTTGT------ATCCTATCAAAGG-AAAAAAA P_troglodytes300148 CAAACTG--GGTGTTTGTCATGGTCATGTATCATGTCAGAGAAAACAAAC P_troglodytes300351 CAAACT--GAGTGTTTG-TCTTG-----TATCCTGTCAGAGGAAAGAAAT P_troglodytes300382 CAAAC-G--G-TGTTTGTCTTGT-----AT-CCTGTCAGAGGAAA-CAAA P_troglodytes300738 CAAACTG--GGTGTTTGTCT-GT------ATCCTGTCAGAGG-AAACAAA P_pygmaeus300209 CAAAC-G--GGTGTTTGTCTTGT-----ATTCCCATCAGAGGAAAACAAA P_pygmaeus300310 CAAACT--GAGTGTTTG-TCTTA-----TATCCTGTCAGAGGAAAGAAAC P_pygmaeus300545 CAAAC-G--G-TGTTTGTCTTGT-----AT-CCCATCAGAGGAAA-CAAA P_pygmaeus300713 CAAACTG--GGTGTTTGTCT-GT------ATCCTGTCAGAGG-AAACAAA P_pygmaeus300068 CAAACTG--GGTGTTTGTCATGGTCATGTATCCTGTCAGAGAAAACAAAC R_norvegicus301019 CAAACTT-AAGTGTTTG-TCTTG-----TAACCTGTCAGGG-GAAACATT S_araneus300059 CAAACTG--GGGGTTTG-TCTTG-----TATCCTGTCAGAGGAAACAAGT S_araneus300086 CAAAATG--GGTGTCTG-TCTTG-----TATCC----AGAGGAAACAAAA S_araneus300504 CAAACAA---GTGTTTGTCTTAT------ATCTTTTCAGAGGAAACAATA S_araneus300590 CAAACTG--GGAATTTG-TCTTA-----CATCTAGTCAGAGGAAACAATA S_araneus300630 --AA--A--ACTATGTG-TTTAG-----AACCTGTCAT-AGGGAGTAACA S_araneus300650 CAAACTG--GACATTTA-TCTTG-----TATTTTGTCAGGGAAAACATCG S_araneus300700 CAAACTG--GGTGTTTA-TCTTG-----TATAATGTCAGAGAAAACAACG S_araneus300723 CAAACTG-----------TCTTG-----AATCCTCTCAGGGGAAAAATAT S_araneus300808 CAAACTG--GG-GTTTG-ACTTA-----TGTGCTGTCAAAAGAAACAATG S_araneus300889 CAGACTG--GATGTTTGTCTTGT------ATCCTGTCAGAGGAAACAACT S_araneus300912 CAAACTG--GATGATTG-TCTTA-----TATCCTGTCTGAGGAAATAATG S_araneus300589 CAAATAT--TGTGTTTATCTTGG-----AT-CCTGTCAGAATAAA-CAAC S_araneus301026 CAAATTG--GA-GTTTG-TCTTT-----TATACTGTCAGAGGAAACAGCA S_tridecemlineatus300172 CAGATG--AAGTGTTTGCTCACG-----TAACCTGTCAGATTGAAGTAGA T_nigroviridis300051 TCAA--A--CCCGTTTG-TTCTG-----GGTCTGTCCCGAGGAAACAGCA T_belangeri300073 CAAACCA--GGTGTTTGTCTTGT------ATCCTGTCAAAGG-AAACAAA T_belangeri300190 CAAACTA--GGAGTTTCTCTTGT------ATCCTGTCAAAGG-AAACAAA C_familiaris300368 T- C_porcellus300048 C- C_porcellus300176 T- D_novemcinctus300405 -- D_novemcinctus300419 -- E_telfairi300188 AA E_telfairi300321 T- E_telfairi300403 T- E_telfairi300561 T- E_telfairi300646 T- E_caballus300351 T- E_europaeus300079 -- E_europaeus300080 -- E_europaeus300319 -- F_catus300245 T- G_gallus300030 -- G_gorilla300859 -- G_gorilla300018 -- G_gorilla300060 T- G_gorilla300244 T- G_gorilla300801 -- H_sapiens300598 T- L_africana300436 T- M_mulatta300008 T- M_mulatta300025 -- M_mulatta300737 T- M_mulatta300380 -- M_murinus300366 T- M_murinus300425 T- M_murinus300008 T- M_murinus300074 -- M_murinus300262 -- M_domestica300154 -- M_musculus300779 A- M_lucifugus300150 -- M_lucifugus300563 -- M_lucifugus300640 A- O_anatinus303878 -- O_cuniculus300244 -- O_cuniculus300392 T- O_cuniculus300414 AC O_garnettii300597 T- O_garnettii300724 T- O_garnettii300725 T- O_garnettii300135 T- O_garnettii300294 -- O_garnettii300324 T- O_garnettii300449 T- O_garnettii300531 T- P_troglodytes300148 -- P_troglodytes300351 -- P_troglodytes300382 T- P_troglodytes300738 T- P_pygmaeus300209 -- P_pygmaeus300310 -- P_pygmaeus300545 T- P_pygmaeus300713 T- P_pygmaeus300068 -- R_norvegicus301019 G- S_araneus300059 -- S_araneus300086 -- S_araneus300504 -- S_araneus300590 -- S_araneus300630 -- S_araneus300650 -- S_araneus300700 -- S_araneus300723 -- S_araneus300808 -- S_araneus300889 -- S_araneus300912 -- S_araneus300589 T- S_araneus301026 -- S_tridecemlineatus300172 T- T_nigroviridis300051 -- T_belangeri300073 T- T_belangeri300190 T-

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved