snOPY snoRNA Orthological Gene Database

Family: SNORA26

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300038 -------------------------------------------------- C_familiaris300096 -------------------------------------------------- C_porcellus300388 -------------------------------------------------- C_porcellus300424 -------------------------------------------------- C_porcellus300564 -------------------------------------------------- C_porcellus300616 -------------------------------------------------- D_rerio300277 -------------------------------------------------- D_rerio300278 -------------------------------------------------- D_novemcinctus300004 -------------------------------------------------- D_novemcinctus300069 -------------------------------------------------- D_novemcinctus300134 -------------------------------------------------- D_novemcinctus300226 -------------------------------------------------- D_novemcinctus300305 -------------------------------------------------- D_novemcinctus300353 -------------------------------------------------- D_novemcinctus300356 -------------------------------------------------- D_novemcinctus300614 -------------------------------------------------- D_novemcinctus300615 -------------------------------------------------- D_melanogaster300121 -------------------------------------------------- D_melanogaster300122 -------------------------------------------------- E_telfairi300086 -------------------------------------------------- E_telfairi300115 -------------------------------------------------- E_telfairi300178 -------------------------------------------------- E_telfairi300184 -------------------------------------------------- E_telfairi300295 -------------------------------------------------- E_telfairi300318 -------------------------------------------------- E_telfairi300340 -------------------------------------------------- E_telfairi300402 -------------------------------------------------- E_telfairi300433 -------------------------------------------------- E_telfairi300475 -------------------------------------------------- E_telfairi300487 -------------------------------------------------- E_telfairi300593 -------------------------------------------------- E_telfairi300640 -------------------------------------------------- E_telfairi300673 -------------------------------------------------- E_telfairi300734 -------------------------------------------------- E_telfairi300741 -------------------------------------------------- E_telfairi300764 -------------------------------------------------- E_telfairi300765 -------------------------------------------------- E_caballus300070 -------------------------------------------------- E_caballus300254 -------------------------------------------------- E_europaeus300034 -------------------------------------------------- E_europaeus300117 -------------------------------------------------- E_europaeus300122 -------------------------------------------------- E_europaeus300204 -------------------------------------------------- E_europaeus300219 -------------------------------------------------- E_europaeus300239 -------------------------------------------------- E_europaeus300272 -------------------------------------------------- E_europaeus300346 -------------------------------------------------- E_europaeus300352 -------------------------------------------------- E_europaeus300375 -------------------------------------------------- E_europaeus300380 -------------------------------------------------- E_europaeus300383 -------------------------------------------------- E_europaeus300388 -------------------------------------------------- E_europaeus300389 -------------------------------------------------- E_europaeus300428 -------------------------------------------------- E_europaeus300433 -------------------------------------------------- E_europaeus300454 -------------------------------------------------- E_europaeus300464 -------------------------------------------------- E_europaeus300544 -------------------------------------------------- E_europaeus300549 -------------------------------------------------- E_europaeus300591 -------------------------------------------------- E_europaeus300701 -------------------------------------------------- E_europaeus300721 -------------------------------------------------- F_catus300053 -------------------------------------------------- H_sapiens300058 -------------------------------------------------- H_sapiens300480 -------------------------------------------------- L_africana300063 -------------------------------------------------- L_africana300379 -------------------------------------------------- L_africana300481 -------------------------------------------------- M_mulatta300012 -------------------------------------------------- M_mulatta300195 -------------------------------------------------- M_mulatta300271 -------------------------------------------------- M_mulatta300286 -------------------------------------------------- M_mulatta300298 -------------------------------------------------- M_mulatta300376 -------------------------------------------------- M_mulatta300391 -------------------------------------------------- M_mulatta300408 -------------------------------------------------- M_mulatta300476 -------------------------------------------------- M_mulatta300480 -------------------------------------------------- M_mulatta300488 -------------------------------------------------- M_murinus300225 -------------------------------------------------- M_murinus300268 -------------------------------------------------- M_murinus300303 -------------------------------------------------- M_murinus300410 -------------------------------------------------- M_domestica300024 -------------------------------------------------- M_musculus300704 -------------------------------------------------- M_musculus300786 -------------------------------------------------- M_musculus300787 -------------------------------------------------- M_musculus300823 -------------------------------------------------- M_musculus300924 -------------------------------------------------- O_anatinus303218 -------------------------------------------------- O_cuniculus300002 -------------------------------------------------- O_cuniculus300003 -------------------------------------------------- O_cuniculus300028 -------------------------------------------------- O_cuniculus300143 -------------------------------------------------- O_cuniculus300155 -------------------------------------------------- O_cuniculus300284 -------------------------------------------------- O_cuniculus300286 -------------------------------------------------- O_cuniculus300362 -------------------------------------------------- O_cuniculus300404 -------------------------------------------------- O_cuniculus300435 -------------------------------------------------- O_cuniculus300510 -------------------------------------------------- O_garnettii300026 -------------------------------------------------- O_garnettii300054 -------------------------------------------------- O_garnettii300084 -------------------------------------------------- O_garnettii300102 -------------------------------------------------- O_garnettii300162 -------------------------------------------------- O_garnettii300481 -------------------------------------------------- P_troglodytes300017 -------------------------------------------------- P_troglodytes300069 -------------------------------------------------- P_troglodytes300091 -------------------------------------------------- P_troglodytes300149 -------------------------------------------------- P_troglodytes300155 -------------------------------------------------- P_troglodytes300215 -------------------------------------------------- P_troglodytes300253 -------------------------------------------------- P_troglodytes300314 -------------------------------------------------- P_troglodytes300385 -------------------------------------------------- P_troglodytes300386 -------------------------------------------------- P_troglodytes300464 -------------------------------------------------- P_pygmaeus300072 -------------------------------------------------- P_pygmaeus300096 -------------------------------------------------- P_pygmaeus300135 -------------------------------------------------- P_pygmaeus300203 -------------------------------------------------- P_pygmaeus300271 -------------------------------------------------- P_pygmaeus300353 -------------------------------------------------- P_pygmaeus300356 -------------------------------------------------- P_pygmaeus300367 -------------------------------------------------- P_pygmaeus300421 -------------------------------------------------- P_pygmaeus300423 -------------------------------------------------- R_norvegicus300010 -------------------------------------------------- R_norvegicus300083 -------------------------------------------------- R_norvegicus300126 -------------------------------------------------- R_norvegicus300144 -------------------------------------------------- R_norvegicus300229 -------------------------------------------------- R_norvegicus300252 -------------------------------------------------- R_norvegicus300361 -------------------------------------------------- R_norvegicus300401 -------------------------------------------------- R_norvegicus300463 -------------------------------------------------- R_norvegicus300475 -------------------------------------------------- R_norvegicus300570 -------------------------------------------------- R_norvegicus300658 -------------------------------------------------- R_norvegicus300671 -------------------------------------------------- R_norvegicus300809 -------------------------------------------------- R_norvegicus300843 -------------------------------------------------- R_norvegicus300901 -------------------------------------------------- R_norvegicus301001 -------------------------------------------------- R_norvegicus301053 -------------------------------------------------- R_norvegicus301063 -------------------------------------------------- S_cerevisiae300022 ATAACAATTTGTGATGCTTTAGGGAGCCTATTGTTTGATGGTTTATAGGA S_araneus300035 -------------------------------------------------- S_araneus300052 -------------------------------------------------- S_araneus300077 -------------------------------------------------- S_araneus300080 -------------------------------------------------- S_araneus300189 -------------------------------------------------- S_araneus300272 -------------------------------------------------- S_araneus300283 -------------------------------------------------- S_araneus300302 -------------------------------------------------- S_araneus300366 -------------------------------------------------- S_araneus300377 -------------------------------------------------- S_araneus300470 -------------------------------------------------- S_araneus300608 -------------------------------------------------- S_araneus300689 -------------------------------------------------- S_araneus300842 -------------------------------------------------- S_araneus300881 -------------------------------------------------- S_araneus300938 -------------------------------------------------- S_araneus301004 -------------------------------------------------- S_tridecemlineatus300039 -------------------------------------------------- S_tridecemlineatus300164 -------------------------------------------------- S_tridecemlineatus300203 -------------------------------------------------- S_tridecemlineatus300218 -------------------------------------------------- T_nigroviridis300074 -------------------------------------------------- T_belangeri300014 -------------------------------------------------- T_belangeri300159 -------------------------------------------------- T_belangeri300192 -------------------------------------------------- T_belangeri300220 -------------------------------------------------- T_belangeri300331 -------------------------------------------------- T_belangeri300378 -------------------------------------------------- C_familiaris300038 -------------------------------------------------- C_familiaris300096 -------------------------------------------------- C_porcellus300388 -------------------------------------------------- C_porcellus300424 -------------------------------------------------- C_porcellus300564 -------------------------------------------------- C_porcellus300616 -------------------------------------------------- D_rerio300277 -------------------------------------------------- D_rerio300278 -------------------------------------------------- D_novemcinctus300004 -------------------------------------------------- D_novemcinctus300069 -------------------------------------------------- D_novemcinctus300134 -------------------------------------------------- D_novemcinctus300226 -------------------------------------------------- D_novemcinctus300305 -------------------------------------------------- D_novemcinctus300353 -------------------------------------------------- D_novemcinctus300356 -------------------------------------------------- D_novemcinctus300614 -------------------------------------------------- D_novemcinctus300615 -------------------------------------------------- D_melanogaster300121 -------------------------------------------------- D_melanogaster300122 -------------------------------------------------- E_telfairi300086 -------------------------------------------------- E_telfairi300115 -------------------------------------------------- E_telfairi300178 -------------------------------------------------- E_telfairi300184 -------------------------------------------------- E_telfairi300295 -------------------------------------------------- E_telfairi300318 -------------------------------------------------- E_telfairi300340 -------------------------------------------------- E_telfairi300402 -------------------------------------------------- E_telfairi300433 -------------------------------------------------- E_telfairi300475 -------------------------------------------------- E_telfairi300487 -------------------------------------------------- E_telfairi300593 -------------------------------------------------- E_telfairi300640 -------------------------------------------------- E_telfairi300673 -------------------------------------------------- E_telfairi300734 -------------------------------------------------- E_telfairi300741 -------------------------------------------------- E_telfairi300764 -------------------------------------------------- E_telfairi300765 -------------------------------------------------- E_caballus300070 -------------------------------------------------- E_caballus300254 -------------------------------------------------- E_europaeus300034 -------------------------------------------------- E_europaeus300117 -------------------------------------------------- E_europaeus300122 -------------------------------------------------- E_europaeus300204 -------------------------------------------------- E_europaeus300219 -------------------------------------------------- E_europaeus300239 -------------------------------------------------- E_europaeus300272 -------------------------------------------------- E_europaeus300346 -------------------------------------------------- E_europaeus300352 -------------------------------------------------- E_europaeus300375 -------------------------------------------------- E_europaeus300380 -------------------------------------------------- E_europaeus300383 -------------------------------------------------- E_europaeus300388 -------------------------------------------------- E_europaeus300389 -------------------------------------------------- E_europaeus300428 -------------------------------------------------- E_europaeus300433 -------------------------------------------------- E_europaeus300454 -------------------------------------------------- E_europaeus300464 -------------------------------------------------- E_europaeus300544 -------------------------------------------------- E_europaeus300549 -------------------------------------------------- E_europaeus300591 -------------------------------------------------- E_europaeus300701 -------------------------------------------------- E_europaeus300721 -------------------------------------------------- F_catus300053 -------------------------------------------------- H_sapiens300058 -------------------------------------------------- H_sapiens300480 -------------------------------------------------- L_africana300063 -------------------------------------------------- L_africana300379 -------------------------------------------------- L_africana300481 -------------------------------------------------- M_mulatta300012 -------------------------------------------------- M_mulatta300195 -------------------------------------------------- M_mulatta300271 -------------------------------------------------- M_mulatta300286 -------------------------------------------------- M_mulatta300298 -------------------------------------------------- M_mulatta300376 -------------------------------------------------- M_mulatta300391 -------------------------------------------------- M_mulatta300408 -------------------------------------------------- M_mulatta300476 -------------------------------------------------- M_mulatta300480 -------------------------------------------------- M_mulatta300488 -------------------------------------------------- M_murinus300225 -------------------------------------------------- M_murinus300268 -------------------------------------------------- M_murinus300303 -------------------------------------------------- M_murinus300410 -------------------------------------------------- M_domestica300024 -------------------------------------------------- M_musculus300704 -------------------------------------------------- M_musculus300786 -------------------------------------------------- M_musculus300787 -------------------------------------------------- M_musculus300823 -------------------------------------------------- M_musculus300924 -------------------------------------------------- O_anatinus303218 -------------------------------------------------- O_cuniculus300002 -------------------------------------------------- O_cuniculus300003 -------------------------------------------------- O_cuniculus300028 -------------------------------------------------- O_cuniculus300143 -------------------------------------------------- O_cuniculus300155 -------------------------------------------------- O_cuniculus300284 -------------------------------------------------- O_cuniculus300286 -------------------------------------------------- O_cuniculus300362 -------------------------------------------------- O_cuniculus300404 -------------------------------------------------- O_cuniculus300435 -------------------------------------------------- O_cuniculus300510 -------------------------------------------------- O_garnettii300026 -------------------------------------------------- O_garnettii300054 -------------------------------------------------- O_garnettii300084 -------------------------------------------------- O_garnettii300102 -------------------------------------------------- O_garnettii300162 -------------------------------------------------- O_garnettii300481 -------------------------------------------------- P_troglodytes300017 -------------------------------------------------- P_troglodytes300069 -------------------------------------------------- P_troglodytes300091 -------------------------------------------------- P_troglodytes300149 -------------------------------------------------- P_troglodytes300155 -------------------------------------------------- P_troglodytes300215 -------------------------------------------------- P_troglodytes300253 -------------------------------------------------- P_troglodytes300314 -------------------------------------------------- P_troglodytes300385 -------------------------------------------------- P_troglodytes300386 -------------------------------------------------- P_troglodytes300464 -------------------------------------------------- P_pygmaeus300072 -------------------------------------------------- P_pygmaeus300096 -------------------------------------------------- P_pygmaeus300135 -------------------------------------------------- P_pygmaeus300203 -------------------------------------------------- P_pygmaeus300271 -------------------------------------------------- P_pygmaeus300353 -------------------------------------------------- P_pygmaeus300356 -------------------------------------------------- P_pygmaeus300367 -------------------------------------------------- P_pygmaeus300421 -------------------------------------------------- P_pygmaeus300423 -------------------------------------------------- R_norvegicus300010 -------------------------------------------------- R_norvegicus300083 -------------------------------------------------- R_norvegicus300126 -------------------------------------------------- R_norvegicus300144 -------------------------------------------------- R_norvegicus300229 -------------------------------------------------- R_norvegicus300252 -------------------------------------------------- R_norvegicus300361 -------------------------------------------------- R_norvegicus300401 -------------------------------------------------- R_norvegicus300463 -------------------------------------------------- R_norvegicus300475 -------------------------------------------------- R_norvegicus300570 -------------------------------------------------- R_norvegicus300658 -------------------------------------------------- R_norvegicus300671 -------------------------------------------------- R_norvegicus300809 -------------------------------------------------- R_norvegicus300843 -------------------------------------------------- R_norvegicus300901 -------------------------------------------------- R_norvegicus301001 -------------------------------------------------- R_norvegicus301053 -------------------------------------------------- R_norvegicus301063 -------------------------------------------------- S_cerevisiae300022 GCCGGATTTGTCTTTTTGACTAATTTTCAACCTATTCTTACTTCCAAAAC S_araneus300035 -------------------------------------------------- S_araneus300052 -------------------------------------------------- S_araneus300077 -------------------------------------------------- S_araneus300080 -------------------------------------------------- S_araneus300189 -------------------------------------------------- S_araneus300272 -------------------------------------------------- S_araneus300283 -------------------------------------------------- S_araneus300302 -------------------------------------------------- S_araneus300366 -------------------------------------------------- S_araneus300377 -------------------------------------------------- S_araneus300470 -------------------------------------------------- S_araneus300608 -------------------------------------------------- S_araneus300689 -------------------------------------------------- S_araneus300842 -------------------------------------------------- S_araneus300881 -------------------------------------------------- S_araneus300938 -------------------------------------------------- S_araneus301004 -------------------------------------------------- S_tridecemlineatus300039 -------------------------------------------------- S_tridecemlineatus300164 -------------------------------------------------- S_tridecemlineatus300203 -------------------------------------------------- S_tridecemlineatus300218 -------------------------------------------------- T_nigroviridis300074 -------------------------------------------------- T_belangeri300014 -------------------------------------------------- T_belangeri300159 -------------------------------------------------- T_belangeri300192 -------------------------------------------------- T_belangeri300220 -------------------------------------------------- T_belangeri300331 -------------------------------------------------- T_belangeri300378 -------------------------------------------------- C_familiaris300038 --------------------------------GTGCGCTCCCAAGG-CTG C_familiaris300096 --------------------------------GTGCGCTCCCAAGG-CTG C_porcellus300388 --------------------------------GTGCCCTTTTAAGG-TTG C_porcellus300424 --------------------------------GTGCCCCTTTAACA-CTG C_porcellus300564 --------------------------------GTGCCCTTTTAAGG-TTG C_porcellus300616 --------------------------------TTGCCCTTTTAAGG-TTG D_rerio300277 --------------------------------TTGCCCACTGGAGGCTGT D_rerio300278 ---------------------------------TTGCACATTCAAGTCC- D_novemcinctus300004 --------------------------------CTGCGCTTTTAAGG-TTG D_novemcinctus300069 --------------------------------GTGCCCTTTTAAGG-TTG D_novemcinctus300134 ----------------------------------TAGCACTTGAAACTAG D_novemcinctus300226 --------------------------------GTGCCCTTTTAAGA-TTA D_novemcinctus300305 -------------------------------------------------- D_novemcinctus300353 --------------------------------GTGCCCTTTTAAGA-TTG D_novemcinctus300356 --------------------------------GTGCCCTTTTAAGG-TTG D_novemcinctus300614 --------------------------------GTGCCCTTTTAAGG-TTG D_novemcinctus300615 --------------------------------GTGGCCTTTTAAGA-TTG D_melanogaster300121 ----------------------------------------------ATGG D_melanogaster300122 ------------------------------------------------CG E_telfairi300086 --------------------------------GTGCCCTTGTAAGG-TTG E_telfairi300115 --------------------------------GTGCCCTTTTAAGG-TTG E_telfairi300178 --------------------------------GTGCCCTGGCA-GG-TTG E_telfairi300184 --------------------------------GTGCCCCTTTAAGG-TTG E_telfairi300295 --------------------------------GTGCCCTTTTAAGG-TTG E_telfairi300318 -------------------------------TTAGTGCTAAAACTTCAGA E_telfairi300340 -----------------------------------------GTACGAAAA E_telfairi300402 --------------------------------GTGCCCTTTGAAGT-TTG E_telfairi300433 --------------------------------GTGCCCTTTTAAGG-TTG E_telfairi300475 --------------------------------GTGTCCTTCTAAGG-TTG E_telfairi300487 --------------------------------GTGCCCTTTTAAGG-TTG E_telfairi300593 -------------------------------------------------- E_telfairi300640 --------------------------------GTGCCCTTTTAAGG-TTG E_telfairi300673 --------------------------------GTGCCCTTTTAAGG-TTG E_telfairi300734 --------------------------------GTGCCCTATTAAGG-TTG E_telfairi300741 --------------------------------GTGCCCTTTTAAGG-TTG E_telfairi300764 --------------------------------GTGCCCTTTTAAGG-TTG E_telfairi300765 --------------------------------TAGGCCTTTTTAGG-CTG E_caballus300070 --------------------------------GTGCCCTTTTAAGG-TTG E_caballus300254 --------------------------------GTGCCCTTTTAAGG-TTG E_europaeus300034 --------------------------------GTGCCTTT--AAGG-TTG E_europaeus300117 -------------------------------ATGCCTTATTAAAGACTGT E_europaeus300122 --------------------------------GTGCCCTTTAAAGG-TTG E_europaeus300204 --------------------------------GTACACTTTTAAGG-CTG E_europaeus300219 ---------------------------------TTGCCCTTTTAAAGTTA E_europaeus300239 -------------------------------------------GAGGCT- E_europaeus300272 -----------------------------TTACCATTGTTGATTCACTGA E_europaeus300346 --------------------------------GTGCTCTTTTAAGA-TTG E_europaeus300352 ------------------------------------CTGCCCGACTCCCT E_europaeus300375 --------------------------------GTACACTTTTAAGG-CTG E_europaeus300380 ------------------------------ATACCCTTTCTATTGG-TTG E_europaeus300383 -----------------------------TTATCCTTACCTAAAGACT-- E_europaeus300388 --------------------------------GTACTCTTTTAAGG-CTG E_europaeus300389 --------------------------------GTGCTCTTTTAATG---- E_europaeus300428 --------------------------------ATGCCCTTTTAAGG-CTT E_europaeus300433 --------------------------------GTGACCTTTGAAGG-TTA E_europaeus300454 ----------------------------------GTGCCCCTAAAT-TTA E_europaeus300464 --------------------------------GTGCCCTTCTTAGGGTTG E_europaeus300544 --------------------------------GTGCCCTTTTGAGG-TTG E_europaeus300549 --------------------------------GTGCCCTTCTTAGGGTTG E_europaeus300591 ----------------------------------GCAAATTTTTAT-TTG E_europaeus300701 ------------------------------TTTTGTTTTGAAATATGAAA E_europaeus300721 ---------------------------------------TTTAAGG-TTG F_catus300053 --------------------------------GTGCCCTTTTAAGG-TTG H_sapiens300058 --------------------------------GTGCCCTTTTAAGG-TTG H_sapiens300480 --------------------------------GTTCCCTTTTAAGG-CTG L_africana300063 --------------------------------GTGCCCTTTTAAGG-TTG L_africana300379 --------------------------------GTGC-CTTGTAAGG-CTG L_africana300481 --------------------------------GTGCCATTTCAAGG-TTG M_mulatta300012 --------------------------------GTGCCCTTTTAAGG-TTG M_mulatta300195 -------------------------------TGAACTTTAAAATGCAAGT M_mulatta300271 ------------------------------------------AAAAGACA M_mulatta300286 --------------------------------GTGCCCTTTTAAGG-TAG M_mulatta300298 --------------------------------ATGCCCTTTTAAGG-TTG M_mulatta300376 --------------------------------GTTCCTTTTTAAGG-CTG M_mulatta300391 --------------------------------GGGCCCCGTTAAGG-CTG M_mulatta300408 ------------------------------------GTGCCTAAGG-TTA M_mulatta300476 --------------------------------GTGCCCTTTTAAGG-TTG M_mulatta300480 --------------------------------GTGCCCTTTCAAGG-TCG M_mulatta300488 -------------------------------GTGCCGCTTTTAAGG-TTA M_murinus300225 --------------------------------GTGTCCTTTTAAAG-TTG M_murinus300268 --------------------------------GTGTCATTTTAAAA-TTG M_murinus300303 --------------------------------GTGCCCTTTTAAAG-TTG M_murinus300410 --------------------------------GCGCCCTTTTAAGG-TCG M_domestica300024 ---------------------------------TAGCCTGTTAAAG-CTG M_musculus300704 --------------------------------GTGCCTTTTTAAGG-TTG M_musculus300786 -----------------------------------------AAGACACAC M_musculus300787 --------------------------------GTGCCCTTTTAAGG-TTG M_musculus300823 --------------------------------GTGCCCTTTCTAGG-CTA M_musculus300924 --------------------------------GTGCCCTTTTAAGG-TTG O_anatinus303218 --------------------------------GTGCTCCCTTAGAG---- O_cuniculus300002 -----------------------------------GCCCTATAACAAATA O_cuniculus300003 --------------------------------GTGTCCTTTTAGAG-CTG O_cuniculus300028 --------------------------------TTTCCCTTTTAGAG-CTG O_cuniculus300143 --------------------------------GTGCCCTTTTACAG-CTA O_cuniculus300155 --------------------------------TTTCCCTTTTAGAG-CTG O_cuniculus300284 -----------------------------GTGCCCTTTTGTTAGAG-CTG O_cuniculus300286 --------------------------------GTGCCCTTTTACAG-CTA O_cuniculus300362 --------------------------------GTGCCCTTTTAGAG-CTG O_cuniculus300404 --------------------------------GTGCCCTTTTAAAA-CTG O_cuniculus300435 --------------------------------GTGACCTTTTAGAA-CTG O_cuniculus300510 --------------------------------GTGCCCTTTCAGAG-CTG O_garnettii300026 --------------------------------GTGCCCTTTTAGGG-CTG O_garnettii300054 --------------------------------TTATTCTTTTAAGG-TTG O_garnettii300084 --------------------------------GTGCCCTTTTAAGG-CTG O_garnettii300102 --------------------------------GTGCCCTTTTAAGG-CTG O_garnettii300162 --------------------------------GTGGCCTTTTAAGG-TTG O_garnettii300481 -----------------------------TCACCCTTTCCTGTCCCTTAC P_troglodytes300017 --------------------------------GTTCCCTTTTAAGG-CTG P_troglodytes300069 -------------------------------TGAACTTTAAAATGCAAGT P_troglodytes300091 --------------------------------TGCCCCTTTTAAGG-TTG P_troglodytes300149 --------------------------------GCACCCCTTTAAGG-CTG P_troglodytes300155 --------------------------------GTGCCCTTTTAAGG-TTG P_troglodytes300215 ----------------------------------------TTGCCGCCCA P_troglodytes300253 --------------------------------GTGTCCTTTTAAGG-TTG P_troglodytes300314 --------------------------------GTGCCCTTTTAAGG-TAG P_troglodytes300385 --------------------------------GTGCCCTTTTAAGG-TTG P_troglodytes300386 --------------------------------ATGCCCTTTTAAGG-TTG P_troglodytes300464 ------------------------------------GTGCCTAAGG-TTA P_pygmaeus300072 ------------------------------------GTGCCTAAGG-TTA P_pygmaeus300096 --------------------------------TGCCCCTTTTAAGG-TTG P_pygmaeus300135 --------------------------------GTGCCCTTTTAAGG-TTG P_pygmaeus300203 --------------------------------GTGCCCTTTTACGG-TTG P_pygmaeus300271 ------------------------------------------ATGACCCT P_pygmaeus300353 --------------------------------GTGTCCTTTTAAGG-TTG P_pygmaeus300356 -------------------------------TGAACTTTAAAATGCAAGT P_pygmaeus300367 ----------------------------------------TTGCCGCCCA P_pygmaeus300421 --------------------------------GTGCCCTTTTAAGG-TTG P_pygmaeus300423 --------------------------------GTTCCCTTTTAAGG-CTG R_norvegicus300010 --------------------------------GTGCCCTTTTAAGG-TTG R_norvegicus300083 ---------------------------------------ATAAATA-TTG R_norvegicus300126 ----------------------------------GTTCCTTCAGCTAAAC R_norvegicus300144 --------------------------------GTGCCCTTTTAAGG-TTG R_norvegicus300229 --------------------------------GTGCCCTTTTAAGG-TTG R_norvegicus300252 --------------------------------GTGCCCTTTTAAGG-TTG R_norvegicus300361 --------------------------------GTGCCCTTTTACGG-TTG R_norvegicus300401 --------------------------------GTGCCC-TTTAACA-TTG R_norvegicus300463 ---------------------------------CAGCTCCGAAAAAAAGA R_norvegicus300475 --------------------------------GTGCCCTTTTAAGG-TTG R_norvegicus300570 --------------------------------------GTTTAGTCAAA- R_norvegicus300658 ---------------------------ATTCCCTGGGCAGGTGGTTCTGG R_norvegicus300671 --------------------------------GTGCCCTTTTAAGG-TTG R_norvegicus300809 --------------------------------GTGCCCCTTAAAGG--TG R_norvegicus300843 --------------------------------GTGCCCTTTTAAGG-TTG R_norvegicus300901 --------------------------------GTGCCCTTTTAAGG-TTG R_norvegicus301001 --------------------------------GTGCCCTTTCTGGG-ATG R_norvegicus301053 --------------------------------GTGCCCTTTTAAGG-TTG R_norvegicus301063 ----------------------------------GTGCCTTTAAGG-TTG S_cerevisiae300022 TGTTGCAATGGCTCTCGTTTTTTTTAAATTTTTCTCTTTTCTCTTCTTTG S_araneus300035 --------------------------------GTGCCCTCTTAAGG-CTG S_araneus300052 --------------------------------GTGTGCCCTTAAGG-TGG S_araneus300077 --------------------------------ATCAAAATTTAAAATATT S_araneus300080 --------------------------------TCTCTCTACTAAGG-TTG S_araneus300189 ---------------------------------------AAACCTGTATA S_araneus300272 --------------------------------GTGTCCTTTTAAGA-CTG S_araneus300283 --------------------------------GTGCCCTCCTAAGA-CTG S_araneus300302 --------------------------------TAGTCCTTTGAAGG-TTG S_araneus300366 -------------------------------ACACCCTTTTAAAAG-TGG S_araneus300377 --------------------------------GTACCCTTCTAAAA-TTG S_araneus300470 --------------------------------GTACCTTGTTGGGC-TTG S_araneus300608 --------------------------------GCGCCCTCTTAAGG-CAG S_araneus300689 --------------------------------GCATCCTCTTCAGG-TTG S_araneus300842 --------------------------------GTGCCCTTCTAAGG-TTG S_araneus300881 --------------------------------GTGTCA-GGCAGGC-TTC S_araneus300938 --------------------------------TTGCTCTTTTAAGG-CTG S_araneus301004 --------------------------------ATGCCCTTTTAAGG-TTG S_tridecemlineatus300039 --------------------------------GTGCCTTTTTAAGG-TTG S_tridecemlineatus300164 ------------------------------------------AAAAATGA S_tridecemlineatus300203 ------------------------------------------------TA S_tridecemlineatus300218 --------------------------------GTGTCCTTTTAAGG-CTG T_nigroviridis300074 --------------------------------TTGCCCACCTCAGGCAGA T_belangeri300014 --------------------------------GTGCCCT-----GG-TTG T_belangeri300159 --------------------------------GTGCCCT-----GG-T-G T_belangeri300192 --------------------------------GTGCCCTCTTAAGG-CTG T_belangeri300220 --------------------------------GTGCCCTTTTAAGG-CTG T_belangeri300331 --------------------------------GTGCCCTTCTAAGG-CTG T_belangeri300378 --------------------------------GTGCCCTTCCGAGG-TTC C_familiaris300038 CCGCAGT--GCCCT----GGGAGG-------CCAA--CACAGAA------ C_familiaris300096 CCGCAGT--GCCCT----GGGAGG-------CCAA--CACAGAA------ C_porcellus300388 ATACAGT--GCCTT----AAGAGG-------CTAA--CACAGAA------ C_porcellus300424 ACATAGT--GCCTT----AAGAAG-------CTAA--CACAGAA------ C_porcellus300564 ATACAGT--GCCTT----AAGAGG-------CTAA--CACAGAA------ C_porcellus300616 ACACAGT--GCCTT----CAAAGG-------GTAA--TACAGAA------ D_rerio300277 CTGT-GT---CTCT-----AGTGGCC-----ATAA----CAGGG------ D_rerio300278 -TTCTAT--GGCTT----GAGTGA-------ATAA--CACAGGG------ D_novemcinctus300004 ATTCTGC--ATTTG----AAGAGG-------CTAA--CACAGAA------ D_novemcinctus300069 ATTCTGT--ATTTT----AAGAGG-------CCCA--CACAGAA------ D_novemcinctus300134 CCTTGTT--TAAAG----TGAATT-------GCTG--CACAGAA------ D_novemcinctus300226 ATTCAGT--GCTTT----AATTGG-------TTAG--CACAGAA------ D_novemcinctus300305 ------------GT----GTTCTT-------CTAA--CACAGAA------ D_novemcinctus300353 ATTCAGT--GCTTT----AAGTGGCTAATA-TAAAAATGTAGAA------ D_novemcinctus300356 ACTCAGT--GCTTT---AA-GAAG-------CTAA--CACAGAA------ D_novemcinctus300614 ATTCAGT--ACTTT----AAGAGG-------CTAA--CACAGAA------ D_novemcinctus300615 ATTCAGT--GCTTT----AAGAGA-------CTAA--CGCAGAA------ D_melanogaster300121 GCACAGT---TTTAA---ACTAGGTGGTTA--TCCTCCATGGAA------ D_melanogaster300122 GCATGCC---AACTA---AAAAGGCGGTTG-CTCCATTCTGGAC------ E_telfairi300086 TTGCAGT--ACTTT----AAGAGG-------TGAA--CACAGAA------ E_telfairi300115 CTGCGGT--ACTTT----AAGAGG-------CTAA--CACAGAA------ E_telfairi300178 CTGCAGG--GCCTG----CACAGG-------CTCA--CACAGAA------ E_telfairi300184 CTGCAGT--GCTTT----AAGAGG-------GGAA--CACAGAC------ E_telfairi300295 CTGCAAT--ACTTT----AAGAGG-------CTAA--CACAGAA------ E_telfairi300318 A-AT-----ATTTT----TAAAGG-------CGAT--CATTGGT------ E_telfairi300340 CCAACAA--AAGTT----AAGAGG-------CTAA--CACAGAA------ E_telfairi300402 CTGCAGC--GCTTA----AAGAGG-------CTAA--TGCAGAA------ E_telfairi300433 CTGCAGT--ACTTT----AAGAGG-------CTAA--CACAGAA------ E_telfairi300475 CTGCGGT--ACTTT----AAGAGG-------CTAA--CACAGAA------ E_telfairi300487 CTGCGGT--ACTTT----AAGAGG-------CTAA--CACAGAA------ E_telfairi300593 -----GA--AACCC----TCTGGC-------GCAA--CACAGAA------ E_telfairi300640 CTGCAGT--ACTTT----AAGAGG-------CTAA--CACAGAA------ E_telfairi300673 CTGCAGT--ACTTT----AAGAGG-------CTAA--CACAGAA------ E_telfairi300734 CTGCAGC--ACTTT----AAGAGG-------TTAA--CACCGAA------ E_telfairi300741 CTGCAGT--ATTTGA---AAGAGG-------CTAA--CACAGAA------ E_telfairi300764 CTGCGGT--ACTTT----AAGAGG-------CTAA--CACAGAA------ E_telfairi300765 GTGCTGT--GCTTT----AA--GG-------CTAG--CACGGAA------ E_caballus300070 ACGCAGT--GCCTT---AA-GAGG-------CTAA--CACAGAA------ E_caballus300254 ACGCAGT--GCCTT---AA-GAGG-------CTAA--CACAGAA------ E_europaeus300034 ATGCAGT--GCTTC----AAGATG--------CTA--CACGGAA------ E_europaeus300117 -TGCAAT--G-ATT----AAGAGA-------CTAA--CACAGAA------ E_europaeus300122 ATGCAGT--GCTTC----AAGATG--------CTA--CACGGAA------ E_europaeus300204 ACACAGT--CCTTT----AAGAGA-------CTTA-----ACAC------ E_europaeus300219 ATGCAAT--GGTTT----GAGAGG-------CTAA--CACAGAA------ E_europaeus300239 -TCTAGT--GCTTG----AAGAGG-------CTAA--CACAGAA------ E_europaeus300272 -TGCAGT--GCTTT----AAGTGG-------CTAA--CACAGAA------ E_europaeus300346 ACTCAGC--GCTTT----AAGAGG-------CTAA--CACAGAA------ E_europaeus300352 ATACAGT--GTTTT----CAGAGA-------TGAA--CACAGGA------ E_europaeus300375 ACACAGT--CCTTT----AAGAGA-------CTTA-----ACAC------ E_europaeus300380 ACAGAGT--ACTTT----AAGAGG-------CTAG--CTCAAAA------ E_europaeus300383 ---CACT--G-TTT----AAGAAG-------CTAA--CACAGAA------ E_europaeus300388 GTGCAGT--GCTTT----TAGAGG-------CTAA--CACAGAA------ E_europaeus300389 ---CAGT--GCTTT----AAGAGG-------CTAA--CACAGAA------ E_europaeus300428 ---TAA----TTTA----AGAAG--------TTAA--CATAGAA------ E_europaeus300433 ATGCAAC--GTTTA----AGAGA--------CTAA--CATAGAA------ E_europaeus300454 ATGCAGT--GTGTT----AAGAGGCTATG---------GCAAAA------ E_europaeus300464 ATGCTTT--AAGTGCTTTAAGACG-------TTAA--CATAGAA------ E_europaeus300544 ATGCAGT--TCTTA----AAAAGG-------CTAA--CACAGAA------ E_europaeus300549 ATGCTTT--AAGTGCTTTAAGACG-------TTAA--CATAGAA------ E_europaeus300591 ACTTGGT--ACTTT----CAGAGG-------CTAG--CACAGAA------ E_europaeus300701 A-ATCAC--ATTCT----AATTTG-------CTAA--CATAGGA------ E_europaeus300721 ATGCAGT--GCTTT----AAAAGA-------CTTAA-CACAG-------- F_catus300053 ACGCAGT--GCCTT----AAGAGG-------CTAA--CACAGAA------ H_sapiens300058 ACCCAGT--GCTTT----AAGAGG-------CTAA--CACAGAA------ H_sapiens300480 ACCCAGT--GCTTT----AAGAGG-------CTGA--TACAGAA------ L_africana300063 CTGCAGT--GCTTT----AAGAGGCTAAC---------ACAGAA------ L_africana300379 ATGCAGT--GCCCA----AGGTGG-------CT-G--CACAGGA------ L_africana300481 ACGCTGT--GATTT----AAGAAG-------CTAA--CACAGAA------ M_mulatta300012 ACCCAGT--GCTTT----AAGAGG-------CTAA--CACAGAA------ M_mulatta300195 TCACAGT--TCTTT----AAGAGA-------CTAA--CACAGAA------ M_mulatta300271 AACAAC---CAAAT----TAAAAA-------ATAA--CACAGAA------ M_mulatta300286 ACACAGT--TTTTT----AAGCGG-------CTAG--CACAGAA------ M_mulatta300298 ATGTAGT--GCTTT----AAGAAGCTAAC---------ATAGAA------ M_mulatta300376 GCCCAGT--GCTCT----AAGAGG-------CTGA--TACAGAA------ M_mulatta300391 ATGCAAT--GCTTT----AAGAGG-------CTAA--CACAGAA------ M_mulatta300408 ACACAGT--GCCTT----AAGAGG-------CTAA--CACAGAA------ M_mulatta300476 ACACAGT--GCCTT---AA-GAGC-------CTAA--CACAGAA------ M_mulatta300480 ACGCAGT--GCTTT----AAGGGG-------CTAA--CACAGAA------ M_mulatta300488 ACACAGT--GCTTT----AAG------------------CAGAA------ M_murinus300225 ACGCAGT--GCTTT----AAGAGG-------CTAA--CACAGAA------ M_murinus300268 TTGCAGT--GCTTT----AAGAGG-------CTAA--AACAGAA------ M_murinus300303 ACGCAGT--GCTTT----AAGAGG-------CTAA--CACAGAA------ M_murinus300410 A-----------------AAGAGG-------CTAA--CACAGAG------ M_domestica300024 ---CAGT--GCTTT----AAGAGG-------CTAA--CCCAGAA------ M_musculus300704 TCACGGT--ACTTT----AAGAGG-------CTAA--CACAGAA------ M_musculus300786 AGAGGAT--ACTTT----AAAAGG-------CTAA--CACAGAA------ M_musculus300787 ATACTGT--ACTTT----AAGAGG-------CTAA--CACAGAA------ M_musculus300823 ACACAGT--CCTGT----AAGAGG-------CTAG--CACAGAG------ M_musculus300924 ACACTGT--ACTTT----AAGAGG-------CTAA--CACAGAA------ O_anatinus303218 CTGCTTGT-GCTCT----AAGGGG--------CAA--CACAGGA------ O_cuniculus300002 G--------AAAAC----CATAGC-------AAAG--CACAGAA------ O_cuniculus300003 ACAGAGT--GCTTT----AAGAGG-------CTAA--CATATAA------ O_cuniculus300028 AGAGTGT--GCTTT----AAGAGG-------CTAA--CACAGAA------ O_cuniculus300143 ACACAGT--GCTTT----AAGAGG-------CTAA--CACAGAA------ O_cuniculus300155 AGAGTGT--GCTTT----AAGAGG-------CTAA--CACAGAA------ O_cuniculus300284 ACAGAGT--GCTTT----AAGAGG-------CTAA--CACAGAA------ O_cuniculus300286 ACACAGT--GCTTT----AAGAGG-------CTAA--CACAGAA------ O_cuniculus300362 ACAGAAT--GCTTT----AAGAGG-------CTAG--CACAGAA------ O_cuniculus300404 ACAG--T--GCTTT----AAGAGG-------CTAA--CACAGAA------ O_cuniculus300435 ATGGAGT--GCTTT----AAGAGG-------CTAA--CACAGGT------ O_cuniculus300510 ACAGAGT--GCTCT----GAGAGG-------CTAA--CACAGAA------ O_garnettii300026 ATGCAGG--GCTCT----AAAAGG-------CTAA--CACGGAA------ O_garnettii300054 ATGCAGT--TCTTT----AAGAGA-------CTAA--CATGGAG------ O_garnettii300084 ATGCAGT--GCTTT----AAGGGA-------GGAA--CACAGAA------ O_garnettii300102 ATGCAGT--GCTTT----AAGGGA-------GGAA--CACAGAA------ O_garnettii300162 ATGCAGT--GCTTT----AAGAGG-------CTAA--CACAGAA------ O_garnettii300481 ATGCAGT--GCTTT----AAGAGG-------CTAA--CACAGAA------ P_troglodytes300017 ACCCAGT--GCATT----AGGAGG-------CTGA--TACAGAA------ P_troglodytes300069 TCATAGA--TCTTT----AAGAGA-------CTAA--CACAGAA------ P_troglodytes300091 ACACAGT--GCATT----AAG------------------CAGAA------ P_troglodytes300149 ATGCAAT--GCTTT----AAGAGG-------CTAA--CACAGAA------ P_troglodytes300155 ACCCAGT--GCTTT----AAGAGG-------CTAA--CACAGAA------ P_troglodytes300215 CACAAC---CAAAT----TAAAAA-------ATAA--CACAGAA------ P_troglodytes300253 ACACAAT--GCTTT---AA-GAGC-------CTAA--CACAGAA------ P_troglodytes300314 ACGCAGT--TTTGT----AAGAGG-------CTAA--CACATAA------ P_troglodytes300385 ACGCAGT--GCTTT----AAGGGG-------CTAA--CACAGAA------ P_troglodytes300386 ATGTGGT--GCTTT----AAGAAGCTAAC---------ATAGAA------ P_troglodytes300464 ACACAGC--GCCTT----AAGAGG-------CTAA--CACAGAA------ P_pygmaeus300072 ACACAGC--GCCTT----AAGAGG-------CTAA--CACAGAA------ P_pygmaeus300096 ACAC-GT--GCATT----AAG------------------CAGAA------ P_pygmaeus300135 ACGCAGT--GCTTT----AAGGGG-------CTAA--CACAGAA------ P_pygmaeus300203 ATGTAGT--GCTTT----AAGAAGCTAAC---------ACAGAA------ P_pygmaeus300271 TTCCTGC--GC-------CAGAGG-------CTAA--CACAGAA------ P_pygmaeus300353 ACACAGT--GCTTT---AA-GAGC-------CTAA--CACAGAA------ P_pygmaeus300356 TCATAGT--TCTTT----AAGAGA-------CTAA--CACAGAA------ P_pygmaeus300367 CACAAC---CAAAT----TAAAAA-------ATAA--CACAGAA------ P_pygmaeus300421 ACCCAGT--GCTTT----AAGAGG-------CTAA--CACAGAA------ P_pygmaeus300423 ACCCAGT--GCTTT----AAGAGG-------CTGA--TACAGAA------ R_norvegicus300010 TCGCAGT--ACTTT----AAGAGG-------CTAA--CACAGAA------ R_norvegicus300083 CCCCAGT--ACTTT----AAGAGG-------CTAA--CACAGAA------ R_norvegicus300126 ATAAAGA--AGAAA----AGCAGG-------CTAA--CACAGAA------ R_norvegicus300144 TTGTGGT--ACTTT----AAGGGG-------CTAA--CACAGAC------ R_norvegicus300229 TCGTGGT--ACTTT----AAGAGG-------CTAA--CACAGAA------ R_norvegicus300252 TCGCAGT--ACTTT----AAGAGG-------CTAA--CACAGAA------ R_norvegicus300361 TCATGGT--ACTTT----AAGAGG-------CTAA--CACAAAA------ R_norvegicus300401 CTGCAGT--GCTTT----AAGATG-------CTAA--CACAGAA------ R_norvegicus300463 ACCAAAA--AAAAA----AAGAGG-------TTAA--CACAGAA------ R_norvegicus300475 TCGCAGT--ACTTT----AAGAGG-------CTAA--CACAGAA------ R_norvegicus300570 --GTGGA--GAATC----TGGAGG-------CTAA--CACAGAA------ R_norvegicus300658 GTTCTAT--AAGAA----AGCAGA-------CTAA--CACAGAA------ R_norvegicus300671 TCATGGC--TCTTT----AAGAGG-------CTAA--CACAAAA------ R_norvegicus300809 GTGCTGT---ACTT----AAGAGG-------CTAA--CACAGAA------ R_norvegicus300843 TTGCAGT--ACTTT----AAGAGG-------CTAA--CACAGAA------ R_norvegicus300901 GTACTGT--ACCTT----AAGAGG-------CTAA--CACAGAA------ R_norvegicus301001 ACACTGT--CCTGT----AAGAGG-------CTAG--CACAGAA------ R_norvegicus301053 TCGAGGT--ACTTT----AAGAGG-------CAAA--CACAGAA------ R_norvegicus301063 TCTCAGT--ACTTT----AAGAGG-------CTAA--CACAGAA------ S_cerevisiae300022 GCATAGTTTATTTTTAATAAATTATTTCAGGGTGAGATAGAGAAAGGATA S_araneus300035 ATG--GT--GCTTT----CAGAGG-------TTAA--CACAGAA------ S_araneus300052 ACTTGGT--GCTTT----CAGGGGCTA-----------GCAGGA------ S_araneus300077 TGAACTT--CAAAG----AGCAGG-------AAAG--TAAATCT------ S_araneus300080 ACTTGGT--GCTTT----AAGAGG-------TTCA--CACAGAA------ S_araneus300189 A-ACC-----TTTT----GTCTAG-------CCAA---ACAGAA------ S_araneus300272 GTGCAGT--GCCTT----AAGAGA-------TTAA--CAGAGA------- S_araneus300283 TCTTGGT--GCTTT----CAGAGA-------CTCG--TGTAAGA------ S_araneus300302 ATACCATG-CTGTC----AGAGAC--------CAA--CACAGAA------ S_araneus300366 ACACAGT--GCTTT----AAA-GA-------GTGAG-CACAGGA------ S_araneus300377 ATGCAGTT-GCTTT----ACATTG-------ACAA--TGCAGAA------ S_araneus300470 ATGCAAT--GCTTT---TA-GAGG-------CTAA--CACAGA------- S_araneus300608 CCTCAGG--GCTCC----AAGATG-------CTAA--CACA-GA------ S_araneus300689 ACTCGGTG-GTTTC----AGAGTC--------TAA--CACAAAA------ S_araneus300842 AAGTAGT--GCTTT---AAAGAAG-------CTAA--CACAGAAGAACAG S_araneus300881 AAACAAC--GCTTT---TAAGAAA-------CTGA--CACAC-------- S_araneus300938 ATGCAGT--GCTTT----AAGAGG-------CTAA--CACAGAA------ S_araneus301004 TTGCAGT--ACTTGCTTTAAGAGG-------CTAA--CACAGA------- S_tridecemlineatus300039 ACGCAGT--GCTTT----AAGAAG-------CTAA--CACAGAA------ S_tridecemlineatus300164 -TGCAGG--AATTT----AAGAGG-------CTCA--CACAGAA------ S_tridecemlineatus300203 ACCAGAAA-ACTCCA---GAATAGCCTTTT-CTTGTGTACTTTAA----- S_tridecemlineatus300218 ATGTGAT--ACTTC----AAAAGGCTTATT-TTAC--CACAGAA------ T_nigroviridis300074 CCGTTGC---CTCT-----GGTGGAA-----ACA-----CAGGG------ T_belangeri300014 ACGCCAT--GCTTT----TAGAGG-------CTAA--CACGGAA------ T_belangeri300159 ACGCCAT--GCTTT----TAGAGG-------CTAA--CACGGAA------ T_belangeri300192 CCGCAGT--GCTTT----AAGAGG-------CTAA--CACAGAA------ T_belangeri300220 CCGCAGT--GCTTT----AAGAGG-------CTAA--CACAGAA------ T_belangeri300331 CCGCAGT--GCTTT----AAGAGT-------CTAA--CATAGAA------ T_belangeri300378 ATGCT------GTGCTTTAAGAGG-------TTAA--CACAGAA------ C_familiaris300038 --GGGGACAGC-----AAGG-----CTCCAT-----GAAACC-------C C_familiaris300096 --GGGGACAGC-----AAGG-----CTCCAT-----GAAACC-------C C_porcellus300388 --GAGTACAGG-----AACC-----CTCCAT-----AAAATC-------C C_porcellus300424 --GGGTAAAGG-----GACC-----CTCCAT-----AGAACC-------C C_porcellus300564 --GGGTACAGG-----AACC-----CTCCAT-----AAAACC-------C C_porcellus300616 --GGGAA-AAGA----AAGA-----CTCCTT-----AAAGCC-------C D_rerio300277 --GGGTATATTG-----AGCTG--CTCTTGT-----TAAAACC------C D_rerio300278 --GGGCAGAAGA-----ATT-----CTCTCA-----AAAACC-------T D_novemcinctus300004 ---GGTAAAGT-----AAGT-----CTCCAT-----AAAACC-------C D_novemcinctus300069 --TGGTAAAGT-----AAGC-----CTCCAT-----AAAACC-------T D_novemcinctus300134 --GTGTAAAGTA-----AGT-----CTCCGA-----AAAACA-------G D_novemcinctus300226 --GGGCAAAAG-----AAGT-----CTCCAT-----AAAATC-------C D_novemcinctus300305 --GGGTAAAGTA-----AGT-----CTCCAT-----AAAAAT-------G D_novemcinctus300353 --GGGTAAATT-----AATT-----CTCCAT-----AAAACC-------C D_novemcinctus300356 --GGGAAAA---------GT-----CTCCAT-----AAAATG-------C D_novemcinctus300614 --GGGTAAATT-----AAGT-----CTCCAT-----AAAACC-------C D_novemcinctus300615 --GGGTAAAGT-----AAGT-----CTCCAT-----AAAACT-------C D_melanogaster300121 --GATCACCGATCGAAAGCTGT--GCCCAAA----GCAAACC-------C D_melanogaster300122 --AACTGCTGA-CGATACGTGT--GCCCAGA----GCGAATC-------C E_telfairi300086 --AGGCA-----AAACGAGT-----TTCCAT----AAAA--CC------C E_telfairi300115 --GGGTAAATA-AAGCAAGT-----CTCCAT----AAAA--CC------C E_telfairi300178 --GGGCAAAGC-----AAGT-----CTCCAG-----AAAACC-------C E_telfairi300184 --TGGCA-----AGGCACCC-----CTCCAT----AAAA--CC------C E_telfairi300295 --GGGTA-----AAGCAAGT-----CTCCAT----AAAA--CC------T E_telfairi300318 ---GGTAAAGTA-----AGG-----CTCCAG-----AGAACC-------C E_telfairi300340 --GGGTAAAGCA-----AAT-----CTGCAT-----ACAACC-------C E_telfairi300402 --GGGTG-TATG----T-GT-----CTCCAT-----AAAACT-------C E_telfairi300433 --GGGTA-----TAGCAAGT-----CTCCAT----AAAA--CC------C E_telfairi300475 --GGGTA-----AAGCAAGT-----CTCCAT----AAAA--CC------C E_telfairi300487 --GGGTAAATA-AAGCACGT-----CTCCAT----AAAA--CC------C E_telfairi300593 --GGGTAAAGCG-----AGG-----CTCCAT-----AAAGCC-------C E_telfairi300640 --GG-TA-----AAGCAAGT-----CTCCAT----AAAAAACC------C E_telfairi300673 --GGGTA-----AAGCAAAT-----CTCCAT----AAAA--CC------C E_telfairi300734 --GGGTA-----AAGCA-GT-----CTCCAT----GAAA--CC------C E_telfairi300741 --AGATG-----AAGCAAGT-----TTCCAT----AAAA--CC------C E_telfairi300764 --GGGTA-----AAGCAAGT-----CTCCAT----TAAA--CC------C E_telfairi300765 --GGGTAAAGT-----AAGT-----CTCCAT-----GAAAC--------- E_caballus300070 --GGGCAAAGT-----AAGT-----CTCCGT-----AAAACC-------C E_caballus300254 --GGGCAAAGT-----AAGT-----CTCCAT-----AAAACC-------C E_europaeus300034 --AAGTA-AAGA----AAAG-----CTCTA-------------------- E_europaeus300117 --AGGTAAAGTA-----AAT-----TTCCAC-----AAAGCC-------C E_europaeus300122 --AAGTA-AAGA----AAAG-----CTCTA-------------------- E_europaeus300204 --TGAAGGGTAA----ATT-------TCCAT----AAAGTCC-------C E_europaeus300219 --GGGCAAAATA-----AGT-----GTCTAT-----AAAACC-------C E_europaeus300239 --AGGTAAAATA-----AAT-----CTCCAT-----AAAAGC-------C E_europaeus300272 --GGGGAAAGTA-----AAT-----CTCCAT-----AAGATC-------C E_europaeus300346 --GGGAAAAGT-----AAGT-----CTCCAT-----AAAAGG-------C E_europaeus300352 --GGGTGAAGTA-----AGT-----CTTCCT-----AAAACCAAAGTTCC E_europaeus300375 --TGAAGGGTAA----ATT-------TCCAT----AAAGTCC-------C E_europaeus300380 --GGGTAGC-----CTACGT-----CCTTAT-----AAAACT-------C E_europaeus300383 --GGGTAAAGTA-----AGT-----CTCCAT-----AAAACC-------C E_europaeus300388 ---GAGGGACAT----AAT------CTCCAT----AAAAGCC-------C E_europaeus300389 --GGATAAAGT-----AAAT-----CTTTAT-----AAAAT--------C E_europaeus300428 --GGGTAAAGT-----AAGT-----TTTCAT-----AAAACC-------C E_europaeus300433 --GAATAAAGT-----AAGT-----CTTCAC-----AAAATC-------C E_europaeus300454 --GGATAAAGT-----AAAT-----CTCCAT-----ATAACC-------C E_europaeus300464 --GGGTAAAGTT----AAGT-----CTTCAT-----GAAACC-------C E_europaeus300544 --GGGTAGAAT-----TAGT-----CTTCAT-----AAAACC-------C E_europaeus300549 --GGGTAAAGTT----AAGT-----CTTCAT-----GAAACC-------C E_europaeus300591 --GAATAAA-----GTAAAT-----CTTTAT-----AAAACT-------C E_europaeus300701 --AGGTAAAGTA-----AGT-----CTCCA------ATAACC-------C E_europaeus300721 --------AAGT----AAGT-----CTCCAT-----AAAATT-------C F_catus300053 --GGGTAAA-----GTAAGT-----CTCCAT-----AAAACC-------C H_sapiens300058 --GGGTAAA-----GTAAGT-----CTCCAT-----AAAACC-------C H_sapiens300480 --GGGTAAAGTT----AAGT-----CTCCAC-----AAAATC-------C L_africana300063 --GGGTAAAGT-----AAGA-----CTCTAT-----AAAACC-------C L_africana300379 --GG-----GT-----AAGT-----CTCCAC-----AAAACC-------C L_africana300481 --GGTTG-AATT----CAGT-----CTCCGT-----GAAACC-------C M_mulatta300012 --GGGTAAA-----GTAAGT-----CTCCAT-----AAAACC-------C M_mulatta300195 --AGCTAAAGTA-----ATT-----ATCCAT-----AGAACC-------C M_mulatta300271 --GAGTAAGGTA-----AGT-----CTCCAT-----TAAACA-------C M_mulatta300286 --GGGTAAA-----GTAAGT-----CTCCAT-----AAAACC-------C M_mulatta300298 --GGATAAAAT-----AAGT-----CTCTAC-----AAAACC-------C M_mulatta300376 --GGATAAAGTT----AAGT-----CTCCAC-----AAAACC-------C M_mulatta300391 --GGGTAAAGCT----TTCTTT--ACCCTTTGGG-TAAAACC-------C M_mulatta300408 --GGGCAAA-----GTAAGT-----CTCCAT-----AAAACC-------C M_mulatta300476 --GT---AAGT-----AAGT-----TTCCAT-----AAAACC-------C M_mulatta300480 --GGGTTAA-----GGAAGT-----CTCCAC-----AAACCC-------C M_mulatta300488 --GGGTAAA-----GTAAGT-----CTCCAT-----AAAACC-------C M_murinus300225 --GGGTAAAGT-----AACT-----CTCCAT-----AAAACC-------C M_murinus300268 --GGGTATAGT-----AA-T-----CTTCAT-----AAAACC-------C M_murinus300303 --GGGTAAAGT-----AAGT-----CTCCAT-----AAAACC-------C M_murinus300410 --AGGCA-----AAGCGAGT-----CTCCAT----AAAA--CC------C M_domestica300024 --TGAAGGGTAT----AATAAT--TCTCCAT----TAAA-CC-------C M_musculus300704 --GGGTAAAGG-----AACT-----CTCCAT-----AAAACC-------C M_musculus300786 --GGGCAAAGGA-----ACT-----CTCTAT-----AAAACC-------C M_musculus300787 --GGGTAAAGG-----AACT-----CTCCAT-----CAAACC-------C M_musculus300823 --GGGTAGA-----GGAAAT-----CTCTAT-----TAA-CT-------C M_musculus300924 --GGGTAAAGG-----AACT-----CTCCAT-----CAAACC-------C O_anatinus303218 --GGGAATAAC------ATTC----CTCTCT-----TAAACC-------C O_cuniculus300002 --GGGGAAAGTA-----AGT-----CTCCAT-----AAAACC-------C O_cuniculus300003 --GTGGAAAGT-----AAGT-----CTCCAT-----AAAACC-------C O_cuniculus300028 --GGGGAAAGA-----AAAG-----CTCCAT-----AAAACC-------T O_cuniculus300143 --GGGGAAACT-----AAGT-----CTCCAC-----AAAACC-------C O_cuniculus300155 --GGGGAAAGA-----AAAG-----CTCCAT-----AAAACC-------T O_cuniculus300284 --GGG-AAAAT-----AAGT-----CTCCAT-----AAAACC-------C O_cuniculus300286 --GGGGAAACT-----AAGT-----CTCCAC-----AAAACC-------C O_cuniculus300362 --GGGGAAAGT-----AAGT-----TTGCAT-----CAAACC-------C O_cuniculus300404 --GGGGAAAGT-----AAGT-----CTCCCT-----AAAACC-------C O_cuniculus300435 --GGGGAAAGT-----AAGT-----CTCCAT-----AAAATG-------C O_cuniculus300510 --AGGGAAAGT-----AAGT-----CTCCAT-----AAAACC-------C O_garnettii300026 --GG--A-AAGC----ACAT-----CTCCAT-----AAAACC-------C O_garnettii300054 --GGGTAAAGT-----AAAT-----CTCCAT-----AAAACC-------T O_garnettii300084 --GTATAAAGTG----AGT------TTCCAT-----AAAACC-------C O_garnettii300102 --GTATAAAGTG----AGT------TTCCAT-----AAAACC-------C O_garnettii300162 --GGGTAAAGT-----AAAT-----CTCCAT-----AAAACC-------C O_garnettii300481 --GGGTAAAGTA-----AAT-----CTCCAC-----GAAACC-------C P_troglodytes300017 --GGGTAAAGTT----AAGT-----CTCCAC-----AGAATC-------C P_troglodytes300069 --AGCTAAAGTA-----ATT-----CTCCAT-----AAAACC-------C P_troglodytes300091 --GGGTTAA-----GTAAGT-----CTCCAT-----AAAACC-------C P_troglodytes300149 --GGGTGAAGCC----AGTCT-----CCT------TAAAACC-------C P_troglodytes300155 --GGGTAAA-----GTAAGT-----CTCCAT-----AAAACC-------C P_troglodytes300215 --GGGTAAGGTA-----AGT-----CTCCAT-----TAAACC-------C P_troglodytes300253 --AGGTAAAGT-----AAGT-----TTCCGT-----AAAACC-------C P_troglodytes300314 --GGGTAAATTCAAGTAAGT-----CTCCAT-----AAAACC-------C P_troglodytes300385 --GGGTAAA-----GGAAGT-----CTCCAT-----AAACCC-------C P_troglodytes300386 --GGATAAAGT-----AAGT-----CTCTAC-----AAAACC-------C P_troglodytes300464 --GGGCAAG-----GTAAGT-----CTCCAT-----AAAACC-------C P_pygmaeus300072 --GGGCAAA-----GTAAGT-----CTCCAT-----AAAACC-------C P_pygmaeus300096 --GGGTTAA-----GTGAGT-----CTCCAT-----AAAATC-------C P_pygmaeus300135 --GGGTAAA-----GGAAGT-----CTCCAT-----AAACCC-------C P_pygmaeus300203 --GGATAAAGT-----AAGT-----CTCTAC-----AAAACC-------C P_pygmaeus300271 --GGGTAAAGCC-----AGT-----CTCCTT-----AAAACC-------C P_pygmaeus300353 --AGGTAAAGT-----AAGT-----TTCCAT-----AAAACC-------C P_pygmaeus300356 --AGCTAAAGTA-----ATT-----CTCCAT-----AAAACC-------C P_pygmaeus300367 --GGGTAAGGTA-----AGT-----CTCCAT-----TAAACC-------C P_pygmaeus300421 --GGGTAAA-----GTAAAT-----CTCCAT-----AAAACC-------C P_pygmaeus300423 --GGGTAAAGTT----AAGT-----CTCCAC-----AAAATC-------C R_norvegicus300010 --GGGTAAAGG-----AAGT-----CTCCAC-----AAAACC-------C R_norvegicus300083 --GGGTAAAGG-----AAGT-----CTCCAT-----AAAACC-------C R_norvegicus300126 --GGGTAAAGGA-----ACT-----CTCCAT-----AAAACC-------A R_norvegicus300144 --AGGTAAAGG-----AACT-----TTCCAT-----AAAACC-------C R_norvegicus300229 --GGGTAAAGG-----AATT-----CTCCAT-----AAAACC-------C R_norvegicus300252 --GGGTAAAGG-----AAGT-----CTCCAT-----AAAACC-------C R_norvegicus300361 --GGGTAAAAG-----AACT-----CTCCAT-----AAAACC-------T R_norvegicus300401 --GGGTAAAGG-----AACG-----CTCCAT-----GAAACC-------C R_norvegicus300463 --GGGTAAAGGA-----AGT-----CTCCGT-----AAAACC-------C R_norvegicus300475 --GGGTAAAGG-----AAGT-----CTCCAT-----AAAACC-------C R_norvegicus300570 --GGGTAAAGGA-----AGT-----CTCCAT-----AAAACC-------C R_norvegicus300658 --GGGTAAAGGA-----AGT-----CTCCAT-----AAAACC-------C R_norvegicus300671 --GGGTAAAGG-----AAGT-----CTTCAT-----AAAACC-------C R_norvegicus300809 --GGGTAAAGC-----AACT-----CTTCAT-----AAAACC-------C R_norvegicus300843 --GGATAAAGG-----AAGT-----CTCCAT-----AAAACC-------C R_norvegicus300901 --GGGTAAAGG-----AACT-----CTCCAT-----AAAACC-------C R_norvegicus301001 --GGGTAGA-----GGAAAT-----CTCTAG-----AGA-CT-------C R_norvegicus301053 --GGGCAA------------------------------------------ R_norvegicus301063 --GGGTAAAGG-----AAGT-----CTCCAT-----AAAACC-------C S_cerevisiae300022 ATGAGTATCGTAGATAAATCTTCGGTTCCGAATAGTGTAACTGTTGGTGC S_araneus300035 --AGGTAAAGT-----AGT------CTCCAA-----AAAACC-------C S_araneus300052 --GGATAAAGT-----AAGT-----TTCCAT-----AAAACC-------C S_araneus300077 --CTATAAAACCC----AGA-----GACAAA-----GATTTA-------T S_araneus300080 --GGAAG-AGTA----AAGT-----CCCCAC-----ACAACC-------A S_araneus300189 --GGGTAAAGTA-----AGT-----CTCCAT-----AAAATT-------C S_araneus300272 --GGGTAAAGG-----CAGT-----CTCTGA-----AAAATT-------C S_araneus300283 --GGGTA-AAAT----CAGG-----CTCTAT-----AAAACC-------C S_araneus300302 --GGGGA-AAGT----AAGG-----CTCCAT-----AAAACC-------C S_araneus300366 --AGGTA-AAGT----AAGT-----CTCCAT-----AAAATT-------C S_araneus300377 --AGGTA-AAGT----AAGA-----ATCTAT-----AAAACC-------T S_araneus300470 --GGGTAAAGT-----AAGT-----CTCCAT-----AAAACC-------C S_araneus300608 --GGGTA-AAGG----AAGA-----ATC-AT-----AAAACA-------T S_araneus300689 --GGGTA-AAGT----AAGT-----CAGCAT-----AAAATCT------C S_araneus300842 AAGAGTAGATG-----AAGT-----TTCTAT-----AAAACT-------C S_araneus300881 ---GGCACAGT-----CAGT-----CTCCGG-----AAAACC-------C S_araneus300938 --GGGTAAAGTG----AAT------CTCCAT-----AAAACC-------C S_araneus301004 --GGGTAAAAT-----AAGT-----CTTCAT-----AAAACC-------C S_tridecemlineatus300039 --GGGTA-AAGC----AAAC-----CTCCAT-----AGAACC-------C S_tridecemlineatus300164 --GGGCAAAGGA-----AAC-----CTTCAC-----GGAACC-------C S_tridecemlineatus300203 --AGGTTGATGC-----AGC-----CGATAGGT--TAAAATC-------T S_tridecemlineatus300218 --GGGTAAAAT-----AAGT-----CTCCAT-----AAAACC-------C T_nigroviridis300074 --GGGCAGATT------AGCT---CTCTCAT-----AAACCCG------C T_belangeri300014 --GGGTAAA-----ATAAGT-----CTCCAT-----AAAATC-------C T_belangeri300159 --GGGTAAA-----ATAAGT-----CTCCAT-----AAAATC-------C T_belangeri300192 --GGGTAAA-----GTAAGT-----CTCCAT-----AAAACC-------C T_belangeri300220 --GGGTAAA-----GTAAGT-----CTCCAT-----AAAACC-------C T_belangeri300331 --GGTTAAAAGC----AAGA-----CTCCAT-----AAAACT-------C T_belangeri300378 --GG-TAAAGT-----AAGT-----CTCTGT-----GAATTC-------C C_familiaris300038 AGGG--AC---------GAGCCCGCA-------GAGCTC-CTCTTTGGA- C_familiaris300096 AGGG--AC---------GAGCCCGCA-------GAGCTC-CTCTTTGGA- C_porcellus300388 AGAG--AA---------GAGACTG--------ACAC-TC-CTCTTTGGA- C_porcellus300424 AGAG--AA---------GAGACTG--------AAA-C----TCTTTGAA- C_porcellus300564 AGAG--AA---------GAGACTT--------ACGC-TC-CTCTTTGGA- C_porcellus300616 AGAT--AA---------GAGATTAAA----------CTC-TTCTTTGGG- D_rerio300277 AGGC--CA---------GAGGTCATT----------CTCTGAGTCTGGA- D_rerio300278 GAAG--TG---------CTGGCTTTG------ATATTCCATGCTTCGGA- D_novemcinctus300004 AGAG--AG---------GAGATTAT-------AAAACTC-CTCTTTGGA- D_novemcinctus300069 GGAG--AG---------GAGA----------------TC-CTCTTTGGA- D_novemcinctus300134 GAAG--AA---------GAGAT-TGT------AAAACTC-CTCTTTGGA- D_novemcinctus300226 AGGC--AG---------TAGGCTGT--------AAAATC-CTCTTTCAA- D_novemcinctus300305 AGAG--AG---------GAGATTACA------AAA-CTC-CTCTTTAGA- D_novemcinctus300353 AGAG--AG---------GAGATTGT-------AAAACTT-CATTTTGGAT D_novemcinctus300356 AGAG--AG---------GAGATTGT-------AAAACTC-CCCTTTGGA- D_novemcinctus300614 AGAG--TG---------GAGATGAT-------AAGACTC-CTCTTTGGA- D_novemcinctus300615 AGAG--AA---------GAGATGAT-------AAAAATC-CTCTTTAAA- D_melanogaster300121 CAGC--CATTG-----TAAAACAGCGG-----CGTGTTGGCCCTCAGTGC D_melanogaster300122 AAAG--CCTTGC----TAAAACAGCGG-----CCTGCTG-CTTTCAATGA E_telfairi300086 AGAG--AT---------GAGGTCACC------ATAACTC-CTCTTTGGA- E_telfairi300115 AGAG--AC---------GAGGTCGGC------AGAACTC-CTCTTTGGA- E_telfairi300178 AGGG--AC---------CGGGTTGCAA------GAACTC-TTCTTTGGA- E_telfairi300184 AGAG--AC---------GAGGTCTGT------GGAACTC-TTCTTTGGA- E_telfairi300295 AGAG--AT---------GAGGTTGGT------ACAACTC-CTCTTTGGA- E_telfairi300318 AGAG--AT---------GATATTGGA------GAA-CTT-CTCTTTGGA- E_telfairi300340 AGAG--AA---------GAGGTCAGT------AGAACTT-CTCTTGGGA- E_telfairi300402 AGAG--AA---------GAGATCAGAT-----AC--CTC-TTCTTTGGA- E_telfairi300433 AGAG--AC---------AAGGTCGGT------AGAACTC-CTCTTTGGA- E_telfairi300475 AGAG--AC---------GAGGTCGGT------AGAACTC-CTCTTTGGA- E_telfairi300487 AGAG--AC---------GAGGTCGGC------AGAACTC-CTCTTTGGA- E_telfairi300593 AGAG--AC---------GAGGCCGGT------AGAACTC-CTCTTTGGA- E_telfairi300640 AAAG--AC---------AAGATCGGT------AGAACTC-CTCTTTGGA- E_telfairi300673 AGAG--AC---------GAGGTCGGT------AGAACTC-CTCTTTGGA- E_telfairi300734 AGAG--AT---------GAGGTCGGT------AGAACTC-CTATTTGGA- E_telfairi300741 AGAG--AC---------GAGGTCGGT------ATACCTC-CTCTTTGGA- E_telfairi300764 AGAG--AT---------GAGGTCGGC------AGAACTC-CTCTTTGGA- E_telfairi300765 -------------------------------------TC-CTCTTTGGA- E_caballus300070 GGAG--AG---------GAGATTGT-------CGGACTC-CTCTTTGGA- E_caballus300254 TGAG--AG---------GAGATTGT-------CAGACTC-CTCTTTGGA- E_europaeus300034 -GAG--AA---------GAGGTTGCAA-----A---CAC-TTCTTTGGA- E_europaeus300117 AAAA--AA---------GACA---GC------AAAACTC-T-----GAA- E_europaeus300122 -GAG--AA---------GAGGTTGCAA-----A---CAC-TTCTTTGGA- E_europaeus300204 AAG---------------------TA------AGA-CTG-CTGTTTGGA- E_europaeus300219 AGGG--AA---------GAGGTTATA------AAAATTT---TCTTGGA- E_europaeus300239 AGGG--GA---------GAAATTGTG------AAACTCT--TCTTTGGA- E_europaeus300272 AGGG--AA---------GGGATT-GC------AAAACTC-TTCACTAAA- E_europaeus300346 AAGG--GA---------GAGACTGCA------AAA-CTC-TTCTTTGGA- E_europaeus300352 AAAG--AA---------GAGATTGCA------AAA-CTC-TTCTTTGGA- E_europaeus300375 AAG---------------------TA------AGA-CTG-CTGTTTGGA- E_europaeus300380 AGAG--AA---------GAGATCGT-------AAAACTC-TTCTTTGGA- E_europaeus300383 AGGG--GA---------GAGATT-AC------AGAACTC-TTCTTTGGA- E_europaeus300388 AGAG--AA---------GAGATAATA------AAA-CAC-CTCTT----- E_europaeus300389 AGGG--AA---------GAGATTGTG------AAA-CTC-TTCTTTAGA- E_europaeus300428 AGTG--GA---------GAGATTGT-------GGAACTC-TTCTTTGGA- E_europaeus300433 AGGG--AA---------GAGATTAC-------AAAACTC-TTCTTTGGA- E_europaeus300454 AAAG--AA---------GAGACTGC-------AGCA------TTCCATGT E_europaeus300464 AGAG--AA---------GAGATTGT-------AAAACTC-CTCTTTGGA- E_europaeus300544 AGAA--AA---------GAGTTTAT-------AAAGTTC-CTCTTTGTA- E_europaeus300549 AGAG--AA---------GAGATTGT-------AAAACTC-CTCTTTGGA- E_europaeus300591 AGAA--AT---------GTGCTTAC-------AAAACTC-CTCTTTGGA- E_europaeus300701 AGAA--AA---------GAGATTGCA------AAA-CTC-TTCTTTGGA- E_europaeus300721 AGGG--AA---------CAGATTGTAA-----AA--CCC-TTTATTGGA- F_catus300053 AGGG--AT---------GAGACT---------AAAACTC-CTCTCTGGA- H_sapiens300058 AGAG--AA---------GAGACTGG-------AAAGCTC-CTCTTTGGA- H_sapiens300480 AGGG--AA---------GAGACTGTG------AAA-CTC-ATCTTAGAA- L_africana300063 AGAG--AA---------GAGACTGG-------AGAACTC-CTCTTTGGAT L_africana300379 AGAG--AA---------GAGATTCTG-------CAACTC-CTCTTTGGA- L_africana300481 AGAG--CA---------GAGATCAGAG-----AA--CTC-TT---TGGA- M_mulatta300012 AGAG--AA---------GAGACTGG-------AAATCTC-CCCTTTGGA- M_mulatta300195 AGAG--AT---------GAGATTGTA------AAA-CTC-CTCTGTAGA- M_mulatta300271 AGGA--AA---------GAGAC-TGG------AAAACTC-CTCTTTGGA- M_mulatta300286 GGAG--AACAGACAGAAGAGACTGT-------GAAACTC-CTCTTTGGA- M_mulatta300298 AGAG--AA---------GATATTGG-------AACACTC-CTCT--GGAT M_mulatta300376 AGGG--AA---------GAGACTGTG------AAA-CTC-CTCTTAGAA- M_mulatta300391 AAAG--AA---------GAGATTGTA------AA--CTT-CTCTTTGGA- M_mulatta300408 A-----AA---------GACTCTAT-------GAA-CCC-CTCTCTGGA- M_mulatta300476 AGAG--AC---------TATATTGC-------AAAATTC-CTCTTTGGA- M_mulatta300480 AGAG--AA---------GAGATTGT-------AAAGCTC-CTCTTTAGA- M_mulatta300488 AGAG--AA---------GAGAATGT-------GAAGCTC-CTCTTTGGAG M_murinus300225 AGAG--AA---------GAGATTTTT------AAAACTC-TTCTTTGGA- M_murinus300268 AAAG--AA---------GAGATTTC-------AAAACTC-CTATTTGGA- M_murinus300303 AGAG--AA---------GAGATTTTTTAAA--AAAACTC-CTCTTTGGA- M_murinus300410 AGAG--AG---------GAGGCTGC-------ACGTCTC-CTCTCTGCA- M_domestica300024 AAAT--CA---------GAGATT-TA------AAA-CTC-TTTTTTGGA- M_musculus300704 AGAG--AG---------TAAAACT--------ACACCTC-CTCTTTGGA- M_musculus300786 AGAG--GG---------GAAA--ACT------ACACCTT-CTCTTAGGA- M_musculus300787 AGAG--AA---------GAGGCTCC-------CCACTTC-CTCTCTGGA- M_musculus300823 AGAA--AA---------GGCACTGC-------AAACCTC-CTCTT-GAA- M_musculus300924 AGAG--AA---------GAGGCTCC-------ACACCTC-CTCTCTGGA- O_anatinus303218 AGAG--CT---------GAGGCTA--------AAAACTC-TCCTCTGGA- O_cuniculus300002 AGAG--AA---------GAGA--TGC------TCGTTTC-TTCTTTGGA- O_cuniculus300003 AGAG--AA---------GAGATGGTC------GT--TTC-TTCTTTGGA- O_cuniculus300028 AGAG--AA---------GAGACTG------------------CCTGGAG- O_cuniculus300143 AGAG--AA---------GAGAGTGTG------AC--CTC-TTCTTTGGA- O_cuniculus300155 AGAG--AA---------GAGACTG------------------CCTGGAG- O_cuniculus300284 AGGG--AA---------GATATTGGA----------CCC-CGTCTGCAG- O_cuniculus300286 AGAG--AA---------GAGAGTGTG------AC--CTC-TTCTTTGGA- O_cuniculus300362 AGAG--AA---------GAGGTTGTC------AG--CTC-ATCTTTGAA- O_cuniculus300404 AGAG--AA---------GAGATTGTC------AT--CTC-CTCTTTGGA- O_cuniculus300435 AGAG--AA---------GAGATTGTC------AC--CTC-TTCTTTGGT- O_cuniculus300510 AGAG--AA---------GAGATGGTC------GT--TTC-TTCTTTGGA- O_garnettii300026 GGAG--AA---------GAGATTATAA-----AT--CTT-CTCTTTGGG- O_garnettii300054 GGAG--AA---------GAGATTTTT------AAAACTC-CTCTTTGGA- O_garnettii300084 AGGG--AA---------GAGATTATA------AAA-CTC-TTCTTTGGA- O_garnettii300102 AGGG--AA---------GAGATTATA------AAA-CTC-TTCTTTGGA- O_garnettii300162 AGAG--AA---------GAGATTTTT------GAAACTC-CTCTTTGGA- O_garnettii300481 AGAG--AA---------GAGATTTTT------AAAACTC-CTCTTTGGA- P_troglodytes300017 AGGG--AA---------GAGACTGTG------AAA-CTC-ATCTTAGAA- P_troglodytes300069 AGAG--AC---------GAGATTGTA------AAA-CTC-CTCTGTAGA- P_troglodytes300091 AGAG--AA---------AAGAATGT-------AAAGCTC-CTCTTTGGAG P_troglodytes300149 AAAG--AA---------GAGATTGTA------AAA-CTT-CTCTTTGGA- P_troglodytes300155 AGAG--AA---------GAGACTGG-------AAAGCTC-CTCTTTGGA- P_troglodytes300215 AGGA--AA---------GAGAC-TGG------AAAACTC-CTCTTTGGA- P_troglodytes300253 AGAA--AT---------GATATTGC-------AAAATTC-CTCTTTGAA- P_troglodytes300314 AGAG--AAGAGACAGAAGAGACTGT-------GAAACTC-CTCTTTGGA- P_troglodytes300385 AGAG--AA---------GAGATTGT-------AAAGCTC-CTCTTTAGA- P_troglodytes300386 AGAG--AA---------GAGACTGG-------AAAACTC-CTCTCTGGAT P_troglodytes300464 AGAG--AA---------GACTGT---------GAA-CCC-CTCTCTGGA- P_pygmaeus300072 AGAG--AA---------GACTCTCT-------GAA-CCC-CTCTCTGGA- P_pygmaeus300096 AGAG--AA---------GAGAATGT-------AAAGCTC-CTCTTTGGAG P_pygmaeus300135 AGAG--AA---------GAGATTGC-------AAAGCTC-CTCTTTAGA- P_pygmaeus300203 AGAG--AA---------GAGACTGG-------AAAACTC-CTCTCTGGAT P_pygmaeus300271 AAAG--AA---------GAGATTGTA------AAA-CTT-CTCTTTGGA- P_pygmaeus300353 AGAG--AC---------GATATTGC-------AAAATTC-CTCTTTGGA- P_pygmaeus300356 AGAG--AC---------GAGATTGTA------AAA-CTC-CTCTGTATA- P_pygmaeus300367 AGGA--AA---------GAGAC-TGG------AAATCTC-CTTTTTGGA- P_pygmaeus300421 AGAG--AA---------GAGACTGG-------AAAGCTC-CTCTTTGGA- P_pygmaeus300423 AGGG--AA---------GAGACTGTG------AAA-CTC-ATCTTAGAA- R_norvegicus300010 AGAG--AG---------GAAAACT--------GCAC-TC-CTCTTTAGA- R_norvegicus300083 AGAG--AG---------AAAAACT--------GCACCTC-CTCTTTGGA- R_norvegicus300126 CAGA--AG---------AGGC--TTC------ACTCCTC-CTCTTTGAA- R_norvegicus300144 AGAG--AG---------GAAAACT--------ACACCTC-CTCTTTGGA- R_norvegicus300229 AGAG--AG---------GAAAACT--------ACACCTC-CTCTTTGGA- R_norvegicus300252 AGAG--AG---------GGAAAAT--------GCACCTC-CTCTTTGGA- R_norvegicus300361 AGAG--AG---------GAAAACT--------ACACCTC-CTCTTTGGA- R_norvegicus300401 AGAC--AG---------GAAAACT--------ATACGTC-CTCTTTGAA- R_norvegicus300463 AGAG--AG---------GAAA--ACT------GCACCTC-CTCTTTGGA- R_norvegicus300475 AGAG--AG---------GAAAAAT--------GCACCTC-CTCTTTGGA- R_norvegicus300570 AGAG--AG---------GAAA--AAT------GCACCTC-CTCTTTGGA- R_norvegicus300658 AGAG--AG---------GAAA--ACT------GCACTTC-CTCTTTGGA- R_norvegicus300671 AGAG--AG---------GAAAACT--------GCACCTC-CTCTTTGGT- R_norvegicus300809 AGGG--AG---------GAGACTGTA-----------TGCCTCTTTGGA- R_norvegicus300843 AGAG--AG---------GAAAACT--------GCACTTC-CTCTTTGGA- R_norvegicus300901 AGAG--AA---------GAGGCTCC-------ACTCCTC-CTCTTTGGA- R_norvegicus301001 AGAA--AA---------GGGACTGC-------AAACCTC-CTCTT-GGC- R_norvegicus301053 -------G---------GAAAACT--------GCACCTT-CTCTTTGGA- R_norvegicus301063 AGAG--AG---------GAAAACT--------GCACCTC-CTCTTTGGA- S_cerevisiae300022 TGAGGTAATCCATCTTTAAAACCATCGCCGTTAGAGGTTGCTTCTGATAT S_araneus300035 AGAG--AG---------GAGATTGTAC-----AAA-CTC-CTCCTTGGA- S_araneus300052 AAAG--AG---------GAGACTGG-------GACAAAC---TTCTGGAT S_araneus300077 AATC--CA---------AAGGT-TAT------AAAATTT-CTCTTCGGA- S_araneus300080 AGAA--AG---------AGCATTGTAA-----ATC-CTC-TCACTAGGG- S_araneus300189 AGAG--AG---------GAGACTGAA------AAAATTC-CTCCTTAGA- S_araneus300272 AGAA--AA---------GATTATA---------AAACTT-CTCTTTGAG- S_araneus300283 AGGG--AG---------GAAACTGTAA-----AAA-TTC-CTCCTTGGA- S_araneus300302 AGAG--AA---------GAGATTATAA-----AAAGTTC-CTCTTTGGG- S_araneus300366 AGAA--AG---------GAAATTGTAA-----AAG-CTC-CTTCTTGGA- S_araneus300377 AGAG--AG---------GAGATTGTAA-----AA--CTC-CTCTTTGGA- S_araneus300470 AGAG--AA---------GAT--TGT-------AAAATTC-TTCTCTGGA- S_araneus300608 ------CC---------CAGATTGTAA-----AAA-CTT-TTCCTTGCA- S_araneus300689 AGAG--AG---------AAGG----AA-----AAA-----CTCCTTGGA- S_araneus300842 AGAG--AC---------AAG--AGG-------CACAGAT-CCTCTTGGT- S_araneus300881 AGAG--AA---------GAT--CAG-------AAAACTC-TT---TGGA- S_araneus300938 AGGG--AG---------GAGATTGTA------AAA-CTT-CTCTCTGGA- S_araneus301004 AGAG--AA---------GATG-----------AACATTC-CTCTCAGGA- S_tridecemlineatus300039 AGAG--AA---------GAGATTGCAA-----AA--CTC-TTCTTTGGA- S_tridecemlineatus300164 AGAG--AA---------GAGACT-TA------AAAACTC-T---CTATA- S_tridecemlineatus300203 AGAG--AG---------GAGATTGT-------AGAACTC-CTCTTTGGA- S_tridecemlineatus300218 AGAG--AA---------GAGATTTT-------AAGACTC-CTCTTTAGA- T_nigroviridis300074 CATG--AC---------GCCGCCAGT----------CGTCATGGC-GGA- T_belangeri300014 AGAG--AA---------GAGATGAT-------AAA-CTC-CTCTTTGGA- T_belangeri300159 AGAG--AA---------GAGATGAT-------AAA-CTC-CTCTTTGGA- T_belangeri300192 AGAG--AA---------GAGATGAT-------CAG-CTC-TTCTTTGGA- T_belangeri300220 AGAG--AA---------GAGATGAT-------CAA-CTC-CTCTTTGGA- T_belangeri300331 AGAG--AA---------GAGACTGTAA-----AA----C-TCCTCTGGA- T_belangeri300378 ACAG--AA---------GAGATAGT-------AAAACTG-CTCTTGGGA- C_familiaris300038 ---------TCCTGTCTG----GAGTC-ACAGCC---------------- C_familiaris300096 ---------TCCTGTCTG----GAGTC-ACAGCC---------------- C_porcellus300388 ---------TCCTGTCTG----GAGTC-ACAGCT---------------- C_porcellus300424 ---------TCTTGTGTG----AAGTC-ACAGCG---------------- C_porcellus300564 ---------TCCTGTCTG----GAGTC-ACAGCT---------------- C_porcellus300616 ---------TCCTGTCTG----GAGTC-ACAGGT---------------- D_rerio300277 ---------TCCTGTCAC----AAGGC-ACATGT---------------- D_rerio300278 ---------TCCTGTCGG----GAGAA-ACAACT---------------- D_novemcinctus300004 ---------TTCTGTCTG----GAGTC-ACAGCT---------------- D_novemcinctus300069 ---------TT-TGTCTG----AAGTC-ACAGCT---------------- D_novemcinctus300134 ---------TCCTGTCTG----GAGTC-ACAGCT---------------- D_novemcinctus300226 ---------TCCTATCTA----GAATT-GCAGCT---------------- D_novemcinctus300305 ---------TCCCATCTG----GAGTT-ACGGCT---------------- D_novemcinctus300353 C----------CTGTCTG----GAGTC-ACAGCT---------------- D_novemcinctus300356 ---------TCCTGTCTG----GAATC-ATAGCT---------------- D_novemcinctus300614 ---------TCCTGTCTG----GAGTC-ACAGCT---------------- D_novemcinctus300615 ---------TCCTGTCTG----GAGTC-ACAGCT---------------- D_melanogaster300121 TCGCGT---CTCTACCTGAACCTTGGC-ACAAAG---------------- D_melanogaster300122 GCTAGT---CTCTACCTGTAGCCTGGC-ACAGAT---------------- E_telfairi300086 ---------TCCTGTCTG----GAGTC-ACAACT---------------- E_telfairi300115 ---------TCCTGTCTG----GAGTC-ACAACT---------------- E_telfairi300178 ---------TCCTGTCTG----GAGGC-ACAGCT---------------- E_telfairi300184 ---------GCCCATCTG----GAGTC-ACAGCT---------------- E_telfairi300295 ---------TCCTGTCTG----GAGTC-ATAACT---------------- E_telfairi300318 ---------TCCTGCATG----GAACT-ATAGCG---------------- E_telfairi300340 ---------TCCTGTCTG----GAGAC-AGAGCT---------------- E_telfairi300402 ---------TCCTGCCTG----GAGTC-TTAACG---------------- E_telfairi300433 ---------TCCTGTCTG----GAGTC-ACAACT---------------- E_telfairi300475 ---------TCCTGTCTG----GAGTC-ACAAAT---------------- E_telfairi300487 ---------TCCTGTCTG----GAGTC-ACAGCT---------------- E_telfairi300593 ---------TCCTGTCTG----GAGTC-ACAACT---------------- E_telfairi300640 ---------TCCTATCTG----GAGTC-ACAAGT---------------- E_telfairi300673 ---------TCCTGTCTG----GAGTC-ACAACT---------------- E_telfairi300734 ---------TCAAAC--------AACC-A-AACT---------------- E_telfairi300741 ---------GCCTGTCTG----AAGTC-CCAGCT---------------- E_telfairi300764 ---------TCCTGTCTG----GAGTC-ACAACT---------------- E_telfairi300765 ---------TGCTGTCTA----GAGTT-ATAGCT---------------- E_caballus300070 ---------TCCTATCTG----GAGTC-ATAGCT---------------- E_caballus300254 ---------TCCTGTCTG----GAGTC-ACAGCT---------------- E_europaeus300034 ---------TCCTGCCTG----GAAAT----------------------- E_europaeus300117 ---------TCCTGTCTG----GTGTC-ACAATT---------------- E_europaeus300122 ---------TCCTGCCTG----GAAAT----------------------- E_europaeus300204 ---------TCTTGTCTG----AAGTG-ACAGTT---------------- E_europaeus300219 ---------TCCTATCTG----GACCC-AAGAAA---------------- E_europaeus300239 ---------TCCTGTCTG----GAATT-ACAGTT---------------- E_europaeus300272 ---------TTCTGTCTG----GAGTT-GCAGTA---------------- E_europaeus300346 ---------TCCTGTCTG----CAGTC-ACAGTA---------------- E_europaeus300352 ---------ACTTGTCTG----GAGTC-ATAGCT---------------- E_europaeus300375 ---------TCTTGTCTG----AAGTG-ACAGTT---------------- E_europaeus300380 ---------TCCTGTCTG----GAATC-TTAGTA---------------- E_europaeus300383 ---------TCCTGTCTG----GAGTT-ACAGTT---------------- E_europaeus300388 -------------GTCTG----AAGTC-ATAATT---------------- E_europaeus300389 ---------TCTTGTCTG----GAGTC-ACAGTT---------------- E_europaeus300428 ---------TCCTGTCTG----GAGTT-ACAGTT---------------- E_europaeus300433 ---------TCCTGTCTG----GGATC-ATTGTT---------------- E_europaeus300454 ------------TGTCTG----GAGTC-ACAGTT---------------- E_europaeus300464 ---------TCCTGTCTG----GAGTC-ACAGTA---------------- E_europaeus300544 ---------TCCTGTCTG----GAATC-ACAGTT---------------- E_europaeus300549 ---------TCCTGTCTG----GAGTC-ACAGTA---------------- E_europaeus300591 ---------GCCCATCTT----GATTC-ACAGTT---------------- E_europaeus300701 ---------TTCTGTCTG----GAATA-AATGCT---------------- E_europaeus300721 ---------TCCTGTCTG----CAGAT-ACAGTA---------------- F_catus300053 ---------TCCTGTCTG----GAGTC-ACAGCG---------------- H_sapiens300058 ---------TCCTGTCTG----GAGTC-ACAACT---------------- H_sapiens300480 ---------CCTTGTATG----GAGTC-ACAGCT---------------- L_africana300063 C----------CTGTCTG----GAGTC-ACAGCT---------------- L_africana300379 ---------TCCTGTCTG----GAGTC-ACAGTG---------------- L_africana300481 ---------TCCTCTCTG----GAGTT-ACAACT---------------- M_mulatta300012 ---------TCCTGTCTG----GAGTC-ACAGCT---------------- M_mulatta300195 ---------TCCTATCTG----GAGTC-ACAGCT---------------- M_mulatta300271 ---------TCCTGTCTA----TAGTC-GCAGGT---------------- M_mulatta300286 ---------TGCCATCTG----GAGCC-ATAGCA---------------- M_mulatta300298 C----------CTGCCTG----GAGTC-ACAGCT---------------- M_mulatta300376 ---------CCTTGTATG----GAGTC-ATAGCC---------------- M_mulatta300391 ---------TCCTGTCTG----AAGTC-ACAGCT---------------- M_mulatta300408 ---------TCCTGTCTG----GAGTC-ACAGCT---------------- M_mulatta300476 ---------TCATGTCTG----GAGTT-ACAGCT---------------- M_mulatta300480 ---------TCCTTTCTG----GAGTC-ACACCT---------------- M_mulatta300488 GAGCTGGACTCCTGTCTG----GAGTC-ACAGCT---------------- M_murinus300225 ---------TCCTGTCTG----GAGTC-ACAGCT---------------- M_murinus300268 ---------TCCTGTCTG----GAGTC-ACAGCG---------------- M_murinus300303 ---------TCCTGTCTG----GAGTC-ACAGCT---------------- M_murinus300410 ---------TCCTGTCTG----GAGTC-ACAGCT---------------- M_domestica300024 ---------TCCTGTCTG----GAGTT-ACAGTT---------------- M_musculus300704 ---------TCCTGTCTG----GAGTC-ACAAGT---------------- M_musculus300786 ---------TCCTGTCTG----GAGTC-ACAGAT---------------- M_musculus300787 ---------TCCTGTCTG----GAGTC-ACAGCT---------------- M_musculus300823 ---------GCCTTTTTG----AAGCC-ACAGCT---------------- M_musculus300924 ---------TCCTGTCTG----GAGTC-ACAGCT---------------- O_anatinus303218 ---------TCCTGTCGG----GAGGC-ACACTG---------------- O_cuniculus300002 ---------TCCTGTCTG----GAGTC-ACAAAT---------------- O_cuniculus300003 ---------TCCTGTCTG----GAGTC-AACAGA---------------- O_cuniculus300028 ---------TCACAGCT--------------------------------- O_cuniculus300143 ---------TCCTGTCTG----GAGTC-ACAGCT---------------- O_cuniculus300155 ---------TCACAGCT--------------------------------- O_cuniculus300284 ---------TCACAGCT--------------------------------- O_cuniculus300286 ---------TCCTGTCTG----GAGTC-ACAATT---------------- O_cuniculus300362 ---------TCCTGTCTG----GAGTC-ACAGCT---------------- O_cuniculus300404 ---------TCCTGTCTG----GAGAT-ACAGCT---------------- O_cuniculus300435 ---------TCCTGTCGA----GTCAC-AGCT------------------ O_cuniculus300510 ---------TCCTGTCTG----GAGTC-A-CAAAT--------------- O_garnettii300026 ---------TCCTATCTG----GAGAC-ACAAGT---------------- O_garnettii300054 ---------TCCTGTCTG----GAGTC-ACAGCT---------------- O_garnettii300084 ---------TCCTGTCTG----GAGTC-ACAGCT---------------- O_garnettii300102 ---------TCCTGTCTG----GAGTC-ACAGCT---------------- O_garnettii300162 ---------TCCTGTCTG----GAGTC-ACAGCT---------------- O_garnettii300481 ---------TCCTGTCTG----GAGTC-ACAGCT---------------- P_troglodytes300017 ---------CCTTGTATG----GAGTC-ACAGCT---------------- P_troglodytes300069 ---------TCCTGTCTG----GAGTC-ACAGCT---------------- P_troglodytes300091 GAGCTAGACTCCTGTCCG----GAGTC-ACAGCT---------------- P_troglodytes300149 ---------TCCTGTCTG----GAGTC-ACAGCT---------------- P_troglodytes300155 ---------TCCTGTCTG----GAGTC-ACAACT---------------- P_troglodytes300215 ---------TCCTGTCTA----TAGTC-ACAGGT---------------- P_troglodytes300253 ---------TCATGTCTG----GAAAC-ACAGCT---------------- P_troglodytes300314 ---------CCCCATCTG----GAGCC-ACAGCA---------------- P_troglodytes300385 ---------TCCTTTCTG----GAGTC-ACACCT---------------- P_troglodytes300386 C----------CTGCCTG----GAGTC-ACAGCT---------------- P_troglodytes300464 ---------TCCTGTCTG----GAGTC-ACAGCT---------------- P_pygmaeus300072 ---------TCCTGTCTG----GAGTC-ACAGCT---------------- P_pygmaeus300096 GAGCTGGACTCCTGTCTG----GAGTC-ACAGCT---------------- P_pygmaeus300135 ---------TCCTTTCTG----GAGTC-ACACCT---------------- P_pygmaeus300203 C----------CTGCCTG----GAGTC-ACAGCT---------------- P_pygmaeus300271 ---------TCCTGTCTG----GAGTC-ACAGCT---------------- P_pygmaeus300353 ---------TCATGTCTG----GAGTC-ACAGCT---------------- P_pygmaeus300356 ---------TCCTGTCTG----GAGTC-ACAGCT---------------- P_pygmaeus300367 ---------TCCTGTCTA----TAGTC-ACAGGT---------------- P_pygmaeus300421 ---------TCCTGTCTG----GAGTC-ACAACT---------------- P_pygmaeus300423 ---------CCTTGTATG----GAGTC-ACAGCT---------------- R_norvegicus300010 ---------TCCTGTCTG----GAGTC-ACAGAT---------------- R_norvegicus300083 ---------TCCTGTCTG----GAGTC-ACAGAT---------------- R_norvegicus300126 ---------TCCTCTGTCT---GAGTG-ACAGTT---------------- R_norvegicus300144 ---------TCCTGTCTA----GAGTC-ACAGAA---------------- R_norvegicus300229 ---------TCCTGTCTG----GAGTC-ACAGAT---------------- R_norvegicus300252 ---------TCCTGTCTG----GAGTC-ACAGAT---------------- R_norvegicus300361 ---------TCCTGTCTG----GAGTC-ATCAAT---------------- R_norvegicus300401 ---------TCCTGTCTG----GAGCC-ACAGAT---------------- R_norvegicus300463 ---------TCCTGTCTG----GAGTC-ACAAAT---------------- R_norvegicus300475 ---------TCCTGTCTG----GAGTC-ACAGAT---------------- R_norvegicus300570 ---------TCCTGTCTG----GAGTC-ACAGAT---------------- R_norvegicus300658 ---------TCCTGTCTG----GAGTC-ACAGAT---------------- R_norvegicus300671 ---------TCCTGTCTG----GAGTT-ACAGAT---------------- R_norvegicus300809 ---------TCCTGTGTG-----GGAGAAAAAT----------------- R_norvegicus300843 ---------TCCTGTCTGACTGGAGTC-ACAGAT---------------- R_norvegicus300901 ---------TCCTGTCTG----GAGTC-ACAGTT---------------- R_norvegicus301001 ---------TCCTTCT-G----AAGCC-ACAGCT---------------- R_norvegicus301053 ---------TCCTGTCTG----GAGTC-ACAGAT---------------- R_norvegicus301063 ---------TCCTGTCTG----GAGTC-ACAGAT---------------- S_cerevisiae300022 TTTCGGTTAAGCGACCCATGAAATGGTGATGACCTGAGGTATGGAACATC S_araneus300035 ---------TCCTGTCTG----AAGCC-ACAGCT---------------- S_araneus300052 CT---------CTGTCTG----GATTC-ATAGCC---------------- S_araneus300077 ---------TCCTGTCTG----GGGTT-GCAGCA---------------- S_araneus300080 ---------TTCTTTCAG----GAGTC-ATGGCC---------------- S_araneus300189 ---------GCCTGTCTG----GAGTC-ACAGGC---------------- S_araneus300272 ---------TGCTTTCTG----GAGCT-ACAGTG---------------- S_araneus300283 ---------TTCTGTCTG----GAGTC-ACAGCC---------------- S_araneus300302 ---------TACTGGATG----CAGTC-AAGAGG---------------- S_araneus300366 ---------TCCTGTCTG----GAGTT-ACAGCC---------------- S_araneus300377 ---------TTCCGCCTG----GAGAC-AAACTG---------------- S_araneus300470 ---------TCCTGTCTG----GAGTC-AAAGTG---------------- S_araneus300608 ---------TCCTGTTTG----GAGTC-ACAGCC---------------- S_araneus300689 ---------TCCCGTCTG----GATGC-AAGA------------------ S_araneus300842 ---------TCTTGTCTA----GAATT-AGAATA---------------- S_araneus300881 ---------TCCTGTCCA----GAGGC-ACAGAA---------------- S_araneus300938 ---------TCCTGTCTG----GAGCC-ACATCT---------------- S_araneus301004 ---------TTATGTCTG----GAGTC-ACAGTG---------------- S_tridecemlineatus300039 ---------TCCTGCCTG----GAGTT-ACCAAT---------------- S_tridecemlineatus300164 ---------TCCTGTCTG----GAGTT-ACAGTT---------------- S_tridecemlineatus300203 ---------TCCTGGCCG----GTGTC-ACAGCT---------------- S_tridecemlineatus300218 ---------TCCTCTCTG----GTGTT-ATTATA---------------- T_nigroviridis300074 ---------TCCTGTCGG----GAGAA-ACAAAC---------------- T_belangeri300014 ---------TCCTGTCTG----GAGTCCACACCT---------------- T_belangeri300159 ---------TCCTGTCTG----GAGTC-ACAACT---------------- T_belangeri300192 ---------TCCTGTCTG----GAGTC-ACAACT---------------- T_belangeri300220 ---------TCCTGTCTG----GAGTC-ACAGCT---------------- T_belangeri300331 ---------ACCTGTCTG----GAGTC-ACAACT---------------- T_belangeri300378 ---------TCCTGTCTG----GAGTC-AGAGCT---------------- C_familiaris300038 - C_familiaris300096 - C_porcellus300388 - C_porcellus300424 - C_porcellus300564 - C_porcellus300616 - D_rerio300277 - D_rerio300278 - D_novemcinctus300004 - D_novemcinctus300069 - D_novemcinctus300134 - D_novemcinctus300226 - D_novemcinctus300305 - D_novemcinctus300353 - D_novemcinctus300356 - D_novemcinctus300614 - D_novemcinctus300615 - D_melanogaster300121 - D_melanogaster300122 - E_telfairi300086 - E_telfairi300115 - E_telfairi300178 - E_telfairi300184 - E_telfairi300295 - E_telfairi300318 - E_telfairi300340 - E_telfairi300402 - E_telfairi300433 - E_telfairi300475 - E_telfairi300487 - E_telfairi300593 - E_telfairi300640 - E_telfairi300673 - E_telfairi300734 - E_telfairi300741 - E_telfairi300764 - E_telfairi300765 - E_caballus300070 - E_caballus300254 - E_europaeus300034 - E_europaeus300117 - E_europaeus300122 - E_europaeus300204 - E_europaeus300219 - E_europaeus300239 - E_europaeus300272 - E_europaeus300346 - E_europaeus300352 - E_europaeus300375 - E_europaeus300380 - E_europaeus300383 - E_europaeus300388 - E_europaeus300389 - E_europaeus300428 - E_europaeus300433 - E_europaeus300454 - E_europaeus300464 - E_europaeus300544 - E_europaeus300549 - E_europaeus300591 - E_europaeus300701 - E_europaeus300721 - F_catus300053 - H_sapiens300058 - H_sapiens300480 - L_africana300063 - L_africana300379 - L_africana300481 - M_mulatta300012 - M_mulatta300195 - M_mulatta300271 - M_mulatta300286 - M_mulatta300298 - M_mulatta300376 - M_mulatta300391 - M_mulatta300408 - M_mulatta300476 - M_mulatta300480 - M_mulatta300488 - M_murinus300225 - M_murinus300268 - M_murinus300303 - M_murinus300410 - M_domestica300024 - M_musculus300704 - M_musculus300786 - M_musculus300787 - M_musculus300823 - M_musculus300924 - O_anatinus303218 - O_cuniculus300002 - O_cuniculus300003 - O_cuniculus300028 - O_cuniculus300143 - O_cuniculus300155 - O_cuniculus300284 - O_cuniculus300286 - O_cuniculus300362 - O_cuniculus300404 - O_cuniculus300435 - O_cuniculus300510 - O_garnettii300026 - O_garnettii300054 - O_garnettii300084 - O_garnettii300102 - O_garnettii300162 - O_garnettii300481 - P_troglodytes300017 - P_troglodytes300069 - P_troglodytes300091 - P_troglodytes300149 - P_troglodytes300155 - P_troglodytes300215 - P_troglodytes300253 - P_troglodytes300314 - P_troglodytes300385 - P_troglodytes300386 - P_troglodytes300464 - P_pygmaeus300072 - P_pygmaeus300096 - P_pygmaeus300135 - P_pygmaeus300203 - P_pygmaeus300271 - P_pygmaeus300353 - P_pygmaeus300356 - P_pygmaeus300367 - P_pygmaeus300421 - P_pygmaeus300423 - R_norvegicus300010 - R_norvegicus300083 - R_norvegicus300126 - R_norvegicus300144 - R_norvegicus300229 - R_norvegicus300252 - R_norvegicus300361 - R_norvegicus300401 - R_norvegicus300463 - R_norvegicus300475 - R_norvegicus300570 - R_norvegicus300658 - R_norvegicus300671 - R_norvegicus300809 - R_norvegicus300843 - R_norvegicus300901 - R_norvegicus301001 - R_norvegicus301053 - R_norvegicus301063 - S_cerevisiae300022 T S_araneus300035 - S_araneus300052 - S_araneus300077 - S_araneus300080 - S_araneus300189 - S_araneus300272 - S_araneus300283 - S_araneus300302 - S_araneus300366 - S_araneus300377 - S_araneus300470 - S_araneus300608 - S_araneus300689 - S_araneus300842 - S_araneus300881 - S_araneus300938 - S_araneus301004 - S_tridecemlineatus300039 - S_tridecemlineatus300164 - S_tridecemlineatus300203 - S_tridecemlineatus300218 - T_nigroviridis300074 - T_belangeri300014 - T_belangeri300159 - T_belangeri300192 - T_belangeri300220 - T_belangeri300331 - T_belangeri300378 -

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved