snOPY snoRNA Orthological Gene Database

Family: SNORA26

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300038 -------------------------------------------------- C_familiaris300096 -------------------------------------------------- C_porcellus300388 -------------------------------------------------- C_porcellus300424 -------------------------------------------------- C_porcellus300564 -------------------------------------------------- C_porcellus300616 -------------------------------------------------- D_rerio300277 -------------------------------------------------- D_rerio300278 -------------------------------------------------- D_novemcinctus300004 -------------------------------------------------- D_novemcinctus300069 -------------------------------------------------- D_novemcinctus300134 -------------------------------------------------- D_novemcinctus300226 -------------------------------------------------- D_novemcinctus300305 -------------------------------------------------- D_novemcinctus300353 -------------------------------------------------- D_novemcinctus300356 -------------------------------------------------- D_novemcinctus300614 -------------------------------------------------- D_novemcinctus300615 -------------------------------------------------- D_melanogaster300121 -------------------------------------------------- D_melanogaster300122 -------------------------------------------------- E_telfairi300086 -------------------------------------------------- E_telfairi300115 -------------------------------------------------- E_telfairi300178 -------------------------------------------------- E_telfairi300184 -------------------------------------------------- E_telfairi300295 -------------------------------------------------- E_telfairi300318 -------------------------------------------------- E_telfairi300340 -------------------------------------------------- E_telfairi300402 -------------------------------------------------- E_telfairi300433 -------------------------------------------------- E_telfairi300475 -------------------------------------------------- E_telfairi300487 -------------------------------------------------- E_telfairi300593 -------------------------------------------------- E_telfairi300640 -------------------------------------------------- E_telfairi300673 -------------------------------------------------- E_telfairi300734 -------------------------------------------------- E_telfairi300741 -------------------------------------------------- E_telfairi300764 -------------------------------------------------- E_telfairi300765 -------------------------------------------------- E_caballus300070 -------------------------------------------------- E_caballus300254 -------------------------------------------------- E_europaeus300034 -------------------------------------------------- E_europaeus300117 -------------------------------------------------- E_europaeus300122 -------------------------------------------------- E_europaeus300204 -------------------------------------------------- E_europaeus300219 -------------------------------------------------- E_europaeus300239 -------------------------------------------------- E_europaeus300272 -------------------------------------------------- E_europaeus300346 -------------------------------------------------- E_europaeus300352 -------------------------------------------------- E_europaeus300375 -------------------------------------------------- E_europaeus300380 -------------------------------------------------- E_europaeus300383 -------------------------------------------------- E_europaeus300388 -------------------------------------------------- E_europaeus300389 -------------------------------------------------- E_europaeus300428 -------------------------------------------------- E_europaeus300433 -------------------------------------------------- E_europaeus300454 -------------------------------------------------- E_europaeus300464 -------------------------------------------------- E_europaeus300544 -------------------------------------------------- E_europaeus300549 -------------------------------------------------- E_europaeus300591 -------------------------------------------------- E_europaeus300701 -------------------------------------------------- E_europaeus300721 -------------------------------------------------- F_catus300053 -------------------------------------------------- H_sapiens300058 -------------------------------------------------- H_sapiens300480 -------------------------------------------------- L_africana300063 -------------------------------------------------- L_africana300379 -------------------------------------------------- L_africana300481 -------------------------------------------------- M_mulatta300012 -------------------------------------------------- M_mulatta300195 -------------------------------------------------- M_mulatta300271 -------------------------------------------------- M_mulatta300286 -------------------------------------------------- M_mulatta300298 -------------------------------------------------- M_mulatta300376 -------------------------------------------------- M_mulatta300391 -------------------------------------------------- M_mulatta300408 -------------------------------------------------- M_mulatta300476 -------------------------------------------------- M_mulatta300480 -------------------------------------------------- M_mulatta300488 -------------------------------------------------- M_murinus300225 -------------------------------------------------- M_murinus300268 -------------------------------------------------- M_murinus300303 -------------------------------------------------- M_murinus300410 -------------------------------------------------- M_domestica300024 -------------------------------------------------- M_musculus300704 -------------------------------------------------- M_musculus300786 -------------------------------------------------- M_musculus300787 -------------------------------------------------- M_musculus300823 -------------------------------------------------- M_musculus300924 -------------------------------------------------- M_lucifugus300035 -------------------------------------------------- M_lucifugus300537 -------------------------------------------------- M_lucifugus300624 -------------------------------------------------- M_lucifugus300690 -------------------------------------------------- O_anatinus303218 -------------------------------------------------- O_cuniculus300002 -------------------------------------------------- O_cuniculus300003 -------------------------------------------------- O_cuniculus300028 -------------------------------------------------- O_cuniculus300143 -------------------------------------------------- O_cuniculus300155 -------------------------------------------------- O_cuniculus300284 -------------------------------------------------- O_cuniculus300286 -------------------------------------------------- O_cuniculus300362 -------------------------------------------------- O_cuniculus300404 -------------------------------------------------- O_cuniculus300435 -------------------------------------------------- O_cuniculus300510 -------------------------------------------------- O_garnettii300026 -------------------------------------------------- O_garnettii300054 -------------------------------------------------- O_garnettii300084 -------------------------------------------------- O_garnettii300102 -------------------------------------------------- O_garnettii300162 -------------------------------------------------- O_garnettii300481 -------------------------------------------------- P_troglodytes300017 -------------------------------------------------- P_troglodytes300069 -------------------------------------------------- P_troglodytes300091 -------------------------------------------------- P_troglodytes300149 -------------------------------------------------- P_troglodytes300155 -------------------------------------------------- P_troglodytes300215 -------------------------------------------------- P_troglodytes300253 -------------------------------------------------- P_troglodytes300314 -------------------------------------------------- P_troglodytes300385 -------------------------------------------------- P_troglodytes300386 -------------------------------------------------- P_troglodytes300464 -------------------------------------------------- P_pygmaeus300072 -------------------------------------------------- P_pygmaeus300096 -------------------------------------------------- P_pygmaeus300135 -------------------------------------------------- P_pygmaeus300203 -------------------------------------------------- P_pygmaeus300271 -------------------------------------------------- P_pygmaeus300353 -------------------------------------------------- P_pygmaeus300356 -------------------------------------------------- P_pygmaeus300367 -------------------------------------------------- P_pygmaeus300421 -------------------------------------------------- P_pygmaeus300423 -------------------------------------------------- R_norvegicus300010 -------------------------------------------------- R_norvegicus300083 -------------------------------------------------- R_norvegicus300126 -------------------------------------------------- R_norvegicus300144 -------------------------------------------------- R_norvegicus300229 -------------------------------------------------- R_norvegicus300252 -------------------------------------------------- R_norvegicus300361 -------------------------------------------------- R_norvegicus300401 -------------------------------------------------- R_norvegicus300463 -------------------------------------------------- R_norvegicus300475 -------------------------------------------------- R_norvegicus300570 -------------------------------------------------- R_norvegicus300658 -------------------------------------------------- R_norvegicus300671 -------------------------------------------------- R_norvegicus300809 -------------------------------------------------- R_norvegicus300843 -------------------------------------------------- R_norvegicus300901 -------------------------------------------------- R_norvegicus301001 -------------------------------------------------- R_norvegicus301053 -------------------------------------------------- R_norvegicus301063 -------------------------------------------------- S_cerevisiae300022 ATAACAATTTGTGATGCTTTAGGGAGCCTATTGTTTGATGGTTTATAGGA S_araneus300035 -------------------------------------------------- S_araneus300052 -------------------------------------------------- S_araneus300077 -------------------------------------------------- S_araneus300080 -------------------------------------------------- S_araneus300189 -------------------------------------------------- S_araneus300272 -------------------------------------------------- S_araneus300283 -------------------------------------------------- S_araneus300302 -------------------------------------------------- S_araneus300366 -------------------------------------------------- S_araneus300377 -------------------------------------------------- S_araneus300470 -------------------------------------------------- S_araneus300608 -------------------------------------------------- S_araneus300689 -------------------------------------------------- S_araneus300842 -------------------------------------------------- S_araneus300881 -------------------------------------------------- S_araneus300938 -------------------------------------------------- S_araneus301004 -------------------------------------------------- S_tridecemlineatus300039 -------------------------------------------------- S_tridecemlineatus300164 -------------------------------------------------- S_tridecemlineatus300203 -------------------------------------------------- S_tridecemlineatus300218 -------------------------------------------------- T_nigroviridis300074 -------------------------------------------------- T_belangeri300014 -------------------------------------------------- T_belangeri300159 -------------------------------------------------- T_belangeri300192 -------------------------------------------------- T_belangeri300220 -------------------------------------------------- T_belangeri300331 -------------------------------------------------- T_belangeri300378 -------------------------------------------------- C_familiaris300038 -------------------------------------------------- C_familiaris300096 -------------------------------------------------- C_porcellus300388 -------------------------------------------------- C_porcellus300424 -------------------------------------------------- C_porcellus300564 -------------------------------------------------- C_porcellus300616 -------------------------------------------------- D_rerio300277 -------------------------------------------------- D_rerio300278 -------------------------------------------------- D_novemcinctus300004 -------------------------------------------------- D_novemcinctus300069 -------------------------------------------------- D_novemcinctus300134 -------------------------------------------------- D_novemcinctus300226 -------------------------------------------------- D_novemcinctus300305 -------------------------------------------------- D_novemcinctus300353 -------------------------------------------------- D_novemcinctus300356 -------------------------------------------------- D_novemcinctus300614 -------------------------------------------------- D_novemcinctus300615 -------------------------------------------------- D_melanogaster300121 -------------------------------------------------- D_melanogaster300122 -------------------------------------------------- E_telfairi300086 -------------------------------------------------- E_telfairi300115 -------------------------------------------------- E_telfairi300178 -------------------------------------------------- E_telfairi300184 -------------------------------------------------- E_telfairi300295 -------------------------------------------------- E_telfairi300318 -------------------------------------------------- E_telfairi300340 -------------------------------------------------- E_telfairi300402 -------------------------------------------------- E_telfairi300433 -------------------------------------------------- E_telfairi300475 -------------------------------------------------- E_telfairi300487 -------------------------------------------------- E_telfairi300593 -------------------------------------------------- E_telfairi300640 -------------------------------------------------- E_telfairi300673 -------------------------------------------------- E_telfairi300734 -------------------------------------------------- E_telfairi300741 -------------------------------------------------- E_telfairi300764 -------------------------------------------------- E_telfairi300765 -------------------------------------------------- E_caballus300070 -------------------------------------------------- E_caballus300254 -------------------------------------------------- E_europaeus300034 -------------------------------------------------- E_europaeus300117 -------------------------------------------------- E_europaeus300122 -------------------------------------------------- E_europaeus300204 -------------------------------------------------- E_europaeus300219 -------------------------------------------------- E_europaeus300239 -------------------------------------------------- E_europaeus300272 -------------------------------------------------- E_europaeus300346 -------------------------------------------------- E_europaeus300352 -------------------------------------------------- E_europaeus300375 -------------------------------------------------- E_europaeus300380 -------------------------------------------------- E_europaeus300383 -------------------------------------------------- E_europaeus300388 -------------------------------------------------- E_europaeus300389 -------------------------------------------------- E_europaeus300428 -------------------------------------------------- E_europaeus300433 -------------------------------------------------- E_europaeus300454 -------------------------------------------------- E_europaeus300464 -------------------------------------------------- E_europaeus300544 -------------------------------------------------- E_europaeus300549 -------------------------------------------------- E_europaeus300591 -------------------------------------------------- E_europaeus300701 -------------------------------------------------- E_europaeus300721 -------------------------------------------------- F_catus300053 -------------------------------------------------- H_sapiens300058 -------------------------------------------------- H_sapiens300480 -------------------------------------------------- L_africana300063 -------------------------------------------------- L_africana300379 -------------------------------------------------- L_africana300481 -------------------------------------------------- M_mulatta300012 -------------------------------------------------- M_mulatta300195 -------------------------------------------------- M_mulatta300271 -------------------------------------------------- M_mulatta300286 -------------------------------------------------- M_mulatta300298 -------------------------------------------------- M_mulatta300376 -------------------------------------------------- M_mulatta300391 -------------------------------------------------- M_mulatta300408 -------------------------------------------------- M_mulatta300476 -------------------------------------------------- M_mulatta300480 -------------------------------------------------- M_mulatta300488 -------------------------------------------------- M_murinus300225 -------------------------------------------------- M_murinus300268 -------------------------------------------------- M_murinus300303 -------------------------------------------------- M_murinus300410 -------------------------------------------------- M_domestica300024 -------------------------------------------------- M_musculus300704 -------------------------------------------------- M_musculus300786 -------------------------------------------------- M_musculus300787 -------------------------------------------------- M_musculus300823 -------------------------------------------------- M_musculus300924 -------------------------------------------------- M_lucifugus300035 -------------------------------------------------- M_lucifugus300537 -------------------------------------------------- M_lucifugus300624 -------------------------------------------------- M_lucifugus300690 -------------------------------------------------- O_anatinus303218 -------------------------------------------------- O_cuniculus300002 -------------------------------------------------- O_cuniculus300003 -------------------------------------------------- O_cuniculus300028 -------------------------------------------------- O_cuniculus300143 -------------------------------------------------- O_cuniculus300155 -------------------------------------------------- O_cuniculus300284 -------------------------------------------------- O_cuniculus300286 -------------------------------------------------- O_cuniculus300362 -------------------------------------------------- O_cuniculus300404 -------------------------------------------------- O_cuniculus300435 -------------------------------------------------- O_cuniculus300510 -------------------------------------------------- O_garnettii300026 -------------------------------------------------- O_garnettii300054 -------------------------------------------------- O_garnettii300084 -------------------------------------------------- O_garnettii300102 -------------------------------------------------- O_garnettii300162 -------------------------------------------------- O_garnettii300481 -------------------------------------------------- P_troglodytes300017 -------------------------------------------------- P_troglodytes300069 -------------------------------------------------- P_troglodytes300091 -------------------------------------------------- P_troglodytes300149 -------------------------------------------------- P_troglodytes300155 -------------------------------------------------- P_troglodytes300215 -------------------------------------------------- P_troglodytes300253 -------------------------------------------------- P_troglodytes300314 -------------------------------------------------- P_troglodytes300385 -------------------------------------------------- P_troglodytes300386 -------------------------------------------------- P_troglodytes300464 -------------------------------------------------- P_pygmaeus300072 -------------------------------------------------- P_pygmaeus300096 -------------------------------------------------- P_pygmaeus300135 -------------------------------------------------- P_pygmaeus300203 -------------------------------------------------- P_pygmaeus300271 -------------------------------------------------- P_pygmaeus300353 -------------------------------------------------- P_pygmaeus300356 -------------------------------------------------- P_pygmaeus300367 -------------------------------------------------- P_pygmaeus300421 -------------------------------------------------- P_pygmaeus300423 -------------------------------------------------- R_norvegicus300010 -------------------------------------------------- R_norvegicus300083 -------------------------------------------------- R_norvegicus300126 -------------------------------------------------- R_norvegicus300144 -------------------------------------------------- R_norvegicus300229 -------------------------------------------------- R_norvegicus300252 -------------------------------------------------- R_norvegicus300361 -------------------------------------------------- R_norvegicus300401 -------------------------------------------------- R_norvegicus300463 -------------------------------------------------- R_norvegicus300475 -------------------------------------------------- R_norvegicus300570 -------------------------------------------------- R_norvegicus300658 -------------------------------------------------- R_norvegicus300671 -------------------------------------------------- R_norvegicus300809 -------------------------------------------------- R_norvegicus300843 -------------------------------------------------- R_norvegicus300901 -------------------------------------------------- R_norvegicus301001 -------------------------------------------------- R_norvegicus301053 -------------------------------------------------- R_norvegicus301063 -------------------------------------------------- S_cerevisiae300022 GCCGGATTTGTCTTTTTGACTAATTTTCAACCTATTCTTACTTCCAAAAC S_araneus300035 -------------------------------------------------- S_araneus300052 -------------------------------------------------- S_araneus300077 -------------------------------------------------- S_araneus300080 -------------------------------------------------- S_araneus300189 -------------------------------------------------- S_araneus300272 -------------------------------------------------- S_araneus300283 -------------------------------------------------- S_araneus300302 -------------------------------------------------- S_araneus300366 -------------------------------------------------- S_araneus300377 -------------------------------------------------- S_araneus300470 -------------------------------------------------- S_araneus300608 -------------------------------------------------- S_araneus300689 -------------------------------------------------- S_araneus300842 -------------------------------------------------- S_araneus300881 -------------------------------------------------- S_araneus300938 -------------------------------------------------- S_araneus301004 -------------------------------------------------- S_tridecemlineatus300039 -------------------------------------------------- S_tridecemlineatus300164 -------------------------------------------------- S_tridecemlineatus300203 -------------------------------------------------- S_tridecemlineatus300218 -------------------------------------------------- T_nigroviridis300074 -------------------------------------------------- T_belangeri300014 -------------------------------------------------- T_belangeri300159 -------------------------------------------------- T_belangeri300192 -------------------------------------------------- T_belangeri300220 -------------------------------------------------- T_belangeri300331 -------------------------------------------------- T_belangeri300378 -------------------------------------------------- C_familiaris300038 -------------------------------GTGCGCTCCCAAGG--CTG C_familiaris300096 -------------------------------GTGCGCTCCCAAGG--CTG C_porcellus300388 -------------------------------GTGCCCTTTTAAGG--TTG C_porcellus300424 -------------------------------GTGCCCCTTTAACA--CTG C_porcellus300564 -------------------------------GTGCCCTTTTAAGG--TTG C_porcellus300616 -------------------------------TTGCCCTTTTAAGG--TTG D_rerio300277 -------------------------------TTGCCCACTGGAGG--CTG D_rerio300278 -------------------------------------TTGCACATTCAAG D_novemcinctus300004 -------------------------------CTGCGCTTTTAAGG--TTG D_novemcinctus300069 -------------------------------GTGCCCTTTTAAGG--TTG D_novemcinctus300134 ---------------------------------TAGCACTTGAAACTAGC D_novemcinctus300226 -------------------------------GTGCCCTTTTAAGA--TTA D_novemcinctus300305 -------------------------------------------------- D_novemcinctus300353 -------------------------------GTGCCCTTTTAAGA--TTG D_novemcinctus300356 -------------------------------GTGCCCTTTTAAGG--TTG D_novemcinctus300614 -------------------------------GTGCCCTTTTAAGG--TTG D_novemcinctus300615 -------------------------------GTGGCCTTTTAAGA--TTG D_melanogaster300121 -----------------------------ATGGGCACAGTTTTAAACTAG D_melanogaster300122 -------------------------------CGGCATGCCAACTAAAAAG E_telfairi300086 -------------------------------GTGCCCTTGTAAGG--TTG E_telfairi300115 -------------------------------GTGCCCTTTTAAGG--TTG E_telfairi300178 -------------------------------GTGCCCTGGCA-GG--TTG E_telfairi300184 -------------------------------GTGCCCCTTTAAGG--TTG E_telfairi300295 -------------------------------GTGCCCTTTTAAGG--TTG E_telfairi300318 ----------------------------------TTAGTGCTAAAACTTC E_telfairi300340 ------------------------------------------GTACGAAA E_telfairi300402 -------------------------------GTGCCCTTTGAAGT--TTG E_telfairi300433 -------------------------------GTGCCCTTTTAAGG--TTG E_telfairi300475 -------------------------------GTGTCCTTCTAAGG--TTG E_telfairi300487 -------------------------------GTGCCCTTTTAAGG--TTG E_telfairi300593 -------------------------------------------------- E_telfairi300640 -------------------------------GTGCCCTTTTAAGG--TTG E_telfairi300673 -------------------------------GTGCCCTTTTAAGG--TTG E_telfairi300734 -------------------------------GTGCCCTATTAAGG--TTG E_telfairi300741 -------------------------------GTGCCCTTTTAAGG--TTG E_telfairi300764 -------------------------------GTGCCCTTTTAAGG--TTG E_telfairi300765 -------------------------------TAGGCCTTTTTAGG--CTG E_caballus300070 -------------------------------GTGCCCTTTTAAGG--TTG E_caballus300254 -------------------------------GTGCCCTTTTAAGG--TTG E_europaeus300034 -------------------------------GTGCCTTT--AAGG--TTG E_europaeus300117 -----------------------------------ATGCCTTATTAAAGA E_europaeus300122 -------------------------------GTGCCCTTTAAAGG--TTG E_europaeus300204 -------------------------------GTACACTTTTAAGG--CTG E_europaeus300219 -------------------------------------TTGCCCTTTTAAA E_europaeus300239 -----------------------------------------------GAG E_europaeus300272 ---------------------------------TTACCATTGTTGATTCA E_europaeus300346 -------------------------------GTGCTCTTTTAAGA--TTG E_europaeus300352 --------------------------------------CTGCCCGACTCC E_europaeus300375 -------------------------------GTACACTTTTAAGG--CTG E_europaeus300380 -------------------------------ATACCCTTTCTATTGGTTG E_europaeus300383 ---------------------------------TTATCCTTACCTAAAGA E_europaeus300388 -------------------------------GTACTCTTTTAAGG--CTG E_europaeus300389 -------------------------------GTGCTCTTTTAATG----- E_europaeus300428 -------------------------------ATGCCCTTTTAAGG--CTT E_europaeus300433 -------------------------------GTGACCTTTGAAGG--TTA E_europaeus300454 ---------------------------------GTGCCCCTAAAT--TTA E_europaeus300464 -------------------------------GTGCCCTTCTTAGGG-TTG E_europaeus300544 -------------------------------GTGCCCTTTTGAGG--TTG E_europaeus300549 -------------------------------GTGCCCTTCTTAGGG-TTG E_europaeus300591 ---------------------------------------GCAAATTTTTA E_europaeus300701 ---------------------------------TTTTGTTTTGAAATATG E_europaeus300721 --------------------------------------TTTAAGG--TTG F_catus300053 -------------------------------GTGCCCTTTTAAGG--TTG H_sapiens300058 -------------------------------GTGCCCTTTTAAGG--TTG H_sapiens300480 -------------------------------GTTCCCTTTTAAGG--CTG L_africana300063 -------------------------------GTGCCCTTTTAAGG--TTG L_africana300379 -------------------------------GTGC-CTTGTAAGG--CTG L_africana300481 -------------------------------GTGCCATTTCAAGG--TTG M_mulatta300012 -------------------------------GTGCCCTTTTAAGG--TTG M_mulatta300195 -----------------------------------TGAACTTTAAAATGC M_mulatta300271 ------------------------------------------AAAAGACA M_mulatta300286 -------------------------------GTGCCCTTTTAAGG--TAG M_mulatta300298 -------------------------------ATGCCCTTTTAAGG--TTG M_mulatta300376 -------------------------------GTTCCTTTTTAAGG--CTG M_mulatta300391 -------------------------------GGGCCCCGTTAAGG--CTG M_mulatta300408 -----------------------------------GTGCCTAAGG--TTA M_mulatta300476 -------------------------------GTGCCCTTTTAAGG--TTG M_mulatta300480 -------------------------------GTGCCCTTTCAAGG--TCG M_mulatta300488 ------------------------------GTGCCGCTTTTAAGG--TTA M_murinus300225 -------------------------------GTGTCCTTTTAAAG--TTG M_murinus300268 -------------------------------GTGTCATTTTAAAA--TTG M_murinus300303 -------------------------------GTGCCCTTTTAAAG--TTG M_murinus300410 -------------------------------GCGCCCTTTTAAGG--TCG M_domestica300024 --------------------------------TAGCCTGTTAAAG--CTG M_musculus300704 -------------------------------GTGCCTTTTTAAGG--TTG M_musculus300786 ------------------------------------------AAGACACA M_musculus300787 -------------------------------GTGCCCTTTTAAGG--TTG M_musculus300823 -------------------------------GTGCCCTTTCTAGG--CTA M_musculus300924 -------------------------------GTGCCCTTTTAAGG--TTG M_lucifugus300035 -------------------------------GTGCCCTTTTAAGG--TTG M_lucifugus300537 --------------------------------ATACACCCAGAATGTATA M_lucifugus300624 -------------------------------GTGCCCTTTTAAGG--TTG M_lucifugus300690 --------------------------------------ATAACTGAGAAA O_anatinus303218 -------------------------------GTGCTCCCTTAGAG--CTG O_cuniculus300002 ------------------------------------------GCCCTATA O_cuniculus300003 -------------------------------GTGTCCTTTTAGAG--CTG O_cuniculus300028 -------------------------------TTTCCCTTTTAGAG--CTG O_cuniculus300143 -------------------------------GTGCCCTTTTACAG--CTA O_cuniculus300155 -------------------------------TTTCCCTTTTAGAG--CTG O_cuniculus300284 ----------------------------GTGCCCTTTTGTTAGAG--CTG O_cuniculus300286 -------------------------------GTGCCCTTTTACAG--CTA O_cuniculus300362 -------------------------------GTGCCCTTTTAGAG--CTG O_cuniculus300404 -------------------------------GTGCCCTTTTAAAA--CTG O_cuniculus300435 -------------------------------GTGACCTTTTAGAA--CTG O_cuniculus300510 -------------------------------GTGCCCTTTCAGAG--CTG O_garnettii300026 -------------------------------GTGCCCTTTTAGGG--CTG O_garnettii300054 -------------------------------TTATTCTTTTAAGG--TTG O_garnettii300084 -------------------------------GTGCCCTTTTAAGG--CTG O_garnettii300102 -------------------------------GTGCCCTTTTAAGG--CTG O_garnettii300162 -------------------------------GTGGCCTTTTAAGG--TTG O_garnettii300481 ---------------------------------TCACCCTTTCCTGTCCC P_troglodytes300017 -------------------------------GTTCCCTTTTAAGG--CTG P_troglodytes300069 -----------------------------------TGAACTTTAAAATGC P_troglodytes300091 -------------------------------TGCCCCTTTTAAGG--TTG P_troglodytes300149 -------------------------------GCACCCCTTTAAGG--CTG P_troglodytes300155 -------------------------------GTGCCCTTTTAAGG--TTG P_troglodytes300215 ----------------------------------------TTGCCGCCCA P_troglodytes300253 -------------------------------GTGTCCTTTTAAGG--TTG P_troglodytes300314 -------------------------------GTGCCCTTTTAAGG--TAG P_troglodytes300385 -------------------------------GTGCCCTTTTAAGG--TTG P_troglodytes300386 -------------------------------ATGCCCTTTTAAGG--TTG P_troglodytes300464 -----------------------------------GTGCCTAAGG--TTA P_pygmaeus300072 -----------------------------------GTGCCTAAGG--TTA P_pygmaeus300096 -------------------------------TGCCCCTTTTAAGG--TTG P_pygmaeus300135 -------------------------------GTGCCCTTTTAAGG--TTG P_pygmaeus300203 -------------------------------GTGCCCTTTTACGG--TTG P_pygmaeus300271 -----------------------------------------------ATG P_pygmaeus300353 -------------------------------GTGTCCTTTTAAGG--TTG P_pygmaeus300356 -----------------------------------TGAACTTTAAAATGC P_pygmaeus300367 ----------------------------------------TTGCCGCCCA P_pygmaeus300421 -------------------------------GTGCCCTTTTAAGG--TTG P_pygmaeus300423 -------------------------------GTTCCCTTTTAAGG--CTG R_norvegicus300010 -------------------------------GTGCCCTTTTAAGG--TTG R_norvegicus300083 --------------------------------------ATAAATA--TTG R_norvegicus300126 -----------------------------------GTTCCTTCAGCTAAA R_norvegicus300144 -------------------------------GTGCCCTTTTAAGG--TTG R_norvegicus300229 -------------------------------GTGCCCTTTTAAGG--TTG R_norvegicus300252 -------------------------------GTGCCCTTTTAAGG--TTG R_norvegicus300361 -------------------------------GTGCCCTTTTACGG--TTG R_norvegicus300401 -------------------------------GTGCCCTTT-AACA--TTG R_norvegicus300463 -------------------------------------CAGCTCCGAAAAA R_norvegicus300475 -------------------------------GTGCCCTTTTAAGG--TTG R_norvegicus300570 ---------------------------------------GTTTAGTCAAA R_norvegicus300658 -------------------------------ATTCCCTGGGCAGG--TGG R_norvegicus300671 -------------------------------GTGCCCTTTTAAGG--TTG R_norvegicus300809 -------------------------------GTGCCCCTTAAAGG---TG R_norvegicus300843 -------------------------------GTGCCCTTTTAAGG--TTG R_norvegicus300901 -------------------------------GTGCCCTTTTAAGG--TTG R_norvegicus301001 -------------------------------GTGCCCTTTCTGGG--ATG R_norvegicus301053 -------------------------------GTGCCCTTTTAAGG--TTG R_norvegicus301063 -------------------------------GTGCCTTTA--AGG--TTG S_cerevisiae300022 TGTTGCAATGGCTCTCGTTTTTTTTAAATTTTTCTCTTTTCTCTTCTTTG S_araneus300035 -------------------------------GTGCCCTCTTAAGG--CTG S_araneus300052 -------------------------------GTGTGCCCTTAAGG--TGG S_araneus300077 -----------------------------------------------ATC S_araneus300080 -------------------------------TCTCTCTACTAAGG--TTG S_araneus300189 ------------------------------------------AAACCTGT S_araneus300272 -------------------------------GTGTCCTTTTAAGA--CTG S_araneus300283 -------------------------------GTGCCCTCCTAAGA--CTG S_araneus300302 -------------------------------TAGTCCTTTGAAGG--TTG S_araneus300366 ----------------------------------ACACCCTTTTAAAAGT S_araneus300377 -------------------------------GTACCCTTCTAAAA--TTG S_araneus300470 -------------------------------GTACCTTGTTGGGC--TTG S_araneus300608 -------------------------------GCGCCCTCTTAAGG--CAG S_araneus300689 -------------------------------GCATCCTCTTCAGG--TTG S_araneus300842 -------------------------------GTGCCCTTCTAAGG--TTG S_araneus300881 -------------------------------GTGTCA-GGCAGGC--TTC S_araneus300938 -------------------------------TTGCTCTTTTAAGG--CTG S_araneus301004 -------------------------------ATGCCCTTTTAAGG--TTG S_tridecemlineatus300039 -------------------------------GTGCCTTTTTAAGG--TTG S_tridecemlineatus300164 ----------------------------------------------AAAA S_tridecemlineatus300203 ------------------------------------TAACCAGAAAACTC S_tridecemlineatus300218 -------------------------------GTGTCCTTTTAAGG--CTG T_nigroviridis300074 -------------------------------TTGCCCACCTCAGG--CAG T_belangeri300014 -------------------------------GTGCCCT-----GG--TTG T_belangeri300159 -------------------------------GTGCCCT-----GG--T-G T_belangeri300192 -------------------------------GTGCCCTCTTAAGG--CTG T_belangeri300220 -------------------------------GTGCCCTTTTAAGG--CTG T_belangeri300331 -------------------------------GTGCCCTTCTAAGG--CTG T_belangeri300378 -------------------------------GTGCCCTTCCGAGG--TTC C_familiaris300038 CCGCAG----TGCCC-TGGGA--------GGCCAACACAGAAGGGGA--- C_familiaris300096 CCGCAG----TGCCC-TGGGA--------GGCCAACACAGAAGGGGA--- C_porcellus300388 ATACAG----TGCCT-TAAGA--------GGCTAACACAGAAGAGTA--- C_porcellus300424 ACATA----GTGCCTT-AAGAAGCTAAC--------ACAGAAGGGTAAA- C_porcellus300564 ATACAG----TGCCT-TAAGA--------GGCTAACACAGAAGGGTA--- C_porcellus300616 ACACA----GTGCCTTCAAAGGG-TAAT--------ACAGAAGGGAAAA- D_rerio300277 TCTGT------GTCTCTAGTGGCCATAA---------CAGGGGGGTATA- D_rerio300278 TCC--TTCTATGGCTTGAGTGA---------ATAACACAGGGGGGCAGA- D_novemcinctus300004 ATTCTGCATTT----G-AAGAGG--------CTAACACAGAA-G------ D_novemcinctus300069 ATTCTGTATTT----T-AAGAGG--------CCCACACAGAATG------ D_novemcinctus300134 CTTGTTTA-AAGTGAATTG-------------CTGCACAGAAGTGTAAA- D_novemcinctus300226 ATTCA----GTGCTTT-AATTGG--------TTAGCACAGAAGG------ D_novemcinctus300305 ---------GTGTTCTT--------------CTAACACAGAAGGGTAAA- D_novemcinctus300353 ATTCA----GTGCTTT-AAGTGGCTAATATAAAAATGTAGAAGGGTAAA- D_novemcinctus300356 ACTCA----GTGCTTT-AAGAAG--------CTAACACAGAAGG------ D_novemcinctus300614 ATTCAGTACTT----T-AAGAGG--------CTAACACAGAAGG------ D_novemcinctus300615 ATTCA----GTGCTTT-AAGAGA--------CTAACGCAGAAGG------ D_melanogaster300121 GTGGTTA---TCCTCCATGGAAGATCACCGATCGAAAGCTGTGCCCAAA- D_melanogaster300122 GCGGTTGC--TCCATTCTGGACAACTGCTGA-CGATACGTGTGCCCAGA- E_telfairi300086 TTGCAG----TACTT-TAAGA--------GGTGAACACAGAAAGGCA--- E_telfairi300115 CTGCGG----TACTT-TAAGA--------GGCTAACACAGAAGGGTAAAT E_telfairi300178 CTGCAG----GGCCT-GCACA--------GGCTCACACAGAAGGGCA--- E_telfairi300184 CTGCAG----TGCTT-TAAGA--------GGGGAACACAGACTGGCA--- E_telfairi300295 CTGCAA----TACTT-TAAGA--------GGCTAACACAGAAGGGTA--- E_telfairi300318 AGAAAT---ATTTTTAAAGG-----------CGATCATTGGT-GGTAAA- E_telfairi300340 ACCAACAAAAGTTAAGAGG------------CTAACACAGAAGGGTAAA- E_telfairi300402 CTGCA----GCGCTTA-AAGAGG--------CTAATGCAGAAGG------ E_telfairi300433 CTGCAG----TACTT-TAAGA--------GGCTAACACAGAAGGGTA--- E_telfairi300475 CTGCGG----TACTT-TAAGA--------GGCTAACACAGAAGGGTA--- E_telfairi300487 CTGCGG----TACTT-TAAGA--------GGCTAACACAGAAGGGTAAAT E_telfairi300593 ------GA-AACCCTCTGGC-----------GCAACACAGAAGGGTAAA- E_telfairi300640 CTGCAG----TACTT-TAAGA--------GGCTAACACAGAAGG-TA--- E_telfairi300673 CTGCAG----TACTT-TAAGA--------GGCTAACACAGAAGGGTA--- E_telfairi300734 CTGCAG----CACTT-TAAGA--------GGTTAACACCGAAGGGTA--- E_telfairi300741 CTGCAG----TATTTGAAAGA--------GGCTAACACAGAAAGATG--- E_telfairi300764 CTGCGG----TACTT-TAAGA--------GGCTAACACAGAAGGGTA--- E_telfairi300765 GTGCT----GTGCTTT-AAGG----------CTAGCACGGAAGG------ E_caballus300070 ACGCA----GTGCCTT-AAGAGGCTAAC--------ACAGAAGGGCAAA- E_caballus300254 ACGCA----GTGCCTT-AAGAGGCTAAC--------ACAGAAGGGCAAA- E_europaeus300034 ATGCA----GT-GCTTCAAGATG-CTAC--------ACGGAAAAGTAAA- E_europaeus300117 CTG-TTGCAATG-ATTAAGAGA---------CTAACACAGAAAGGTAAA- E_europaeus300122 ATGCA----GT-GCTTCAAGATG-CTAC--------ACGGAAAAGTAAA- E_europaeus300204 ACACA----GTCCTTT-AAGAGACTTA-----------ACACTGAAGGG- E_europaeus300219 GTTAATGCAATGGTTTGAGAGG---------CTAACACAGAAGGGCAAA- E_europaeus300239 GCT--TCTAGTGCTTGAAGAGG---------CTAACACAGAAAGGTAAA- E_europaeus300272 CTG-ATGCAGTGCTTTAAGTGG---------CTAACACAGAAGGGGAAA- E_europaeus300346 ACTCA----GCGCTTT-AAGAGGCTAAC--------ACAGAAGGGAAAA- E_europaeus300352 CTATA--CAGTGTTTTCAGAGA---------TGAACACAGGAGGGTGAA- E_europaeus300375 ACACA----GTCCTTT-AAGAGACTTA-----------ACACTGAAGGG- E_europaeus300380 ACAGA----GTACTTT-AAGAGG--------CTAGCTCAAAAGG------ E_europaeus300383 CT-----CACTG-TTTAAGAAG---------CTAACACAGAAGGGTAAA- E_europaeus300388 GTGCA----GTGCTTT-TAGAGGCTAAC--------ACAGAA-GAGGGA- E_europaeus300389 ---CA----GTGCTTT-AAGAGGCTAAC--------ACAGAAGGATAAA- E_europaeus300428 ---TA----A---TTT-AAGAAG--------TTAACATAGAAGG------ E_europaeus300433 ATGCA----ACG-TTT-AAGAGA--------CTAACATAGAAGA------ E_europaeus300454 ATGCA----GTGTGTT-AAGAGGCTATG--------GCAAAAGGATAAA- E_europaeus300464 ATGCTTTAAGTGCTTT-AAGACG--------TTAACATAGAAGG------ E_europaeus300544 ATGCA----GTTCTTA-AAAAGG--------CTAACACAGAAGG------ E_europaeus300549 ATGCTTTAAGTGCTTT-AAGACG--------TTAACATAGAAGG------ E_europaeus300591 TTTGACTTGGTACTTTCAGAGG---------CTAGCACAGAAGAATAAA- E_europaeus300701 AAAAATCACATTCTAATTTG-----------CTAACATAGGAAGGTAAA- E_europaeus300721 ATGCA----GTGCTTTAAAAGACTTAAC--------ACAGA-------A- F_catus300053 ACGCA----GTGCCTT-AAGAGGCTAAC--------ACAGAAGGGTAAA- H_sapiens300058 ACCCA----GTGCTTT-AAGAGGCTAAC--------ACAGAAGGGTAAA- H_sapiens300480 ACCCA----GTGCTTT-AAGAGGCTGAT--------ACAGAAGGGTAAA- L_africana300063 CTGCA----GTGCTTT-AAGAGGCTAAC--------ACAGAAGGGTAAA- L_africana300379 ATGCAG----TGCCC-AAGGT--------GGCT-GCACAGGAGG------ L_africana300481 ACGCT----GTGATTT-AAGAAG--------CTAACACAGAAGG------ M_mulatta300012 ACCCA----GTGCTTT-AAGAGGCTAAC--------ACAGAAGGGTAAA- M_mulatta300195 AAGTTCACAGTTCTTTAAGAGA---------CTAACACAGAAAGCTAAA- M_mulatta300271 AACAACCAAATTAAAAAA--------------TAACACAGAAGAGTAAG- M_mulatta300286 ACACA----GTTTTTT-AAGCGGCTAGC--------ACAGAAGGGTAAA- M_mulatta300298 ATGTA----GTGCTTT-AAGAAGCTAAC--------ATAGAAGGATAAA- M_mulatta300376 GCCCA----GTGCTCT-AAGAGGCTGAT--------ACAGAAGGATAAA- M_mulatta300391 ATGCA----ATGCTTT-AAGAGGCTAAC--------ACAGAAGGGTAAA- M_mulatta300408 ACACA----GTGCCTT-AAGAGGCTAAC--------ACAGAAGGGCAAA- M_mulatta300476 ACACA----GTGCCTT-AAGAGC--------CTAACACAGAAGT------ M_mulatta300480 ACGCA----GTGCTTT-AAGGGGCTAAC--------ACAGAAGGGTTAA- M_mulatta300488 ACACA----GTGCTTT-AAG-----------------CAGAAGGGTAAA- M_murinus300225 ACGCA----GTGCTTT-AAGAGGCTAAC--------ACAGAAGGGTAAA- M_murinus300268 TTGCA----GTGCTTT-AAGAGGCTAAA--------ACAGAAGGGTATA- M_murinus300303 ACGCA----GTGCTTT-AAGAGGCTAAC--------ACAGAAGGGTAAA- M_murinus300410 ----------------AAAGA--------GGCTAACACAGAGAGGCA--- M_domestica300024 ---CA----GTGCTTT-AAGAGGCTAAC--------CCAGAATGAAGGG- M_musculus300704 TCACGG----TACTT-TAAGA--------GGCTAACACAGAAGGGTA--- M_musculus300786 CAGAGGATACTTTAAAAGG------------CTAACACAGAAGGGCAAA- M_musculus300787 ATACTG----TACTT-TAAGA--------GGCTAACACAGAAGGGTA--- M_musculus300823 ACACA----GTCCTGT-AAGAGGCTAGC--------ACAGAGGGGTAGA- M_musculus300924 ACACTG----TACTT-TAAGA--------GGCTAACACAGAAGGGTA--- M_lucifugus300035 ACGCA----GTGCCTT-AAGGGGCTAAC--------ACAGAAGGGTAAA- M_lucifugus300537 AAGAATTCCTACTTAAGAGG-----------CTAACACAGA-GGGTAAA- M_lucifugus300624 ACTCA----GTGCCTT-AAGAGGCTAAC--------ACAGAAGGGTAAA- M_lucifugus300690 ACATACGCAGTGCCTTAAGGTG---------CTAACACAGAAGGGTAAAA O_anatinus303218 CTT------GTGCTCTAAGGGGC----------AACACAGGAGGGAATA- O_cuniculus300002 ACAAATAG-AAAACCATAGC-----------AAAGCACAGAAGGGGAAA- O_cuniculus300003 ACAGA----GTGCTTT-AAGAGGCTAAC--------ATATAAGTGGAAA- O_cuniculus300028 AGAGT----GTGCTTT-AAGAGGCTAAC--------ACAGAAGGGGAAA- O_cuniculus300143 ACACA----GTGCTTT-AAGAGGCTAAC--------ACAGAAGGGGAAA- O_cuniculus300155 AGAGT----GTGCTTT-AAGAGGCTAAC--------ACAGAAGGGGAAA- O_cuniculus300284 ACAGA----GTGCTTT-AAGAGGCTAAC--------ACAGAAGGG-AAA- O_cuniculus300286 ACACA----GTGCTTT-AAGAGGCTAAC--------ACAGAAGGGGAAA- O_cuniculus300362 ACAGA----ATGCTTT-AAGAGGCTAGC--------ACAGAAGGGGAAA- O_cuniculus300404 ACAG------TGCTTT-AAGAGGCTAAC--------ACAGAAGGGGAAA- O_cuniculus300435 ATGGA----GTGCTTT-AAGAGGCTAAC--------ACAGGTGGGGAAA- O_cuniculus300510 ACAGA----GTGCTCT-GAGAGGCTAAC--------ACAGAAAGGGAAA- O_garnettii300026 ATGCA----GGGCTCTAAAAGGC-TAAC--------ACGGAAGG--AAA- O_garnettii300054 ATGCA----GTTCTTTAAGAGACT-AAC--------ATGGAGGGGTAAA- O_garnettii300084 ATGCA----GTGCTTT-AAGGGA--------GGAACACAGAAGT------ O_garnettii300102 ATGCA----GTGCTTT-AAGGGA--------GGAACACAGAAGT------ O_garnettii300162 ATGCA----GTGCTTT-AAGAGGCTAAC--------ACAGAAGGGTAAA- O_garnettii300481 TTACATGCAGTGCTTTAAGAGG---------CTAACACAGAAGGGTAAA- P_troglodytes300017 ACCCA----GTGCATT-AGGAGGCTGAT--------ACAGAAGGGTAAA- P_troglodytes300069 AAGTTCATAGATCTTTAAGAGA---------CTAACACAGAAAGCTAAA- P_troglodytes300091 ACACA----GTGCATT-AAG-----------------CAGAAGGGTTAA- P_troglodytes300149 ATGCA----ATGCTTT-AAGAGGCTAAC--------ACAGAAGGGTGAA- P_troglodytes300155 ACCCA----GTGCTTT-AAGAGGCTAAC--------ACAGAAGGGTAAA- P_troglodytes300215 CACAACCAAATTAAAAAA--------------TAACACAGAAGGGTAAG- P_troglodytes300253 ACACA----ATGCTTT-AAGAGC--------CTAACACAGAAAG------ P_troglodytes300314 ACGCA----GTTTTGT-AAGAGGCTAAC--------ACATAAGGGTAAAT P_troglodytes300385 ACGCA----GTGCTTT-AAGGGGCTAAC--------ACAGAAGGGTAAA- P_troglodytes300386 ATGTG----GTGCTTT-AAGAAGCTAAC--------ATAGAAGGATAAA- P_troglodytes300464 ACACA----GCGCCTT-AAGAGGCTAAC--------ACAGAAGGGCAAG- P_pygmaeus300072 ACACA----GCGCCTT-AAGAGGCTAAC--------ACAGAAGGGCAAA- P_pygmaeus300096 ACAC-----GTGCATT-AAG-----------------CAGAAGGGTTAA- P_pygmaeus300135 ACGCA----GTGCTTT-AAGGGGCTAAC--------ACAGAAGGGTAAA- P_pygmaeus300203 ATGTA----GTGCTTT-AAGAAGCTAAC--------ACAGAAGGATAAA- P_pygmaeus300271 ACCCTTTCCTGCGCCAGAGG-----------CTAACACAGAAGGGTAAA- P_pygmaeus300353 ACACA----GTGCTTT-AAGAGC--------CTAACACAGAAAG------ P_pygmaeus300356 AAGTTCATAGTTCTTTAAGAGA---------CTAACACAGAAAGCTAAA- P_pygmaeus300367 CACAACCAAATTAAAAAA--------------TAACACAGAAGGGTAAG- P_pygmaeus300421 ACCCA----GTGCTTT-AAGAGGCTAAC--------ACAGAAGGGTAAA- P_pygmaeus300423 ACCCA----GTGCTTT-AAGAGGCTGAT--------ACAGAAGGGTAAA- R_norvegicus300010 TCGCAG----TACTT-TAAGA--------GGCTAACACAGAAGGGTA--- R_norvegicus300083 CCCCAG----TACTT-TAAGA--------GGCTAACACAGAAGGGTA--- R_norvegicus300126 CATAAAGAAGAAAAGCAGG------------CTAACACAGAAGGGTAAA- R_norvegicus300144 TTGTGG----TACTT-TAAGG--------GGCTAACACAGACAGGTA--- R_norvegicus300229 TCGTGG----TACTT-TAAGA--------GGCTAACACAGAAGGGTA--- R_norvegicus300252 TCGCAG----TACTT-TAAGA--------GGCTAACACAGAAGGGTA--- R_norvegicus300361 TCATGG----TACTT-TAAGA--------GGCTAACACAAAAGGGTA--- R_norvegicus300401 CTGCAG----TGCTT-TAAGA--------TGCTAACACAGAAGGGTA--- R_norvegicus300463 AAGAACCAAAAAAAAAAAGAGG---------TTAACACAGAAGGGTAAA- R_norvegicus300475 TCGCAG----TACTT-TAAGA--------GGCTAACACAGAAGGGTA--- R_norvegicus300570 ---GTGGAGAATCTGGAGG------------CTAACACAGAAGGGTAAA- R_norvegicus300658 TTCTGGG---TTCTA-TAAGAAA---GCAGACTAACACAGAAGGGTA--- R_norvegicus300671 TCATGG----CTCTT-TAAGA--------GGCTAACACAAAAGGGTA--- R_norvegicus300809 GTGCT----GTACTTAAGAGG----------CTAACACAGAAGGGTAAA- R_norvegicus300843 TTGCAG----TACTT-TAAGA--------GGCTAACACAGAAGGATA--- R_norvegicus300901 GTACTG----TACCT-TAAGA--------GGCTAACACAGAAGGGTA--- R_norvegicus301001 ACACT----GTCCTGT-AAGAGGCTAGC--------ACAGAAGGGTAGA- R_norvegicus301053 TCGAGG----TACTT-TAAGA--------GGCAAACACAGAAGGGCA--- R_norvegicus301063 TCTCAG----TACTT-TAAGA--------GGCTAACACAGAAGGGTA--- S_cerevisiae300022 GCATAGTTTATTTTTAATAAATTATTTCAGGGTGAGATAGAGAAAGGAT- S_araneus300035 A--TG----GTGCTTTCAGAGGT-TAAC--------ACAGAAAGGTAAA- S_araneus300052 ACTTG----GTGCTTT-CAGGGGCTA----------GCAGGAGGATAAA- S_araneus300077 A-AAATTT-AAAATATTTGA-----------ACTTCAAAGAGCAGGAAA- S_araneus300080 ACTTG----GTGCTTTAAGAGGT-TCAC--------ACAGAAGGAAGAG- S_araneus300189 ATAAACC---TTTTGTCTAG-----------CCAA-ACAGAAGGGTAAA- S_araneus300272 GTGCA----GTGCCTT-AAGAGA--------TTAACAGAGA-GG------ S_araneus300283 TCTTG----GTGCTTTCAGAGAC-TCGT--------GTAAGAGGGTAAA- S_araneus300302 ATACC----ATGCTGTCAGAGAC-CAAC--------ACAGAAGGGGAAA- S_araneus300366 GGA--CACAGTGCTTTAAAGAG---------TGAGCACAGGAAGGTAAA- S_araneus300377 ATGCA----GTTGCTTTACATTGACAAT--------GCAGAAAGGTAAA- S_araneus300470 ATGCA----ATGCTTTTA-GAGG--------CTAACACAGAGG------- S_araneus300608 CCTCA----GGGCTCCAAGATGC-TAAC--------ACA-GAGGGTAAA- S_araneus300689 ACTCG----GTGGTTTCAGAGTC-TAAC--------ACAAAAGGGTAAA- S_araneus300842 AAGTA----GTGCTTTAAAGAAG--------CTAACACAGAAGAACAGAA S_araneus300881 AAACA----ACGCTTTTAAGAAA--------CTGACACAC--G------- S_araneus300938 ATGCA----GTGCTTTAAGAGGC-TAAC--------ACAGAAGGGTAAA- S_araneus301004 TTGCAGTACTTGCTTT-AAGAGG--------CTAACACAGAG-G------ S_tridecemlineatus300039 ACGCA----GTGCTTT-AAGAAG--------CTAACACAGAAGG------ S_tridecemlineatus300164 ATG-ATGCAGGAATTTAAGAGG---------CTCACACAGAAGGGCAAA- S_tridecemlineatus300203 CAGAATAGCCTTTTCTTGTGTA-------------CTTTAAAGGTTGAT- S_tridecemlineatus300218 ATGTG----ATACTTC-AAAAGGCTTATT--TTACCACAGAAGG------ T_nigroviridis300074 ACCGTT-----GCCTCTGGTGGAAACA----------CAGGGGGGCAGA- T_belangeri300014 ACGCC----ATGCTTT-TAGAGGCTAAC--------ACGGAAGGGTAAAA T_belangeri300159 ACGCC----ATGCTTT-TAGAGGCTAAC--------ACGGAAGGGTAAAA T_belangeri300192 CCGCA----GTGCTTT-AAGAGGCTAAC--------ACAGAAGGGTAAAG T_belangeri300220 CCGCA----GTGCTTT-AAGAGGCTAAC--------ACAGAAGGGTAAAG T_belangeri300331 CCGCA----GTGCTTT-AAGAGTCTAAC--------ATAGAAGGTTAAAA T_belangeri300378 ATGCT----GTGCTTT-AAGAGG--------TTAACACAGAAGG------ C_familiaris300038 --CAGCAAGG------CTCCAT---GAAA--CC------CAGGGAC---- C_familiaris300096 --CAGCAAGG------CTCCAT---GAAA--CC------CAGGGAC---- C_porcellus300388 --CAGGAACC------CTCCAT---AAAA--TC------CAGAGAA---- C_porcellus300424 ----GG-GACC-----CTCCAT----AGAACC-------CAGAGAA---- C_porcellus300564 --CAGGAACC------CTCCAT---AAAA--CC------CAGAGAA---- C_porcellus300616 ----GAAAGA------CTCCTT----AAAGCC-------CAGATAA---- D_rerio300277 ----TTGAGCTG---CTCTTGT----TAAAACC------CAGGCCA---- D_rerio300278 ----AGAATT------CTCTCA----AAAACC-------TGAAGTG---- D_novemcinctus300004 ----GTAAAGT-AAGTCTCCAT----AAAACC-------CAGAGAG---- D_novemcinctus300069 ----GTAAAGT-AAGCCTCCAT----AAAACC-------TGGAGAG---- D_novemcinctus300134 ----GTAAGT------CTCCGA----AAAACA-------GGAAGA----- D_novemcinctus300226 ----GCAAAAG-AAGTCTCCAT----AAAATC-------CAGGCAG---- D_novemcinctus300305 ----GTAAGT------CTCCAT----AAAAAT-------GAGAGA----- D_novemcinctus300353 ----TTAATT------CTCCAT----AAAACC-------CAGAGAG---- D_novemcinctus300356 ----G----AA-AAGTCTCCAT----AAAATG-------CAGAGAG---- D_novemcinctus300614 ----GTAAATT-AAGTCTCCAT----AAAACC-------CAGAGTG---- D_novemcinctus300615 ----GTAAAGT-AAGTCTCCAT----AAAACT-------CAGAGAA---- D_melanogaster300121 ----GCAAACCCCAGCCATTG----TAAAA---------CAGCGGC---- D_melanogaster300122 ----GCGAATCCAAAGCCTTGC---TAAAA---------CAGCGGC---- E_telfairi300086 --AAACGAGT------TTCCAT---AAAA--CC------CAGAGAT---- E_telfairi300115 A-AAGCAAGT------CTCCAT---AAAA--CC------CAGAGAC---- E_telfairi300178 --AAGCAAGT------CTCCAG---AAAA--CC------CAGGGAC---- E_telfairi300184 --AGGCACCC------CTCCAT---AAAA--CC------CAGAGAC---- E_telfairi300295 --AAGCAAGT------CTCCAT---AAAA--CC------TAGAGAT---- E_telfairi300318 ----GTAAGG------CTCCAG----AGAACC-------CAGAGA----- E_telfairi300340 ----GCAAAT------CTGCAT----ACAACC-------CAGAGA----- E_telfairi300402 ----GT-GTAT-GTGTCTCCAT----AAAACT-------CAGAGAA---- E_telfairi300433 --TAGCAAGT------CTCCAT---AAAA--CC------CAGAGAC---- E_telfairi300475 --AAGCAAGT------CTCCAT---AAAA--CC------CAGAGAC---- E_telfairi300487 A-AAGCACGT------CTCCAT---AAAA--CC------CAGAGAC---- E_telfairi300593 ----GCGAGG------CTCCAT----AAAGCC-------CAGAGAC---- E_telfairi300640 --AAGCAAGT------CTCCAT---AAAAAACC------CAAAGAC---- E_telfairi300673 --AAGCAAAT------CTCCAT---AAAA--CC------CAGAGAC---- E_telfairi300734 --AAGCA-GT------CTCCAT---GAAA--CC------CAGAGAT---- E_telfairi300741 --AAGCAAGT------TTCCAT---AAAA--CC------CAGAGAC---- E_telfairi300764 --AAGCAAGT------CTCCAT---TAAA--CC------CAGAGAT---- E_telfairi300765 ----GTAAAGT-AAGTCTCCAT----GAAAC------------------- E_caballus300070 ----GTAAGT------CTCCGT----AAAACC-------CGGAGAG---- E_caballus300254 ----GTAAGT------CTCCAT----AAAACC-------CTGAGAG---- E_europaeus300034 ----GAAAAG------CTCTA--------------------GAGAA---- E_europaeus300117 ----GTAAAT------TTCCAC----AAAGCC-------CAAAAA----- E_europaeus300122 ----GAAAAG------CTCTA--------------------GAGAA---- E_europaeus300204 ----TAAATT-------TCCAT---AAAGTCC-------CAAG------- E_europaeus300219 ----ATAAGT------GTCTAT----AAAACC-------CAGGGAA---- E_europaeus300239 ----ATAAAT------CTCCAT----AAAAGC-------CAGGGGA---- E_europaeus300272 ----GTAAAT------CTCCAT----AAGATC-------CAGGGA----- E_europaeus300346 ----GTAAGT------CTCCAT----AAAAGG-------CAAGGGA---- E_europaeus300352 ----GTAAGT------CTTCCT----AAAACCAAAGTTCCAAAGA----- E_europaeus300375 ----TAAATT-------TCCAT---AAAGTCC-------CAAG------- E_europaeus300380 ----GTAGCCT-ACGTCCTTAT----AAAACT-------CAGAGAA---- E_europaeus300383 ----GTAAGT------CTCCAT----AAAACC-------CAGGGG----- E_europaeus300388 ----CATAAT------CTCCAT---AAAAGCC-------CAGAGAA---- E_europaeus300389 ----GTAAAT------CTTTAT----AAAAT--------CAGGGAA---- E_europaeus300428 ----GTAAAGT-AAGTTTTCAT----AAAACC-------CAGTGGA---- E_europaeus300433 ----ATAAAGT-AAGTCTTCAC----AAAATC-------CAGGGAA---- E_europaeus300454 ----GTAAAT------CTCCAT----ATAACC-------CAAAGAA---- E_europaeus300464 ----GTAAAGTTAAGTCTTCAT----GAAACC-------CAGAGAA---- E_europaeus300544 ----GTAGAAT-TAGTCTTCAT----AAAACC-------CAGAAAA---- E_europaeus300549 ----GTAAAGTTAAGTCTTCAT----GAAACC-------CAGAGAA---- E_europaeus300591 ----GTAAAT------CTTTAT----AAAACT-------CAGAAA----- E_europaeus300701 ----GTAAGT------CTCCA-----ATAACC-------CAGAAA----- E_europaeus300721 ----GTAAGT------CTCCAT----AAAATT-------CAGGGAA---- F_catus300053 ----GTAAGT------CTCCAT----AAAACC-------CAGGGAT---- H_sapiens300058 ----GTAAGT------CTCCAT----AAAACC-------CAGAGAA---- H_sapiens300480 ----GTTAAGT-----CTCCAC----AAAATC-------CAGGGAA---- L_africana300063 ----GTAAGA------CTCTAT----AAAACC-------CAGAGAA---- L_africana300379 ----GTAAGT------CTCCAC---AAAA--CC------CAGAGAA---- L_africana300481 ----TTGAATT-CAGTCTCCGT----GAAACC-------CAGAGCA---- M_mulatta300012 ----GTAAGT------CTCCAT----AAAACC-------CAGAGAA---- M_mulatta300195 ----GTAATT------ATCCAT----AGAACC-------CAGAGA----- M_mulatta300271 ----GTAAGT------CTCCAT----TAAACA-------CAGGAA----- M_mulatta300286 ----GTAAGT------CTCCAT----AAAACC-------CGGAGAACAGA M_mulatta300298 ----ATAAGT------CTCTAC----AAAACC-------CAGAGAA---- M_mulatta300376 ----GTTAAGT-----CTCCAC----AAAACC-------CAGGGAA---- M_mulatta300391 ----GCTTTCT--TTACCCTTTGGGTAAAACC-------CAAAGAA---- M_mulatta300408 ----GTAAGT------CTCCAT----AAAACC-------CA---AA---- M_mulatta300476 -------AAGT-AAGTTTCCAT----AAAACC-------CAGAGAC---- M_mulatta300480 ----GGAAGT------CTCCAC----AAACCC-------CAGAGAA---- M_mulatta300488 ----GTAAGT------CTCCAT----AAAACC-------CAGAGAA---- M_murinus300225 ----GTAACT------CTCCAT----AAAACC-------CAGAGAA---- M_murinus300268 ----GTAA-T------CTTCAT----AAAACC-------CAAAGAA---- M_murinus300303 ----GTAAGT------CTCCAT----AAAACC-------CAGAGAA---- M_murinus300410 --AAGCGAGT------CTCCAT---AAAA--CC------CAGAGAG---- M_domestica300024 ----TATAATA--ATTCTCCAT---TAAA-CC-------CAAATCA---- M_musculus300704 --AAGGAACT------CTCCAT---AAAA--CC------CAGAGAG---- M_musculus300786 ----GGAACT------CTCTAT----AAAACC-------CAGAGG----- M_musculus300787 --AAGGAACT------CTCCAT---CAAA--CC------CAGAGAA---- M_musculus300823 ----GGAAAT------CTCTAT----TAA-CT-------CAGAAAA---- M_musculus300924 --AAGGAACT------CTCCAT---CAAA--CC------CAGAGAA---- M_lucifugus300035 ----CTAAGT------CTCCAT----AAAACC-------CAGAGAA---- M_lucifugus300537 ----GCAAGT------CTCCAT----AAAACC-------CAAAGA----- M_lucifugus300624 ----CTAAGT------CTCCAT----AAAACC-------CAGAGAA---- M_lucifugus300690 A---GTAAGT------CTCGAT----AAAACC-------CAGAGA----- O_anatinus303218 ------ACATT----CCTCTCT----TAAACC-------CAGAGCT---- O_cuniculus300002 ----GTAAGT------CTCCAT----AAAACC-------CAGAGA----- O_cuniculus300003 ----GTAAGT------CTCCAT----AAAACC-------CAGAGAA---- O_cuniculus300028 ----GAAAAG------CTCCAT----AAAACC-------TAGAGAA---- O_cuniculus300143 ----CTAAGT------CTCCAC----AAAACC-------CAGAGAA---- O_cuniculus300155 ----GAAAAG------CTCCAT----AAAACC-------TAGAGAA---- O_cuniculus300284 ----ATAAGT------CTCCAT----AAAACC-------CAGGGAA---- O_cuniculus300286 ----CTAAGT------CTCCAC----AAAACC-------CAGAGAA---- O_cuniculus300362 ----GTAAGT------TTGCAT----CAAACC-------CAGAGAA---- O_cuniculus300404 ----GTAAGT------CTCCCT----AAAACC-------CAGAGAA---- O_cuniculus300435 ----GTAAGT------CTCCAT----AAAATG-------CAGAGAA---- O_cuniculus300510 ----GTAAGT------CTCCAT----AAAACC-------CAGAGAA---- O_garnettii300026 ----GCACAT------CTCCAT----AAAACC-------CGGAGAA---- O_garnettii300054 ----GTAAAT------CTCCAT----AAAACC-------TGGAGAA---- O_garnettii300084 ----ATAAAGT-GAGTTTCCAT----AAAACC-------CAGGGAA---- O_garnettii300102 ----ATAAAGT-GAGTTTCCAT----AAAACC-------CAGGGAA---- O_garnettii300162 ----GTAAAT------CTCCAT----AAAACC-------CAGAGAA---- O_garnettii300481 ----GTAAAT------CTCCAC----GAAACC-------CAGAGA----- P_troglodytes300017 ----GTTAAGT-----CTCCAC----AGAATC-------CAGGGAA---- P_troglodytes300069 ----GTAATT------CTCCAT----AAAACC-------CAGAGA----- P_troglodytes300091 ----GTAAGT------CTCCAT----AAAACC-------CAGAGAA---- P_troglodytes300149 ----GCCAGTC--T---CCT-----TAAAACC-------CAAAGAA---- P_troglodytes300155 ----GTAAGT------CTCCAT----AAAACC-------CAGAGAA---- P_troglodytes300215 ----GTAAGT------CTCCAT----TAAACC-------CAGGAA----- P_troglodytes300253 ----GTAAAGT-AAGTTTCCGT----AAAACC-------CAGAAAT---- P_troglodytes300314 TCAAGTAAGT------CTCCAT----AAAACC-------CAGAGAAGAGA P_troglodytes300385 ----GGAAGT------CTCCAT----AAACCC-------CAGAGAA---- P_troglodytes300386 ----GTAAGT------CTCTAC----AAAACC-------CAGAGAA---- P_troglodytes300464 ----GTAAGT------CTCCAT----AAAACC-------CAGAGAA---- P_pygmaeus300072 ----GTAAGT------CTCCAT----AAAACC-------CAGAGAA---- P_pygmaeus300096 ----GTGAGT------CTCCAT----AAAATC-------CAGAGAA---- P_pygmaeus300135 ----GGAAGT------CTCCAT----AAACCC-------CAGAGAA---- P_pygmaeus300203 ----GTAAGT------CTCTAC----AAAACC-------CAGAGAA---- P_pygmaeus300271 ----GCCAGT------CTCCTT----AAAACC-------CAAAGA----- P_pygmaeus300353 ----GTAAAGT-AAGTTTCCAT----AAAACC-------CAGAGAC---- P_pygmaeus300356 ----GTAATT------CTCCAT----AAAACC-------CAGAGA----- P_pygmaeus300367 ----GTAAGT------CTCCAT----TAAACC-------CAGGAA----- P_pygmaeus300421 ----GTAAAT------CTCCAT----AAAACC-------CAGAGAA---- P_pygmaeus300423 ----GTTAAGT-----CTCCAC----AAAATC-------CAGGGAA---- R_norvegicus300010 --AAGGAAGT------CTCCAC---AAAA--CC------CAGAGAG---- R_norvegicus300083 --AAGGAAGT------CTCCAT---AAAA--CC------CAGAGAG---- R_norvegicus300126 ----GGAACT------CTCCAT----AAAACC-------ACAGAA----- R_norvegicus300144 --AAGGAACT------TTCCAT---AAAA--CC------CAGAGAG---- R_norvegicus300229 --AAGGAATT------CTCCAT---AAAA--CC------CAGAGAG---- R_norvegicus300252 --AAGGAAGT------CTCCAT---AAAA--CC------CAGAGAG---- R_norvegicus300361 --AAAGAACT------CTCCAT---AAAA--CC------TAGAGAG---- R_norvegicus300401 --AAGGAACG------CTCCAT---GAAA--CC------CAGACAG---- R_norvegicus300463 ----GGAAGT------CTCCGT----AAAACC-------CAGAGA----- R_norvegicus300475 --AAGGAAGT------CTCCAT---AAAA--CC------CAGAGAG---- R_norvegicus300570 ----GGAAGT------CTCCAT----AAAACC-------CAGAGA----- R_norvegicus300658 --AAGGAAGT------CTCCAT---AAAA--CC------CAGAGAG---- R_norvegicus300671 --AAGGAAGT------CTTCAT---AAAA--CC------CAGAGAG---- R_norvegicus300809 ----GCAACT------CTTCAT----AAAACC-------CAGGGAG---- R_norvegicus300843 --AAGGAAGT------CTCCAT---AAAA--CC------CAGAGAG---- R_norvegicus300901 --AAGGAACT------CTCCAT---AAAA--CC------CAGAGAA---- R_norvegicus301001 ----GGAAAT------CTCTAG----AGA-CT-------CAGAAAA---- R_norvegicus301053 --A------------------------------------------G---- R_norvegicus301063 --AAGGAAGT------CTCCAT---AAAA--CC------CAGAGAG---- S_cerevisiae300022 ---AATGAGTA-------TCGTAGATAAATCTTCGGTTCCGAATAGTGTA S_araneus300035 ----GT-AGT------CTCCAA----AAAACC-------CAGAGAG---- S_araneus300052 ----GTAAGT------TTCCAT----AAAACC-------CAAAGAG---- S_araneus300077 ----GTAAAT------CTCTAT----AAAACC-------CAGAGAC---- S_araneus300080 ----TAAAGT------CCCCAC----ACAACC-------AAGAAAG---- S_araneus300189 ----GTAAGT------CTCCAT----AAAATT-------CAGAGA----- S_araneus300272 ----GTAAAGG-CAGTCTCTGA----AAAATT-------CAG--AA---- S_araneus300283 ----ATCAGG------CTCTAT----AAAACC-------CAGGGAG---- S_araneus300302 ----GTAAGG------CTCCAT----AAAACC-------CAGAGAA---- S_araneus300366 ----GTAAGT------CTCCAT----AAAATT-------CAGAAA----- S_araneus300377 ----GTAAGA------ATCTAT----AAAACC-------TAGAGAG---- S_araneus300470 ----GTAAAGT-AAGTCTCCAT----AAAACC-------CAGAGAA---- S_araneus300608 ----GGAAGA------ATC-AT----AAAACA-------T----CC---- S_araneus300689 ----GTAAGT------CAGCAT----AAAATCT------CAGAGAG---- S_araneus300842 G--AGTAGATG-AAGTTTCTAT----AAAACT-------CAGAGAC---- S_araneus300881 ----GCACAGT-CAGTCTCCGG----AAAACC-------CAGAGAA---- S_araneus300938 ----GTGAAT------CTCCAT----AAAACC-------CAGGGAG---- S_araneus301004 ----GTAAAAT-AAGTCTTCAT----AAAACC-------CAGAGAA---- S_tridecemlineatus300039 ----GTAAAGC-AAACCTCCAT----AGAACC-------CAGAGAA---- S_tridecemlineatus300164 ----GGAAAC------CTTCAC----GGAACC-------CAGAGA----- S_tridecemlineatus300203 ----GCAGCCG-----ATAGGT---TAAAATC-------TAGAGAG---- S_tridecemlineatus300218 ----GTAAAAT-AAGTCTCCAT----AAAACC-------CAGAGAA---- T_nigroviridis300074 ----TT-AGCT----CTCTCAT----AAACCCG------CCATGAC---- T_belangeri300014 -----TAAGT------CTCCAT----AAAATC-------CAGAGAA---- T_belangeri300159 -----TAAGT------CTCCAT----AAAATC-------CAGAGAA---- T_belangeri300192 -----TAAGT------CTCCAT----AAAACC-------CAGAGAA---- T_belangeri300220 -----TAAGT------CTCCAT----AAAACC-------CAGAGAA---- T_belangeri300331 G----CAAGA------CTCCAT----AAAACT-------CAGAGAA---- T_belangeri300378 -----TAAAGT-AAGTCTCTGT----GAATTC-------CACAGAA---- C_familiaris300038 ------GAGCCCGCA----------------GAGCTCCTCTTTGGA---- C_familiaris300096 ------GAGCCCGCA----------------GAGCTCCTCTTTGGA---- C_porcellus300388 ------GAGACTG-----------------ACAC-TCCTCTTTGGA---- C_porcellus300424 ------GAGACTG------------------AAAC---TCTTTGAA---- C_porcellus300564 ------GAGACTT-----------------ACGC-TCCTCTTTGGA---- C_porcellus300616 ------GAGATTAAA-------------------CTCTTCTTTGGG---- D_rerio300277 ------GAGGTC------------------ATTCTCTGAGTCTGGA---- D_rerio300278 -----CTGGCT---------------TTGATATTCCATGCTTCGGA---- D_novemcinctus300004 ------GAGATTAT----------------AAAACTCCTCTTTGGA---- D_novemcinctus300069 ------GAGA-------------------------TCCTCTTTGGA---- D_novemcinctus300134 -----AGAGAT---------------TGTAAAA-CTCCTCTTTGGA---- D_novemcinctus300226 ------TAGGCTGT----------------AAAA-TCCTCTTTCAA---- D_novemcinctus300305 -----GGAGAT---------------TACAAAA-CTCCTCTTTAGA---- D_novemcinctus300353 ------GAGATTGT----------------AAAACTTCATTTTGGA---- D_novemcinctus300356 ------GAGATTGT----------------AAAACTCCCCTTTGGA---- D_novemcinctus300614 ------GAGATGAT----------------AAGACTCCTCTTTGGA---- D_novemcinctus300615 ------GAGATGAT----------------AAAAATCCTCTTTAAA---- D_melanogaster300121 ------GTGTTGG----------------------CCCTCAGTGCTCGCG D_melanogaster300122 ------CTGCTG-----------------------CTTTCAATGAGCTAG E_telfairi300086 ------GAGGTCACC---------------ATAACTCCTCTTTGGA---- E_telfairi300115 ------GAGGTCGGC---------------AGAACTCCTCTTTGGA---- E_telfairi300178 ------CGGGTTGCA---------------AGAACTCTTCTTTGGA---- E_telfairi300184 ------GAGGTCTGT---------------GGAACTCTTCTTTGGA---- E_telfairi300295 ------GAGGTTGGT---------------ACAACTCCTCTTTGGA---- E_telfairi300318 -----TGATAT---------------TGGAGAA-CTTCTCTTTGGA---- E_telfairi300340 -----AGAGGT---------------CAGTAGAACTTCTCTTGGGA---- E_telfairi300402 ------GAGATCAG----------------ATACCTCTTCTTTGGA---- E_telfairi300433 ------AAGGTCGGT---------------AGAACTCCTCTTTGGA---- E_telfairi300475 ------GAGGTCGGT---------------AGAACTCCTCTTTGGA---- E_telfairi300487 ------GAGGTCGGC---------------AGAACTCCTCTTTGGA---- E_telfairi300593 -----GAGGCC---------------GGTAGAA-CTCCTCTTTGGA---- E_telfairi300640 ------AAGATCGGT---------------AGAACTCCTCTTTGGA---- E_telfairi300673 ------GAGGTCGGT---------------AGAACTCCTCTTTGGA---- E_telfairi300734 ------GAGGTCGGT---------------AGAACTCCTATTTGGA---- E_telfairi300741 ------GAGGTCGGT---------------ATACCTCCTCTTTGGA---- E_telfairi300764 ------GAGGTCGGC---------------AGAACTCCTCTTTGGA---- E_telfairi300765 -----------------------------------TCCTCTTTGGA---- E_caballus300070 ------GAGATTGT----------------CGGACTCCTCTTTGGA---- E_caballus300254 ------GAGATTGT----------------CAGACTCCTCTTTGGA---- E_europaeus300034 ------GAGGTTGCA--------------AA---CACTTCTTTGGA---- E_europaeus300117 -----AGACA-----------------GC-AAAACTCT-----GAA---- E_europaeus300122 ------GAGGTTGCA--------------AA---CACTTCTTTGGA---- E_europaeus300204 -------------T----------------AAGACTGCTGTTTGGA---- E_europaeus300219 -----GAGGTT---------------ATAAAAATTT---TCTTGGA---- E_europaeus300239 -----GAAATT---------------GTGAAACTCT--TCTTTGGA---- E_europaeus300272 -----AGGGAT---------------TGC-AAAACTCTTCACTAAA---- E_europaeus300346 ------GAGACTGC----------------AAAACTCTTCTTTGGA---- E_europaeus300352 -----AGAGAT---------------TGC-AAAACTCTTCTTTGGA---- E_europaeus300375 -------------T----------------AAGACTGCTGTTTGGA---- E_europaeus300380 ------GAGATCGT----------------AAAACTCTTCTTTGGA---- E_europaeus300383 -----AGAGAT---------------TAC-AGAACTCTTCTTTGGA---- E_europaeus300388 ------GAGATAAT----------------AAAACACCTCTT-------- E_europaeus300389 ------GAGATTGT----------------GAAACTCTTCTTTAGA---- E_europaeus300428 ------GAGATTGT----------------GGAACTCTTCTTTGGA---- E_europaeus300433 ------GAGATTAC----------------AAAACTCTTCTTTGGA---- E_europaeus300454 ------GAGACTGC----------------AGCA-----TTCCATG---- E_europaeus300464 ------GAGATTGT----------------AAAACTCCTCTTTGGA---- E_europaeus300544 ------GAGTTTAT----------------AAAGTTCCTCTTTGTA---- E_europaeus300549 ------GAGATTGT----------------AAAACTCCTCTTTGGA---- E_europaeus300591 -----TGTGCT---------------TACAAAA-CTCCTCTTTGGA---- E_europaeus300701 -----AGAGAT---------------TGCAAAA-CTCTTCTTTGGA---- E_europaeus300721 ------CAGATTGT---------------AAAA-CCCTTTATTGGA---- F_catus300053 ------GAGACT------------------AAAACTCCTCTCTGGA---- H_sapiens300058 ------GAGACTGG----------------AAAGCTCCTCTTTGGA---- H_sapiens300480 ------GAGACTGT----------------GAAACTCATCTTAGAA---- L_africana300063 ------GAGACTGG----------------AGAACTCCTCTTTGGA---- L_africana300379 ------GAGATTCTG----------------CAACTCCTCTTTGGA---- L_africana300481 ------GAGATCAG----------------AGAACTCTT---TGGA---- M_mulatta300012 ------GAGACTGG----------------AAATCTCCCCTTTGGA---- M_mulatta300195 -----TGAGAT---------------TGTAAAA-CTCCTCTGTAGA---- M_mulatta300271 -----AGAGAC---------------TGGAA-AACTCCTCTTTGGA---- M_mulatta300286 CAGA-AGAGACTGT----------------GAAACTCCTCTTTGGA---- M_mulatta300298 ------GATATTGG----------------AACACTCCTCT--GGA---- M_mulatta300376 ------GAGACTGT----------------GAAACTCCTCTTAGAA---- M_mulatta300391 ------GAGATTGT----------------AAA-CTTCTCTTTGGA---- M_mulatta300408 ------GACTCTAT----------------GAA-CCCCTCTCTGGA---- M_mulatta300476 ------TATATTGC----------------AAAATTCCTCTTTGGA---- M_mulatta300480 ------GAGATTGT----------------AAAGCTCCTCTTTAGA---- M_mulatta300488 ------GAGAATGT----------------GAAGCTCCTCTTTGGAGGAG M_murinus300225 ------GAGATTTTT---------------AAAACTCTTCTTTGGA---- M_murinus300268 ------GAGATTTC----------------AAAACTCCTATTTGGA---- M_murinus300303 ------GAGATTTTTT-----------AAAAAAACTCCTCTTTGGA---- M_murinus300410 ------GAGGCTG-C---------------ACGTCTCCTCTCTGCA---- M_domestica300024 ------GAGATT-T----------------AAAACTCTTTTTTGGA---- M_musculus300704 ------TAAAACT-----------------ACACCTCCTCTTTGGA---- M_musculus300786 -----GGAAAA---------------CTACA--CCTTCTCTTAGGA---- M_musculus300787 ------GAGGCTCC----------------CCACTTCCTCTCTGGA---- M_musculus300823 ------GGCACTGC----------------AAACCTCCTCTT-GAA---- M_musculus300924 ------GAGGCTCC----------------ACACCTCCTCTCTGGA---- M_lucifugus300035 ------GAGATGGT----------------AAAACTCCTCTTTGGA---- M_lucifugus300537 -----AGAGAT---------------GGTAAAA-CTCCTCTTTGGA---- M_lucifugus300624 ------GAGATGGT----------------AAAACTCCTCTTTGGA---- M_lucifugus300690 -----AGAGAT----------------GGTAAAACTCCTCTTTGGA---- O_anatinus303218 ------GAGGCTA-----------------AAAACTCTCCTCTGGA---- O_cuniculus300002 -----AGAGAT------------GCTCGT-----TTCTTCTTTGGA---- O_cuniculus300003 ------GAGATGGT----------------CGT-TTCTTCTTTGGA---- O_cuniculus300028 ------GAGACTG--------------------------CCTGGAG---- O_cuniculus300143 ------GAGAGTGT----------------GAC-CTCTTCTTTGGA---- O_cuniculus300155 ------GAGACTG--------------------------CCTGGAG---- O_cuniculus300284 ------GATATTGG----------------A---CCCCGTCTGCAG---- O_cuniculus300286 ------GAGAGTGT----------------GAC-CTCTTCTTTGGA---- O_cuniculus300362 ------GAGGTTGT----------------CAG-CTCATCTTTGAA---- O_cuniculus300404 ------GAGATTGT----------------CAT-CTCCTCTTTGGA---- O_cuniculus300435 ------GAGATTGT----------------CAC-CTCTTCTTTGGT---- O_cuniculus300510 ------GAGATGGT----------------CGT-TTCTTCTTTGGA---- O_garnettii300026 ------GAGATTATA--------------AAT--CTTCTCTTTGGG---- O_garnettii300054 ------GAGATTTTT--------------AAAA-CTCCTCTTTGGA---- O_garnettii300084 ------GAGATTAT----------------AAAACTCTTCTTTGGA---- O_garnettii300102 ------GAGATTAT----------------AAAACTCTTCTTTGGA---- O_garnettii300162 ------GAGATTTTT---------------GAAACTCCTCTTTGGA---- O_garnettii300481 -----AGAGAT---------------TTTTAAAACTCCTCTTTGGA---- P_troglodytes300017 ------GAGACTGT----------------GAAACTCATCTTAGAA---- P_troglodytes300069 -----CGAGAT---------------TGTAAAA-CTCCTCTGTAGA---- P_troglodytes300091 ------AAGAATGT----------------AAAGCTCCTCTTTGGAGGAG P_troglodytes300149 ------GAGATTGT----------------AAAACTTCTCTTTGGA---- P_troglodytes300155 ------GAGACTGG----------------AAAGCTCCTCTTTGGA---- P_troglodytes300215 -----AGAGAC---------------TGGAA-AACTCCTCTTTGGA---- P_troglodytes300253 ------GATATTGC----------------AAAATTCCTCTTTGAA---- P_troglodytes300314 CAGA-AGAGACTGT----------------GAAACTCCTCTTTGGA---- P_troglodytes300385 ------GAGATTGT----------------AAAGCTCCTCTTTAGA---- P_troglodytes300386 ------GAGACTGG----------------AAAACTCCTCTCTGGA---- P_troglodytes300464 ------GACTGT------------------GAA-CCCCTCTCTGGA---- P_pygmaeus300072 ------GACTCTCT----------------GAA-CCCCTCTCTGGA---- P_pygmaeus300096 ------GAGAATGT----------------AAAGCTCCTCTTTGGAGGAG P_pygmaeus300135 ------GAGATTGC----------------AAAGCTCCTCTTTAGA---- P_pygmaeus300203 ------GAGACTGG----------------AAAACTCCTCTCTGGA---- P_pygmaeus300271 -----AGAGAT---------------TGTAAAA-CTTCTCTTTGGA---- P_pygmaeus300353 ------GATATTGC----------------AAAATTCCTCTTTGGA---- P_pygmaeus300356 -----CGAGAT---------------TGTAAAA-CTCCTCTGTATA---- P_pygmaeus300367 -----AGAGAC---------------TGGAA-ATCTCCTTTTTGGA---- P_pygmaeus300421 ------GAGACTGG----------------AAAGCTCCTCTTTGGA---- P_pygmaeus300423 ------GAGACTGT----------------GAAACTCATCTTAGAA---- R_norvegicus300010 ------GAAAACT-----------------GCAC-TCCTCTTTAGA---- R_norvegicus300083 ------AAAAACT-----------------GCACCTCCTCTTTGGA---- R_norvegicus300126 -----GAGGCT---------------TCACT--CCTCCTCTTTGAA---- R_norvegicus300144 ------GAAAACT-----------------ACACCTCCTCTTTGGA---- R_norvegicus300229 ------GAAAACT-----------------ACACCTCCTCTTTGGA---- R_norvegicus300252 ------GGAAAAT-----------------GCACCTCCTCTTTGGA---- R_norvegicus300361 ------GAAAACT-----------------ACACCTCCTCTTTGGA---- R_norvegicus300401 ------GAAAACT-----------------ATACGTCCTCTTTGAA---- R_norvegicus300463 -----GGAAAA---------------CTGCA--CCTCCTCTTTGGA---- R_norvegicus300475 ------GAAAAAT-----------------GCACCTCCTCTTTGGA---- R_norvegicus300570 -----GGAAAA---------------ATGCA--CCTCCTCTTTGGA---- R_norvegicus300658 ------GAAAACT-----------------GCACTTCCTCTTTGGA---- R_norvegicus300671 ------GAAAACT-----------------GCACCTCCTCTTTGGT---- R_norvegicus300809 ------GAGACTGT-------------------ATGCCTCTTTGGA---- R_norvegicus300843 ------GAAAACT-----------------GCACTTCCTCTTTGGA---- R_norvegicus300901 ------GAGGCTCC----------------ACTCCTCCTCTTTGGA---- R_norvegicus301001 ------GGGACTGC----------------AAACCTCCTCTT-GGC---- R_norvegicus301053 ------GAAAACT-----------------GCACCTTCTCTTTGGA---- R_norvegicus301063 ------GAAAACT-----------------GCACCTCCTCTTTGGA---- S_cerevisiae300022 ACTGTTGGTGCTGAGGTAATCCATCTTTAAAACCATCGCCGTTAGAGGTT S_araneus300035 ------GAGATTGTA--------------CAAA-CTCCTCCTTGGA---- S_araneus300052 ------GAGACTGG----------------GACAAAC--TTCTGGA---- S_araneus300077 -----AAAGATTTATAATCCAAAGGTTATAAAA-TTTCTCTTCGGA---- S_araneus300080 ------AGCATTGTA--------------AATC-CTCTCACTAGGG---- S_araneus300189 -----GGAGAC---------------TGAAAAAATTCCTCCTTAGA---- S_araneus300272 ------AAGATTAT----------------AAAACTTCTCTTTGAG---- S_araneus300283 ------GAAACTGTA--------------AAAA-TTCCTCCTTGGA---- S_araneus300302 ------GAGATTATA--------------AAAAGTTCCTCTTTGGG---- S_araneus300366 -----GGAAAT---------------TGTAAAAGCTCCTTCTTGGA---- S_araneus300377 ------GAGATTGTA--------------AAA--CTCCTCTTTGGA---- S_araneus300470 ------GAT--TGT----------------AAAATTCTTCTCTGGA---- S_araneus300608 ------CAGATTGTA--------------AAAA-CTTTTCCTTGCA---- S_araneus300689 ------AAGG----A--------------AAAA----CTCCTTGGA---- S_araneus300842 ------AAG--AGG----------------CACAGATCCTCTTGGT---- S_araneus300881 ------GAT--CAG----------------AAAACTCTT---TGGA---- S_araneus300938 ------GAGATTGTA--------------AAAC-TTCTCTCT-GGA---- S_araneus301004 ------GATG--------------------AACATTCCTCTCAGGA---- S_tridecemlineatus300039 ------GAGATTGC----------------AAAACTCTTCTTTGGA---- S_tridecemlineatus300164 -----AGAGAC---------------TTA-AAAACTCT---CTATA---- S_tridecemlineatus300203 ------GAGATTGT----------------AGAACTCCTCTTTGGA---- S_tridecemlineatus300218 ------GAGATTTT----------------AAGACTCCTCTTTAGA---- T_nigroviridis300074 ------GCCGCC------------------AGTCGTCATGGC-GGA---- T_belangeri300014 ------GAGATGAT----------------AAA-CTCCTCTTTGGA---- T_belangeri300159 ------GAGATGAT----------------AAA-CTCCTCTTTGGA---- T_belangeri300192 ------GAGATGAT----------------CAG-CTCTTCTTTGGA---- T_belangeri300220 ------GAGATGAT----------------CAA-CTCCTCTTTGGA---- T_belangeri300331 ------GAGACTGT----------------AAA-A-CTCCTCTGGA---- T_belangeri300378 ------GAGATAGT----------------AAAACTGCTCTTGGGA---- C_familiaris300038 ------TCCTGTCTG----GAGTC-ACAGCC------------------- C_familiaris300096 ------TCCTGTCTG----GAGTC-ACAGCC------------------- C_porcellus300388 ------TCCTGTCTG----GAGTC-ACAGCT------------------- C_porcellus300424 -----TC-TTGTGTG----AAGTC-ACAGCG------------------- C_porcellus300564 ------TCCTGTCTG----GAGTC-ACAGCT------------------- C_porcellus300616 ------TCCTGTCTG----GAGTC-ACAGGT------------------- D_rerio300277 ------TCCTGTCAC----AAGGC-ACATGT------------------- D_rerio300278 ------TCCTGTCGG----GAGAA-ACAACT------------------- D_novemcinctus300004 ------TTCTGTCTG----GAGTC-ACAGCT------------------- D_novemcinctus300069 ------TT-TGTCTG----AAGTC-ACAGCT------------------- D_novemcinctus300134 ------TCCTGTCTG----GAGTC-ACAGCT------------------- D_novemcinctus300226 ------TCCTATCTA----GAATT-GCAGCT------------------- D_novemcinctus300305 ------TCCCATCTG----GAGTT-ACGGCT------------------- D_novemcinctus300353 -----TC-CTGTCTG----GAGTC-ACAGCT------------------- D_novemcinctus300356 ------TCCTGTCTG----GAATC-ATAGCT------------------- D_novemcinctus300614 ------TCCTGTCTG----GAGTC-ACAGCT------------------- D_novemcinctus300615 ------TCCTGTCTG----GAGTC-ACAGCT------------------- D_melanogaster300121 -----TCTCTACCTGAACCTTGGC-ACAAAG------------------- D_melanogaster300122 -----TCTCTACCTGTAGCCTGGC-ACAGAT------------------- E_telfairi300086 ------TCCTGTCTG----GAGTC-ACAACT------------------- E_telfairi300115 ------TCCTGTCTG----GAGTC-ACAACT------------------- E_telfairi300178 ------TCCTGTCTG----GAGGC-ACAGCT------------------- E_telfairi300184 ------GCCCATCTG----GAGTC-ACAGCT------------------- E_telfairi300295 ------TCCTGTCTG----GAGTC-ATAACT------------------- E_telfairi300318 ------TCCTGCATG----GAACT-ATAGCG------------------- E_telfairi300340 ------TCCTGTCTG----GAGAC-AGAGCT------------------- E_telfairi300402 ------TCCTGCCTG----GAGTC-TTAACG------------------- E_telfairi300433 ------TCCTGTCTG----GAGTC-ACAACT------------------- E_telfairi300475 ------TCCTGTCTG----GAGTC-ACAAAT------------------- E_telfairi300487 ------TCCTGTCTG----GAGTC-ACAGCT------------------- E_telfairi300593 ------TCCTGTCTG----GAGTC-ACAACT------------------- E_telfairi300640 ------TCCTATCTG----GAGTC-ACAAGT------------------- E_telfairi300673 ------TCCTGTCTG----GAGTC-ACAACT------------------- E_telfairi300734 ------TCAAAC--------AACC-A-AACT------------------- E_telfairi300741 ------GCCTGTCTG----AAGTC-CCAGCT------------------- E_telfairi300764 ------TCCTGTCTG----GAGTC-ACAACT------------------- E_telfairi300765 ------TGCTGTCTA----GAGTT-ATAGCT------------------- E_caballus300070 ------TCCTATCTG----GAGTC-ATAGCT------------------- E_caballus300254 ------TCCTGTCTG----GAGTC-ACAGCT------------------- E_europaeus300034 ------TCCTGCCTG----GAAAT-------------------------- E_europaeus300117 ------TCCTGTCTG----GTGTC-ACAATT------------------- E_europaeus300122 ------TCCTGCCTG----GAAAT-------------------------- E_europaeus300204 -----TC-TTGTCTG----AAGTG-ACAGTT------------------- E_europaeus300219 ------TCCTATCTG----GACCC-AAGAAA------------------- E_europaeus300239 ------TCCTGTCTG----GAATT-ACAGTT------------------- E_europaeus300272 ------TTCTGTCTG----GAGTT-GCAGTA------------------- E_europaeus300346 -----TC-CTGTCTG----CAGTC-ACAGTA------------------- E_europaeus300352 ------ACTTGTCTG----GAGTC-ATAGCT------------------- E_europaeus300375 -----TC-TTGTCTG----AAGTG-ACAGTT------------------- E_europaeus300380 ------TCCTGTCTG----GAATC-TTAGTA------------------- E_europaeus300383 ------TCCTGTCTG----GAGTT-ACAGTT------------------- E_europaeus300388 ----------GTCTG----AAGTC-ATAATT------------------- E_europaeus300389 -----TC-TTGTCTG----GAGTC-ACAGTT------------------- E_europaeus300428 ------TCCTGTCTG----GAGTT-ACAGTT------------------- E_europaeus300433 ------TCCTGTCTG----GGATC-ATTGTT------------------- E_europaeus300454 -----T---TGTCTG----GAGTC-ACAGTT------------------- E_europaeus300464 ------TCCTGTCTG----GAGTC-ACAGTA------------------- E_europaeus300544 ------TCCTGTCTG----GAATC-ACAGTT------------------- E_europaeus300549 ------TCCTGTCTG----GAGTC-ACAGTA------------------- E_europaeus300591 ------GCCCATCTT----GATTC-ACAGTT------------------- E_europaeus300701 ------TTCTGTCTG----GAATA-AATGCT------------------- E_europaeus300721 ------TCCTGTCTG----CAGAT-ACAGTA------------------- F_catus300053 ------TCCTGTCTG----GAGTC-ACAGCG------------------- H_sapiens300058 ------TCCTGTCTG----GAGTC-ACAACT------------------- H_sapiens300480 -----CC-TTGTATG----GAGTC-ACAGCT------------------- L_africana300063 ------TCCTGTCTG----GAGTC-ACAGCT------------------- L_africana300379 ------TCCTGTCTG----GAGTC-ACAGTG------------------- L_africana300481 ------TCCTCTCTG----GAGTT-ACAACT------------------- M_mulatta300012 ------TCCTGTCTG----GAGTC-ACAGCT------------------- M_mulatta300195 ------TCCTATCTG----GAGTC-ACAGCT------------------- M_mulatta300271 ------TCCTGTCTA----TAGTC-GCAGGT------------------- M_mulatta300286 ------TGCCATCTG----GAGCC-ATAGCA------------------- M_mulatta300298 ------TCCTGCCTG----GAGTC-ACAGCT------------------- M_mulatta300376 -----CC-TTGTATG----GAGTC-ATAGCC------------------- M_mulatta300391 -----TC-CTGTCTG----AAGTC-ACAGCT------------------- M_mulatta300408 ------TCCTGTCTG----GAGTC-ACAGCT------------------- M_mulatta300476 ------TCATGTCTG----GAGTT-ACAGCT------------------- M_mulatta300480 ------TCCTTTCTG----GAGTC-ACACCT------------------- M_mulatta300488 CTGGACTCCTGTCTG----GAGTC-ACAGCT------------------- M_murinus300225 ------TCCTGTCTG----GAGTC-ACAGCT------------------- M_murinus300268 ------TCCTGTCTG----GAGTC-ACAGCG------------------- M_murinus300303 ------TCCTGTCTG----GAGTC-ACAGCT------------------- M_murinus300410 ------TCCTGTCTG----GAGTC-ACAGCT------------------- M_domestica300024 -----TC-CTGTCTG----GAGTT-ACAGTT------------------- M_musculus300704 ------TCCTGTCTG----GAGTC-ACAAGT------------------- M_musculus300786 ------TCCTGTCTG----GAGTC-ACAGAT------------------- M_musculus300787 ------TCCTGTCTG----GAGTC-ACAGCT------------------- M_musculus300823 ------GCCTTTTTG----AAGCC-ACAGCT------------------- M_musculus300924 ------TCCTGTCTG----GAGTC-ACAGCT------------------- M_lucifugus300035 ------CCCTGTCTG----GAGTC-ACAGTT------------------- M_lucifugus300537 ------TCCTGTCTG----GAGTC-ACAGCT------------------- M_lucifugus300624 ------TCCTGTCTG----GAGTC-ACAGCT------------------- M_lucifugus300690 ------TCCTGTCTG----GAGTC-ACAGCC------------------- O_anatinus303218 ------TCCTGTCGG----GAGGC-ACACTG------------------- O_cuniculus300002 ------TCCTGTCTG----GAGTC-ACAAAT------------------- O_cuniculus300003 -----TC-CTGTCTG----GAGTC-AACAGA------------------- O_cuniculus300028 -----TC-ACAGCT------------------------------------ O_cuniculus300143 -----TC-CTGTCTG----GAGTC-ACAGCT------------------- O_cuniculus300155 -----TC-ACAGCT------------------------------------ O_cuniculus300284 -----TC-ACAGCT------------------------------------ O_cuniculus300286 -----TC-CTGTCTG----GAGTC-ACAATT------------------- O_cuniculus300362 -----TC-CTGTCTG----GAGTC-ACAGCT------------------- O_cuniculus300404 -----TC-CTGTCTG----GAGAT-ACAGCT------------------- O_cuniculus300435 -----TC-CTGTCGA----GTCAC-AGCT--------------------- O_cuniculus300510 -----TC-CTGTCTG----GAGTC-A-CAAAT------------------ O_garnettii300026 ------TCCTATCTG----GAGAC-ACAAGT------------------- O_garnettii300054 ------TCCTGTCTG----GAGTC-ACAGCT------------------- O_garnettii300084 ------TCCTGTCTG----GAGTC-ACAGCT------------------- O_garnettii300102 ------TCCTGTCTG----GAGTC-ACAGCT------------------- O_garnettii300162 ------TCCTGTCTG----GAGTC-ACAGCT------------------- O_garnettii300481 ------TCCTGTCTG----GAGTC-ACAGCT------------------- P_troglodytes300017 -----CC-TTGTATG----GAGTC-ACAGCT------------------- P_troglodytes300069 ------TCCTGTCTG----GAGTC-ACAGCT------------------- P_troglodytes300091 CTAGACTCCTGTCCG----GAGTC-ACAGCT------------------- P_troglodytes300149 -----TC-CTGTCTG----GAGTC-ACAGCT------------------- P_troglodytes300155 ------TCCTGTCTG----GAGTC-ACAACT------------------- P_troglodytes300215 ------TCCTGTCTA----TAGTC-ACAGGT------------------- P_troglodytes300253 ------TCATGTCTG----GAAAC-ACAGCT------------------- P_troglodytes300314 ------CCCCATCTG----GAGCC-ACAGCA------------------- P_troglodytes300385 ------TCCTTTCTG----GAGTC-ACACCT------------------- P_troglodytes300386 ------TCCTGCCTG----GAGTC-ACAGCT------------------- P_troglodytes300464 ------TCCTGTCTG----GAGTC-ACAGCT------------------- P_pygmaeus300072 ------TCCTGTCTG----GAGTC-ACAGCT------------------- P_pygmaeus300096 CTGGACTCCTGTCTG----GAGTC-ACAGCT------------------- P_pygmaeus300135 ------TCCTTTCTG----GAGTC-ACACCT------------------- P_pygmaeus300203 ------TCCTGCCTG----GAGTC-ACAGCT------------------- P_pygmaeus300271 ------TCCTGTCTG----GAGTC-ACAGCT------------------- P_pygmaeus300353 ------TCATGTCTG----GAGTC-ACAGCT------------------- P_pygmaeus300356 ------TCCTGTCTG----GAGTC-ACAGCT------------------- P_pygmaeus300367 ------TCCTGTCTA----TAGTC-ACAGGT------------------- P_pygmaeus300421 ------TCCTGTCTG----GAGTC-ACAACT------------------- P_pygmaeus300423 -----CC-TTGTATG----GAGTC-ACAGCT------------------- R_norvegicus300010 ------TCCTGTCTG----GAGTC-ACAGAT------------------- R_norvegicus300083 ------TCCTGTCTG----GAGTC-ACAGAT------------------- R_norvegicus300126 ------TCCTCTGTCT---GAGTG-ACAGTT------------------- R_norvegicus300144 ------TCCTGTCTA----GAGTC-ACAGAA------------------- R_norvegicus300229 ------TCCTGTCTG----GAGTC-ACAGAT------------------- R_norvegicus300252 ------TCCTGTCTG----GAGTC-ACAGAT------------------- R_norvegicus300361 ------TCCTGTCTG----GAGTC-ATCAAT------------------- R_norvegicus300401 ------TCCTGTCTG----GAGCC-ACAGAT------------------- R_norvegicus300463 ------TCCTGTCTG----GAGTC-ACAAAT------------------- R_norvegicus300475 ------TCCTGTCTG----GAGTC-ACAGAT------------------- R_norvegicus300570 ------TCCTGTCTG----GAGTC-ACAGAT------------------- R_norvegicus300658 ------TCCTGTCTG----GAGTC-ACAGAT------------------- R_norvegicus300671 ------TCCTGTCTG----GAGTT-ACAGAT------------------- R_norvegicus300809 ------TCCTGTGTG-----GGAGAAAAAT-------------------- R_norvegicus300843 ------TCCTGTCTGACTGGAGTC-ACAGAT------------------- R_norvegicus300901 ------TCCTGTCTG----GAGTC-ACAGTT------------------- R_norvegicus301001 ------TCCTTCT-G----AAGCC-ACAGCT------------------- R_norvegicus301053 ------TCCTGTCTG----GAGTC-ACAGAT------------------- R_norvegicus301063 ------TCCTGTCTG----GAGTC-ACAGAT------------------- S_cerevisiae300022 GCTT-CTGATATTTTCGGTTAAGCGACCCATGAAATGGTGATGACCTGAG S_araneus300035 ------TCCTGTCTG----AAGCC-ACAGCT------------------- S_araneus300052 -----TCTCTGTCTG----GATTC-ATAGCC------------------- S_araneus300077 ------TCCTGTCTG----GGGTT-GCAGCA------------------- S_araneus300080 ------TTCTTTCAG----GAGTC-ATGGCC------------------- S_araneus300189 ------GCCTGTCTG----GAGTC-ACAGGC------------------- S_araneus300272 ------TGCTTTCTG----GAGCT-ACAGTG------------------- S_araneus300283 ------TTCTGTCTG----GAGTC-ACAGCC------------------- S_araneus300302 ------TACTGGATG----CAGTC-AAGAGG------------------- S_araneus300366 ------TCCTGTCTG----GAGTT-ACAGCC------------------- S_araneus300377 ------TTCCGCCTG----GAGAC-AAACTG------------------- S_araneus300470 ------TCCTGTCTG----GAGTC-AAAGTG------------------- S_araneus300608 ------TCCTGTTTG----GAGTC-ACAGCC------------------- S_araneus300689 ------TCCCGTCTG----GATGC-AAGA--------------------- S_araneus300842 ------TCTTGTCTA----GAATT-AGAATA------------------- S_araneus300881 ------TCCTGTCCA----GAGGC-ACAGAA------------------- S_araneus300938 ------TCCTGTCTG----GAGCC-ACATCT------------------- S_araneus301004 ------TTATGTCTG----GAGTC-ACAGTG------------------- S_tridecemlineatus300039 ------TCCTGCCTG----GAGTT-ACCAAT------------------- S_tridecemlineatus300164 ------TCCTGTCTG----GAGTT-ACAGTT------------------- S_tridecemlineatus300203 ------TCCTGGCCG----GTGTC-ACAGCT------------------- S_tridecemlineatus300218 ------TCCTCTCTG----GTGTT-ATTATA------------------- T_nigroviridis300074 ------TCCTGTCGG----GAGAA-ACAAAC------------------- T_belangeri300014 ------TCCTGTCTG----GAGTCCACACCT------------------- T_belangeri300159 ------TCCTGTCTG----GAGTC-ACAACT------------------- T_belangeri300192 ------TCCTGTCTG----GAGTC-ACAACT------------------- T_belangeri300220 ------TCCTGTCTG----GAGTC-ACAGCT------------------- T_belangeri300331 ------ACCTGTCTG----GAGTC-ACAACT------------------- T_belangeri300378 ------TCCTGTCTG----GAGTC-AGAGCT------------------- C_familiaris300038 ------------- C_familiaris300096 ------------- C_porcellus300388 ------------- C_porcellus300424 ------------- C_porcellus300564 ------------- C_porcellus300616 ------------- D_rerio300277 ------------- D_rerio300278 ------------- D_novemcinctus300004 ------------- D_novemcinctus300069 ------------- D_novemcinctus300134 ------------- D_novemcinctus300226 ------------- D_novemcinctus300305 ------------- D_novemcinctus300353 ------------- D_novemcinctus300356 ------------- D_novemcinctus300614 ------------- D_novemcinctus300615 ------------- D_melanogaster300121 ------------- D_melanogaster300122 ------------- E_telfairi300086 ------------- E_telfairi300115 ------------- E_telfairi300178 ------------- E_telfairi300184 ------------- E_telfairi300295 ------------- E_telfairi300318 ------------- E_telfairi300340 ------------- E_telfairi300402 ------------- E_telfairi300433 ------------- E_telfairi300475 ------------- E_telfairi300487 ------------- E_telfairi300593 ------------- E_telfairi300640 ------------- E_telfairi300673 ------------- E_telfairi300734 ------------- E_telfairi300741 ------------- E_telfairi300764 ------------- E_telfairi300765 ------------- E_caballus300070 ------------- E_caballus300254 ------------- E_europaeus300034 ------------- E_europaeus300117 ------------- E_europaeus300122 ------------- E_europaeus300204 ------------- E_europaeus300219 ------------- E_europaeus300239 ------------- E_europaeus300272 ------------- E_europaeus300346 ------------- E_europaeus300352 ------------- E_europaeus300375 ------------- E_europaeus300380 ------------- E_europaeus300383 ------------- E_europaeus300388 ------------- E_europaeus300389 ------------- E_europaeus300428 ------------- E_europaeus300433 ------------- E_europaeus300454 ------------- E_europaeus300464 ------------- E_europaeus300544 ------------- E_europaeus300549 ------------- E_europaeus300591 ------------- E_europaeus300701 ------------- E_europaeus300721 ------------- F_catus300053 ------------- H_sapiens300058 ------------- H_sapiens300480 ------------- L_africana300063 ------------- L_africana300379 ------------- L_africana300481 ------------- M_mulatta300012 ------------- M_mulatta300195 ------------- M_mulatta300271 ------------- M_mulatta300286 ------------- M_mulatta300298 ------------- M_mulatta300376 ------------- M_mulatta300391 ------------- M_mulatta300408 ------------- M_mulatta300476 ------------- M_mulatta300480 ------------- M_mulatta300488 ------------- M_murinus300225 ------------- M_murinus300268 ------------- M_murinus300303 ------------- M_murinus300410 ------------- M_domestica300024 ------------- M_musculus300704 ------------- M_musculus300786 ------------- M_musculus300787 ------------- M_musculus300823 ------------- M_musculus300924 ------------- M_lucifugus300035 ------------- M_lucifugus300537 ------------- M_lucifugus300624 ------------- M_lucifugus300690 ------------- O_anatinus303218 ------------- O_cuniculus300002 ------------- O_cuniculus300003 ------------- O_cuniculus300028 ------------- O_cuniculus300143 ------------- O_cuniculus300155 ------------- O_cuniculus300284 ------------- O_cuniculus300286 ------------- O_cuniculus300362 ------------- O_cuniculus300404 ------------- O_cuniculus300435 ------------- O_cuniculus300510 ------------- O_garnettii300026 ------------- O_garnettii300054 ------------- O_garnettii300084 ------------- O_garnettii300102 ------------- O_garnettii300162 ------------- O_garnettii300481 ------------- P_troglodytes300017 ------------- P_troglodytes300069 ------------- P_troglodytes300091 ------------- P_troglodytes300149 ------------- P_troglodytes300155 ------------- P_troglodytes300215 ------------- P_troglodytes300253 ------------- P_troglodytes300314 ------------- P_troglodytes300385 ------------- P_troglodytes300386 ------------- P_troglodytes300464 ------------- P_pygmaeus300072 ------------- P_pygmaeus300096 ------------- P_pygmaeus300135 ------------- P_pygmaeus300203 ------------- P_pygmaeus300271 ------------- P_pygmaeus300353 ------------- P_pygmaeus300356 ------------- P_pygmaeus300367 ------------- P_pygmaeus300421 ------------- P_pygmaeus300423 ------------- R_norvegicus300010 ------------- R_norvegicus300083 ------------- R_norvegicus300126 ------------- R_norvegicus300144 ------------- R_norvegicus300229 ------------- R_norvegicus300252 ------------- R_norvegicus300361 ------------- R_norvegicus300401 ------------- R_norvegicus300463 ------------- R_norvegicus300475 ------------- R_norvegicus300570 ------------- R_norvegicus300658 ------------- R_norvegicus300671 ------------- R_norvegicus300809 ------------- R_norvegicus300843 ------------- R_norvegicus300901 ------------- R_norvegicus301001 ------------- R_norvegicus301053 ------------- R_norvegicus301063 ------------- S_cerevisiae300022 GTATGGAACATCT S_araneus300035 ------------- S_araneus300052 ------------- S_araneus300077 ------------- S_araneus300080 ------------- S_araneus300189 ------------- S_araneus300272 ------------- S_araneus300283 ------------- S_araneus300302 ------------- S_araneus300366 ------------- S_araneus300377 ------------- S_araneus300470 ------------- S_araneus300608 ------------- S_araneus300689 ------------- S_araneus300842 ------------- S_araneus300881 ------------- S_araneus300938 ------------- S_araneus301004 ------------- S_tridecemlineatus300039 ------------- S_tridecemlineatus300164 ------------- S_tridecemlineatus300203 ------------- S_tridecemlineatus300218 ------------- T_nigroviridis300074 ------------- T_belangeri300014 ------------- T_belangeri300159 ------------- T_belangeri300192 ------------- T_belangeri300220 ------------- T_belangeri300331 ------------- T_belangeri300378 -------------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved