snOPY snoRNA Orthological Gene Database

Family: SNORA26

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300038 -------------------------------------------------- C_familiaris300096 -------------------------------------------------- C_porcellus300388 -------------------------------------------------- C_porcellus300424 -------------------------------------------------- C_porcellus300564 -------------------------------------------------- C_porcellus300616 -------------------------------------------------- D_rerio300277 -------------------------------------------------- D_rerio300278 -------------------------------------------------- D_novemcinctus300004 -------------------------------------------------- D_novemcinctus300069 -------------------------------------------------- D_novemcinctus300134 -------------------------------------------------- D_novemcinctus300226 -------------------------------------------------- D_novemcinctus300305 -------------------------------------------------- D_novemcinctus300353 -------------------------------------------------- D_novemcinctus300356 -------------------------------------------------- D_novemcinctus300614 -------------------------------------------------- D_novemcinctus300615 -------------------------------------------------- D_melanogaster300121 -------------------------------------------------- D_melanogaster300122 -------------------------------------------------- E_telfairi300086 -------------------------------------------------- E_telfairi300115 -------------------------------------------------- E_telfairi300178 -------------------------------------------------- E_telfairi300184 -------------------------------------------------- E_telfairi300295 -------------------------------------------------- E_telfairi300318 -------------------------------------------------- E_telfairi300340 -------------------------------------------------- E_telfairi300402 -------------------------------------------------- E_telfairi300433 -------------------------------------------------- E_telfairi300475 -------------------------------------------------- E_telfairi300487 -------------------------------------------------- E_telfairi300593 -------------------------------------------------- E_telfairi300640 -------------------------------------------------- E_telfairi300673 -------------------------------------------------- E_telfairi300734 -------------------------------------------------- E_telfairi300741 -------------------------------------------------- E_telfairi300764 -------------------------------------------------- E_telfairi300765 -------------------------------------------------- E_caballus300070 -------------------------------------------------- E_caballus300254 -------------------------------------------------- E_europaeus300034 -------------------------------------------------- E_europaeus300117 -------------------------------------------------- E_europaeus300122 -------------------------------------------------- E_europaeus300204 -------------------------------------------------- E_europaeus300219 -------------------------------------------------- E_europaeus300239 -------------------------------------------------- E_europaeus300272 -------------------------------------------------- E_europaeus300346 -------------------------------------------------- E_europaeus300352 -------------------------------------------------- E_europaeus300375 -------------------------------------------------- E_europaeus300380 -------------------------------------------------- E_europaeus300383 -------------------------------------------------- E_europaeus300388 -------------------------------------------------- E_europaeus300389 -------------------------------------------------- E_europaeus300428 -------------------------------------------------- E_europaeus300433 -------------------------------------------------- E_europaeus300454 -------------------------------------------------- E_europaeus300464 -------------------------------------------------- E_europaeus300544 -------------------------------------------------- E_europaeus300549 -------------------------------------------------- E_europaeus300591 -------------------------------------------------- E_europaeus300701 -------------------------------------------------- E_europaeus300721 -------------------------------------------------- F_catus300053 -------------------------------------------------- H_sapiens300058 -------------------------------------------------- H_sapiens300480 -------------------------------------------------- L_africana300063 -------------------------------------------------- L_africana300379 -------------------------------------------------- L_africana300481 -------------------------------------------------- M_mulatta300012 -------------------------------------------------- M_mulatta300195 -------------------------------------------------- M_mulatta300271 -------------------------------------------------- M_mulatta300286 -------------------------------------------------- M_mulatta300298 -------------------------------------------------- M_mulatta300376 -------------------------------------------------- M_mulatta300391 -------------------------------------------------- M_mulatta300408 -------------------------------------------------- M_mulatta300476 -------------------------------------------------- M_mulatta300480 -------------------------------------------------- M_mulatta300488 -------------------------------------------------- M_murinus300225 -------------------------------------------------- M_murinus300268 -------------------------------------------------- M_murinus300303 -------------------------------------------------- M_murinus300410 -------------------------------------------------- M_domestica300024 -------------------------------------------------- M_musculus300704 -------------------------------------------------- M_musculus300786 -------------------------------------------------- M_musculus300787 -------------------------------------------------- M_musculus300823 -------------------------------------------------- M_musculus300924 -------------------------------------------------- M_lucifugus300855 -------------------------------------------------- M_lucifugus300856 -------------------------------------------------- M_lucifugus300027 -------------------------------------------------- M_lucifugus300035 -------------------------------------------------- M_lucifugus300101 -------------------------------------------------- M_lucifugus300177 -------------------------------------------------- M_lucifugus300246 -------------------------------------------------- M_lucifugus300495 -------------------------------------------------- M_lucifugus300537 -------------------------------------------------- M_lucifugus300624 -------------------------------------------------- M_lucifugus300690 -------------------------------------------------- M_lucifugus300708 -------------------------------------------------- O_anatinus303218 -------------------------------------------------- O_cuniculus300003 -------------------------------------------------- O_cuniculus300028 -------------------------------------------------- O_cuniculus300143 -------------------------------------------------- O_cuniculus300155 -------------------------------------------------- O_cuniculus300284 -------------------------------------------------- O_cuniculus300286 -------------------------------------------------- O_cuniculus300362 -------------------------------------------------- O_cuniculus300404 -------------------------------------------------- O_cuniculus300435 -------------------------------------------------- O_cuniculus300510 -------------------------------------------------- O_cuniculus300002 -------------------------------------------------- O_garnettii300102 -------------------------------------------------- O_garnettii300481 -------------------------------------------------- O_garnettii300026 -------------------------------------------------- O_garnettii300162 -------------------------------------------------- O_garnettii300084 -------------------------------------------------- O_garnettii300054 -------------------------------------------------- P_troglodytes300253 -------------------------------------------------- P_troglodytes300314 -------------------------------------------------- P_troglodytes300385 -------------------------------------------------- P_troglodytes300386 -------------------------------------------------- P_troglodytes300464 -------------------------------------------------- P_troglodytes300017 -------------------------------------------------- P_troglodytes300091 -------------------------------------------------- P_troglodytes300069 -------------------------------------------------- P_troglodytes300149 -------------------------------------------------- P_troglodytes300155 -------------------------------------------------- P_troglodytes300215 -------------------------------------------------- P_pygmaeus300271 -------------------------------------------------- P_pygmaeus300353 -------------------------------------------------- P_pygmaeus300356 -------------------------------------------------- P_pygmaeus300367 -------------------------------------------------- P_pygmaeus300421 -------------------------------------------------- P_pygmaeus300423 -------------------------------------------------- P_pygmaeus300072 -------------------------------------------------- P_pygmaeus300096 -------------------------------------------------- P_pygmaeus300135 -------------------------------------------------- P_pygmaeus300203 -------------------------------------------------- R_norvegicus300671 -------------------------------------------------- R_norvegicus300463 -------------------------------------------------- R_norvegicus300843 -------------------------------------------------- R_norvegicus300901 -------------------------------------------------- R_norvegicus301001 -------------------------------------------------- R_norvegicus301053 -------------------------------------------------- R_norvegicus301063 -------------------------------------------------- R_norvegicus300809 -------------------------------------------------- R_norvegicus300401 -------------------------------------------------- R_norvegicus300361 -------------------------------------------------- R_norvegicus300252 -------------------------------------------------- R_norvegicus300229 -------------------------------------------------- R_norvegicus300126 -------------------------------------------------- R_norvegicus300144 -------------------------------------------------- R_norvegicus300083 -------------------------------------------------- R_norvegicus300010 -------------------------------------------------- R_norvegicus300475 -------------------------------------------------- R_norvegicus300570 -------------------------------------------------- R_norvegicus300658 -------------------------------------------------- S_cerevisiae300022 ATAACAATTTGTGATGCTTTAGGGAGCCTATTGTTTGATGGTTTATAGGA S_araneus300689 -------------------------------------------------- S_araneus300842 -------------------------------------------------- S_araneus300881 -------------------------------------------------- S_araneus300938 -------------------------------------------------- S_araneus300035 -------------------------------------------------- S_araneus300052 -------------------------------------------------- S_araneus300077 -------------------------------------------------- S_araneus300080 -------------------------------------------------- S_araneus301004 -------------------------------------------------- S_araneus300189 -------------------------------------------------- S_araneus300272 -------------------------------------------------- S_araneus300283 -------------------------------------------------- S_araneus300302 -------------------------------------------------- S_araneus300366 -------------------------------------------------- S_araneus300377 -------------------------------------------------- S_araneus300470 -------------------------------------------------- S_araneus300608 -------------------------------------------------- S_tridecemlineatus300203 -------------------------------------------------- S_tridecemlineatus300218 -------------------------------------------------- S_tridecemlineatus300039 -------------------------------------------------- S_tridecemlineatus300164 -------------------------------------------------- T_nigroviridis300074 -------------------------------------------------- T_belangeri300014 -------------------------------------------------- T_belangeri300159 -------------------------------------------------- T_belangeri300192 -------------------------------------------------- T_belangeri300220 -------------------------------------------------- T_belangeri300331 -------------------------------------------------- T_belangeri300378 -------------------------------------------------- C_familiaris300038 -------------------------------------------------- C_familiaris300096 -------------------------------------------------- C_porcellus300388 -------------------------------------------------- C_porcellus300424 -------------------------------------------------- C_porcellus300564 -------------------------------------------------- C_porcellus300616 -------------------------------------------------- D_rerio300277 -------------------------------------------------- D_rerio300278 -------------------------------------------------- D_novemcinctus300004 -------------------------------------------------- D_novemcinctus300069 -------------------------------------------------- D_novemcinctus300134 -------------------------------------------------- D_novemcinctus300226 -------------------------------------------------- D_novemcinctus300305 -------------------------------------------------- D_novemcinctus300353 -------------------------------------------------- D_novemcinctus300356 -------------------------------------------------- D_novemcinctus300614 -------------------------------------------------- D_novemcinctus300615 -------------------------------------------------- D_melanogaster300121 -------------------------------------------------- D_melanogaster300122 -------------------------------------------------- E_telfairi300086 -------------------------------------------------- E_telfairi300115 -------------------------------------------------- E_telfairi300178 -------------------------------------------------- E_telfairi300184 -------------------------------------------------- E_telfairi300295 -------------------------------------------------- E_telfairi300318 -------------------------------------------------- E_telfairi300340 -------------------------------------------------- E_telfairi300402 -------------------------------------------------- E_telfairi300433 -------------------------------------------------- E_telfairi300475 -------------------------------------------------- E_telfairi300487 -------------------------------------------------- E_telfairi300593 -------------------------------------------------- E_telfairi300640 -------------------------------------------------- E_telfairi300673 -------------------------------------------------- E_telfairi300734 -------------------------------------------------- E_telfairi300741 -------------------------------------------------- E_telfairi300764 -------------------------------------------------- E_telfairi300765 -------------------------------------------------- E_caballus300070 -------------------------------------------------- E_caballus300254 -------------------------------------------------- E_europaeus300034 -------------------------------------------------- E_europaeus300117 -------------------------------------------------- E_europaeus300122 -------------------------------------------------- E_europaeus300204 -------------------------------------------------- E_europaeus300219 -------------------------------------------------- E_europaeus300239 -------------------------------------------------- E_europaeus300272 -------------------------------------------------- E_europaeus300346 -------------------------------------------------- E_europaeus300352 -------------------------------------------------- E_europaeus300375 -------------------------------------------------- E_europaeus300380 -------------------------------------------------- E_europaeus300383 -------------------------------------------------- E_europaeus300388 -------------------------------------------------- E_europaeus300389 -------------------------------------------------- E_europaeus300428 -------------------------------------------------- E_europaeus300433 -------------------------------------------------- E_europaeus300454 -------------------------------------------------- E_europaeus300464 -------------------------------------------------- E_europaeus300544 -------------------------------------------------- E_europaeus300549 -------------------------------------------------- E_europaeus300591 -------------------------------------------------- E_europaeus300701 -------------------------------------------------- E_europaeus300721 -------------------------------------------------- F_catus300053 -------------------------------------------------- H_sapiens300058 -------------------------------------------------- H_sapiens300480 -------------------------------------------------- L_africana300063 -------------------------------------------------- L_africana300379 -------------------------------------------------- L_africana300481 -------------------------------------------------- M_mulatta300012 -------------------------------------------------- M_mulatta300195 -------------------------------------------------- M_mulatta300271 -------------------------------------------------- M_mulatta300286 -------------------------------------------------- M_mulatta300298 -------------------------------------------------- M_mulatta300376 -------------------------------------------------- M_mulatta300391 -------------------------------------------------- M_mulatta300408 -------------------------------------------------- M_mulatta300476 -------------------------------------------------- M_mulatta300480 -------------------------------------------------- M_mulatta300488 -------------------------------------------------- M_murinus300225 -------------------------------------------------- M_murinus300268 -------------------------------------------------- M_murinus300303 -------------------------------------------------- M_murinus300410 -------------------------------------------------- M_domestica300024 -------------------------------------------------- M_musculus300704 -------------------------------------------------- M_musculus300786 -------------------------------------------------- M_musculus300787 -------------------------------------------------- M_musculus300823 -------------------------------------------------- M_musculus300924 -------------------------------------------------- M_lucifugus300855 -------------------------------------------------- M_lucifugus300856 -------------------------------------------------- M_lucifugus300027 -------------------------------------------------- M_lucifugus300035 -------------------------------------------------- M_lucifugus300101 -------------------------------------------------- M_lucifugus300177 -------------------------------------------------- M_lucifugus300246 -------------------------------------------------- M_lucifugus300495 -------------------------------------------------- M_lucifugus300537 -------------------------------------------------- M_lucifugus300624 -------------------------------------------------- M_lucifugus300690 -------------------------------------------------- M_lucifugus300708 -------------------------------------------------- O_anatinus303218 -------------------------------------------------- O_cuniculus300003 -------------------------------------------------- O_cuniculus300028 -------------------------------------------------- O_cuniculus300143 -------------------------------------------------- O_cuniculus300155 -------------------------------------------------- O_cuniculus300284 -------------------------------------------------- O_cuniculus300286 -------------------------------------------------- O_cuniculus300362 -------------------------------------------------- O_cuniculus300404 -------------------------------------------------- O_cuniculus300435 -------------------------------------------------- O_cuniculus300510 -------------------------------------------------- O_cuniculus300002 -------------------------------------------------- O_garnettii300102 -------------------------------------------------- O_garnettii300481 -------------------------------------------------- O_garnettii300026 -------------------------------------------------- O_garnettii300162 -------------------------------------------------- O_garnettii300084 -------------------------------------------------- O_garnettii300054 -------------------------------------------------- P_troglodytes300253 -------------------------------------------------- P_troglodytes300314 -------------------------------------------------- P_troglodytes300385 -------------------------------------------------- P_troglodytes300386 -------------------------------------------------- P_troglodytes300464 -------------------------------------------------- P_troglodytes300017 -------------------------------------------------- P_troglodytes300091 -------------------------------------------------- P_troglodytes300069 -------------------------------------------------- P_troglodytes300149 -------------------------------------------------- P_troglodytes300155 -------------------------------------------------- P_troglodytes300215 -------------------------------------------------- P_pygmaeus300271 -------------------------------------------------- P_pygmaeus300353 -------------------------------------------------- P_pygmaeus300356 -------------------------------------------------- P_pygmaeus300367 -------------------------------------------------- P_pygmaeus300421 -------------------------------------------------- P_pygmaeus300423 -------------------------------------------------- P_pygmaeus300072 -------------------------------------------------- P_pygmaeus300096 -------------------------------------------------- P_pygmaeus300135 -------------------------------------------------- P_pygmaeus300203 -------------------------------------------------- R_norvegicus300671 -------------------------------------------------- R_norvegicus300463 -------------------------------------------------- R_norvegicus300843 -------------------------------------------------- R_norvegicus300901 -------------------------------------------------- R_norvegicus301001 -------------------------------------------------- R_norvegicus301053 -------------------------------------------------- R_norvegicus301063 -------------------------------------------------- R_norvegicus300809 -------------------------------------------------- R_norvegicus300401 -------------------------------------------------- R_norvegicus300361 -------------------------------------------------- R_norvegicus300252 -------------------------------------------------- R_norvegicus300229 -------------------------------------------------- R_norvegicus300126 -------------------------------------------------- R_norvegicus300144 -------------------------------------------------- R_norvegicus300083 -------------------------------------------------- R_norvegicus300010 -------------------------------------------------- R_norvegicus300475 -------------------------------------------------- R_norvegicus300570 -------------------------------------------------- R_norvegicus300658 -------------------------------------------------- S_cerevisiae300022 GCCGGATTTGTCTTTTTGACTAATTTTCAACCTATTCTTACTTCCAAAAC S_araneus300689 -------------------------------------------------- S_araneus300842 -------------------------------------------------- S_araneus300881 -------------------------------------------------- S_araneus300938 -------------------------------------------------- S_araneus300035 -------------------------------------------------- S_araneus300052 -------------------------------------------------- S_araneus300077 -------------------------------------------------- S_araneus300080 -------------------------------------------------- S_araneus301004 -------------------------------------------------- S_araneus300189 -------------------------------------------------- S_araneus300272 -------------------------------------------------- S_araneus300283 -------------------------------------------------- S_araneus300302 -------------------------------------------------- S_araneus300366 -------------------------------------------------- S_araneus300377 -------------------------------------------------- S_araneus300470 -------------------------------------------------- S_araneus300608 -------------------------------------------------- S_tridecemlineatus300203 -------------------------------------------------- S_tridecemlineatus300218 -------------------------------------------------- S_tridecemlineatus300039 -------------------------------------------------- S_tridecemlineatus300164 -------------------------------------------------- T_nigroviridis300074 -------------------------------------------------- T_belangeri300014 -------------------------------------------------- T_belangeri300159 -------------------------------------------------- T_belangeri300192 -------------------------------------------------- T_belangeri300220 -------------------------------------------------- T_belangeri300331 -------------------------------------------------- T_belangeri300378 -------------------------------------------------- C_familiaris300038 ------------------------------GTGCGCTCCCAAGG-CTGCC C_familiaris300096 ------------------------------GTGCGCTCCCAAGG-CTGCC C_porcellus300388 ------------------------------GTGCCCTTTTAAGG-TTGAT C_porcellus300424 ------------------------------GTGCCCCTTTAACA-CTGAC C_porcellus300564 ------------------------------GTGCCCTTTTAAGG-TTGAT C_porcellus300616 ------------------------------TTGCCCTTTTAAGG-TTGAC D_rerio300277 ------------------------------TTGCCCACTGGAGGCTGTCT D_rerio300278 -----------------------------TTGCACATTCAAGTC-CTTCT D_novemcinctus300004 ------------------------------CTGCGCTTTTAAGG-TTGAT D_novemcinctus300069 ------------------------------GTGCCCTTTTAAGG-TTGAT D_novemcinctus300134 -------------------------------TAGCACTTGAAAC-TAGCC D_novemcinctus300226 ------------------------------GTGCCCTTTTAAGA-TTAAT D_novemcinctus300305 -------------------------------------------------- D_novemcinctus300353 ------------------------------GTGCCCTTTTAAGA-TTGAT D_novemcinctus300356 ------------------------------GTGCCCTTTTAAGG-TTGAC D_novemcinctus300614 ------------------------------GTGCCCTTTTAAGG-TTGAT D_novemcinctus300615 ------------------------------GTGGCCTTTTAAGA-TTGAT D_melanogaster300121 --------------------------ATGGGCACAGTTTTAAACTAGGTG D_melanogaster300122 ----------------------------CGGCATGCCAACTAAAAAGGCG E_telfairi300086 ------------------------------GTGCCCTTGTAAGG-TTGTT E_telfairi300115 ------------------------------GTGCCCTTTTAAGG-TTGCT E_telfairi300178 ------------------------------GTGCCCTGGCA-GG-TTGCT E_telfairi300184 ------------------------------GTGCCCCTTTAAGG-TTGCT E_telfairi300295 ------------------------------GTGCCCTTTTAAGG-TTGCT E_telfairi300318 -----------------------------TTAGTGCTAAAACTT-CAGAA E_telfairi300340 --------------------------------------GTACGA-AAACC E_telfairi300402 ------------------------------GTGCCCTTTGAAGT-TTGCT E_telfairi300433 ------------------------------GTGCCCTTTTAAGG-TTGCT E_telfairi300475 ------------------------------GTGTCCTTCTAAGG-TTGCT E_telfairi300487 ------------------------------GTGCCCTTTTAAGG-TTGCT E_telfairi300593 ----------------------------------------------GAAA E_telfairi300640 ------------------------------GTGCCCTTTTAAGG-TTGCT E_telfairi300673 ------------------------------GTGCCCTTTTAAGG-TTGCT E_telfairi300734 ------------------------------GTGCCCTATTAAGG-TTGCT E_telfairi300741 ------------------------------GTGCCCTTTTAAGG-TTGCT E_telfairi300764 ------------------------------GTGCCCTTTTAAGG-TTGCT E_telfairi300765 ------------------------------TAGGCCTTTTTAGG-CTGGT E_caballus300070 ------------------------------GTGCCCTTTTAAGG-TTGAC E_caballus300254 ------------------------------GTGCCCTTTTAAGG-TTGAC E_europaeus300034 ------------------------------GTGCCTTT--AAGG-TTGAT E_europaeus300117 ------------------------------ATGCCTTATTAAAG-ACTGT E_europaeus300122 ------------------------------GTGCCCTTTAAAGG-TTGAT E_europaeus300204 ------------------------------GTACACTTTTAAGG-CTGAC E_europaeus300219 ------------------------------TTGCCCTTTTAAAG-TTAAT E_europaeus300239 ------------------------------------------GA-GGCTT E_europaeus300272 ---------------------------TTACCATTGTTGATTCA-CTGAT E_europaeus300346 ------------------------------GTGCTCTTTTAAGA-TTGAC E_europaeus300352 ---------------------------------CTGCCCGACTC-CCTAT E_europaeus300375 ------------------------------GTACACTTTTAAGG-CTGAC E_europaeus300380 ----------------------------ATACCCTTTCTATTGG-TTGAC E_europaeus300383 ------------------------------TTATCCTTACCTAA-AGACT E_europaeus300388 ------------------------------GTACTCTTTTAAGG-CTGGT E_europaeus300389 ------------------------------GTGCTCTTTTAATG------ E_europaeus300428 ------------------------------ATGCCCTTTTAAGG-CTT-- E_europaeus300433 ------------------------------GTGACCTTTGAAGG-TTAAT E_europaeus300454 --------------------------------GTGCCCCTAAAT-TTAAT E_europaeus300464 ------------------------------GTGCCCTTCTTAGGGTTGAT E_europaeus300544 ------------------------------GTGCCCTTTTGAGG-TTGAT E_europaeus300549 ------------------------------GTGCCCTTCTTAGGGTTGAT E_europaeus300591 --------------------------------GCAAATTTTTAT-TTGAC E_europaeus300701 ----------------------------TTTTGTTTTGAAATAT-GAAAA E_europaeus300721 ----------------------------------TTTAAGGTTG-A---T F_catus300053 ------------------------------GTGCCCTTTTAAGG-TTGAC H_sapiens300058 ------------------------------GTGCCCTTTTAAGG-TTGAC H_sapiens300480 ------------------------------GTTCCCTTTTAAGG-CTGAC L_africana300063 ------------------------------GTGCCCTTTTAAGG-TTGCT L_africana300379 ------------------------------GTGC-CTTGTAAGG-CTGAT L_africana300481 ------------------------------GTGCCATTTCAAGG-TTGAC M_mulatta300012 ------------------------------GTGCCCTTTTAAGG-TTGAC M_mulatta300195 ----------------------------TGAACTTTAAAATGCA-AGTTC M_mulatta300271 -------------------------------AAAAGACAAACAA-CCAAA M_mulatta300286 ------------------------------GTGCCCTTTTAAGG-TAGAC M_mulatta300298 ------------------------------ATGCCCTTTTAAGG-TTGAT M_mulatta300376 ------------------------------GTTCCTTTTTAAGG-CTGGC M_mulatta300391 ------------------------------GGGCCCCGTTAAGG-CTGAT M_mulatta300408 ----------------------------------GTGCCTAAGG-TTAAC M_mulatta300476 ------------------------------GTGCCCTTTTAAGG-TTGAC M_mulatta300480 ------------------------------GTGCCCTTTCAAGG-TCGAC M_mulatta300488 -----------------------------GTGCCGCTTTTAAGG-TTAAC M_murinus300225 ------------------------------GTGTCCTTTTAAAG-TTGAC M_murinus300268 ------------------------------GTGTCATTTTAAAA-TTGTT M_murinus300303 ------------------------------GTGCCCTTTTAAAG-TTGAC M_murinus300410 ------------------------------GCGCCCTTTTAAGG-TCGA- M_domestica300024 -------------------------------TAGCCTGTTAAAG-CTG-- M_musculus300704 ------------------------------GTGCCTTTTTAAGG-TTGTC M_musculus300786 --------------------------------------AAGACA-CACAG M_musculus300787 ------------------------------GTGCCCTTTTAAGG-TTGAT M_musculus300823 ------------------------------GTGCCCTTTCTAGG-CTAAC M_musculus300924 ------------------------------GTGCCCTTTTAAGG-TTGAC M_lucifugus300855 ------------------------------GTGCCCTTTTAAGG-CTGAC M_lucifugus300856 ------------------------------GTGCCCTTTTAAGG-TTGAC M_lucifugus300027 ------------------------------GTGCCCTTTTAAGG-TTGAC M_lucifugus300035 ------------------------------GTGCCCTTTTAAGG-TTGAC M_lucifugus300101 ------------------------------GTGCCCTTTTAAGG-CTGAC M_lucifugus300177 ------------------------------GTGCCCTTTTAAGG-TTGAC M_lucifugus300246 ------------------------------GTGCCCTTTTAAGG-TTGAC M_lucifugus300495 ------------------------------ATATCCTGTTATAC-ATAAT M_lucifugus300537 ---------------------------ATACACCCAGAATGTAT-AAAGA M_lucifugus300624 ------------------------------GTGCCCTTTTAAGG-TTGAC M_lucifugus300690 -------------------------------ATAACTGAGAAAA-CATAC M_lucifugus300708 --------------------------------GAGCTCAAGAAA-TG-AC O_anatinus303218 ------------------------------GTGCTCCCTTAGAG-CTGCT O_cuniculus300003 ------------------------------GTGTCCTTTTAGAG-CTGAC O_cuniculus300028 ------------------------------TTTCCCTTTTAGAG-CTGAG O_cuniculus300143 ------------------------------GTGCCCTTTTACAG-CTAAC O_cuniculus300155 ------------------------------TTTCCCTTTTAGAG-CTGAG O_cuniculus300284 ---------------------------GTGCCCTTTTGTTAGAG-CTGAC O_cuniculus300286 ------------------------------GTGCCCTTTTACAG-CTAAC O_cuniculus300362 ------------------------------GTGCCCTTTTAGAG-CTGAC O_cuniculus300404 ------------------------------GTGCCCTTTTAAAA-CTGAC O_cuniculus300435 ------------------------------GTGACCTTTTAGAA-CTGAT O_cuniculus300510 ------------------------------GTGCCCTTTCAGAG-CTGAC O_cuniculus300002 ------------------------------GCCCTATAACAAAT-AGAAA O_garnettii300102 ------------------------------GTGCCCTTTTAAGG-CTGAT O_garnettii300481 --------------------------TCACCCTTTCCTGTCCCT-TACAT O_garnettii300026 ------------------------------GTGCCCTTTTAGGG-CTGAT O_garnettii300162 ------------------------------GTGGCCTTTTAAGG-TTGAT O_garnettii300084 ------------------------------GTGCCCTTTTAAGG-CTGAT O_garnettii300054 ------------------------------TTATTCTTTTAAGG-TTGAT P_troglodytes300253 ------------------------------GTGTCCTTTTAAGG-TTGAC P_troglodytes300314 ------------------------------GTGCCCTTTTAAGG-TAGAC P_troglodytes300385 ------------------------------GTGCCCTTTTAAGG-TTGAC P_troglodytes300386 ------------------------------ATGCCCTTTTAAGG-TTGAT P_troglodytes300464 ----------------------------------GTGCCTAAGG-TTAAC P_troglodytes300017 ------------------------------GTTCCCTTTTAAGG-CTGAC P_troglodytes300091 ------------------------------TGCCCCTTTTAAGG-TTGAC P_troglodytes300069 ----------------------------TGAACTTTAAAATGCA-AGTTC P_troglodytes300149 ------------------------------GCACCCCTTTAAGG-CTGAT P_troglodytes300155 ------------------------------GTGCCCTTTTAAGG-TTGAC P_troglodytes300215 -----------------------------TTGCCGCCCACACAA-CCAAA P_pygmaeus300271 ------------------------------------------AT-GACCC P_pygmaeus300353 ------------------------------GTGTCCTTTTAAGG-TTGAC P_pygmaeus300356 ----------------------------TGAACTTTAAAATGCA-AGTTC P_pygmaeus300367 -----------------------------TTGCCGCCCACACAA-CCAAA P_pygmaeus300421 ------------------------------GTGCCCTTTTAAGG-TTGAC P_pygmaeus300423 ------------------------------GTTCCCTTTTAAGG-CTGAC P_pygmaeus300072 ----------------------------------GTGCCTAAGG-TTAAC P_pygmaeus300096 ------------------------------TGCCCCTTTTAAGG-TTGAC P_pygmaeus300135 ------------------------------GTGCCCTTTTAAGG-TTGAC P_pygmaeus300203 ------------------------------GTGCCCTTTTACGG-TTGAT R_norvegicus300671 ------------------------------GTGCCCTTTTAAGG-TTGTC R_norvegicus300463 --------------------------CAGCTCCGAAAAAAAGAA-CCAAA R_norvegicus300843 ------------------------------GTGCCCTTTTAAGG-TTGTT R_norvegicus300901 ------------------------------GTGCCCTTTTAAGG-TTGGT R_norvegicus301001 ------------------------------GTGCCCTTTCTGGG-ATGAC R_norvegicus301053 ------------------------------GTGCCCTTTTAAGG-TTGTC R_norvegicus301063 ------------------------------GTGCCTTTA--AGG-TTGTC R_norvegicus300809 ------------------------------GTGCCCCTTAAAGG--TGGT R_norvegicus300401 -------------------------------GTGCCCTTTAACA-TTGCT R_norvegicus300361 ------------------------------GTGCCCTTTTACGG-TTGTC R_norvegicus300252 ------------------------------GTGCCCTTTTAAGG-TTGTC R_norvegicus300229 ------------------------------GTGCCCTTTTAAGG-TTGTC R_norvegicus300126 -------------------------------GTTCCTTCAGCTA-AACAT R_norvegicus300144 ------------------------------GTGCCCTTTTAAGG-TTGTT R_norvegicus300083 -------------------------------------ATAAATA-TTGCC R_norvegicus300010 ------------------------------GTGCCCTTTTAAGG-TTGTC R_norvegicus300475 ------------------------------GTGCCCTTTTAAGG-TTGTC R_norvegicus300570 -----------------------------------GTTTAGTCA-AA--- R_norvegicus300658 ------------------------------ATTCCCTGGGCAGG-TGGTT S_cerevisiae300022 TGTTGCAATGGCTCTCGTTTTTTTTAAATTTTTCTCTTTTCTCTTCTTTG S_araneus300689 ------------------------------GCATCCTCTTCAGG-TTGAC S_araneus300842 ------------------------------GTGCCCTTCTAAGG-TTGAA S_araneus300881 ------------------------------GTGTCAGGC-AGGC-TTCAA S_araneus300938 ------------------------------TTGCTCTTTTAAGG-CTGAT S_araneus300035 ------------------------------GTGCCCTCTTAAGG-CTGAT S_araneus300052 ------------------------------GTGTGCCCTTAAGG-TGGAC S_araneus300077 -----------------------------------ATCA-AAAT-TTAAA S_araneus300080 ------------------------------TCTCTCTACTAAGG-TTGAC S_araneus301004 ------------------------------ATGCCCTTTTAAGG-TTGTT S_araneus300189 -------------------------------------AAACCTG-TATAA S_araneus300272 ------------------------------GTGTCCTTTTAAGA-CTGGT S_araneus300283 ------------------------------GTGCCCTCCTAAGA-CTGTC S_araneus300302 ------------------------------TAGTCCTTTGAAGG-TTGAT S_araneus300366 ---------------------------ACACCCTTTTAAAAGTG-GA--C S_araneus300377 ------------------------------GTACCCTTCTAAAA-TTGAT S_araneus300470 ------------------------------GTACCTTGTTGGGC-TTGAT S_araneus300608 ------------------------------GCGCCCTCTTAAGG-CAGCC S_tridecemlineatus300203 --------------------------------TAACCAGAAAACTCCAGA S_tridecemlineatus300218 ------------------------------GTGTCCTTTTAAGG-CTGAT S_tridecemlineatus300039 ------------------------------GTGCCTTTTTAAGG-TTGAC S_tridecemlineatus300164 ----------------------------------------AAAA-ATGAT T_nigroviridis300074 ------------------------------TTGCCCACCTCAGGCAGACC T_belangeri300014 ------------------------------GTGCCCT-----GG-TTGAC T_belangeri300159 ------------------------------GTGCCCT-----GG-T-GAC T_belangeri300192 ------------------------------GTGCCCTCTTAAGG-CTGCC T_belangeri300220 ------------------------------GTGCCCTTTTAAGG-CTGCC T_belangeri300331 ------------------------------GTGCCCTTCTAAGG-CTGCC T_belangeri300378 ------------------------------GTGCCCTTCCGAGG-TTCAT C_familiaris300038 GCA----GTGCCCT----GGGAGGCC--AAC-------ACAGAAGGGGAC C_familiaris300096 GCA----GTGCCCT----GGGAGGCC--AAC-------ACAGAAGGGGAC C_porcellus300388 ACAG----TGCCTT----AAGA------GGC---TAACACAGAAGAGTAC C_porcellus300424 ATA----GTGCCTT----AAGAAGCT--AAC-------ACAGAAGGGTAA C_porcellus300564 ACAG----TGCCTT----AAGA------GGC---TAACACAGAAGGGTAC C_porcellus300616 ACA----GTGCCTT----CAAAGGGT--AAT-------ACAGAAGGGAAA D_rerio300277 GT-------GTCTC----TAGTGGCCA-TAA--------CAGGGGGGTAT D_rerio300278 A-------TGGCTT----GAGTGAAT--AAC-------ACAGGGGGGCAG D_novemcinctus300004 TCT----GCATTTG----AAGAGGCT---------AACACAGAA-GGTAA D_novemcinctus300069 TCT----GTATTTT----AAGAGGCC---------CACACAGAATGGTAA D_novemcinctus300134 T-------TGTTTA----AAGTGAAT--TGCTG----CACAGAAGTGTAA D_novemcinctus300226 TCA----GTGCTTT----AATTGG---------TTAGCACAGAAGG---- D_novemcinctus300305 --------------------GTGTTC--TTCTA---ACACAGAAGGGTAA D_novemcinctus300353 TCA----GTGCTTT----AAGTGGCTA-ATATAAAAATGTAGAAGGGTAA D_novemcinctus300356 TCA----GTGCTTT----AAGAAGCTA-AC--------ACAGAAGGGAAA D_novemcinctus300614 TCA----GTACTTT----AAGAGGCT---------AACACAGAAGGGTAA D_novemcinctus300615 TCA----GTGCTTT----AAGAGA---------CTAACGCAGAAGG---- D_melanogaster300121 GTTA----TCCTCCATGGAAGATCACC-GAT-----CGAAAGCTGTGCCC D_melanogaster300122 GTTGC---TCCATTCTGGACAACTGCT-GA------CGATACGTGTGCCC E_telfairi300086 GCA----GTACTTT----AAGAGGTG--AAC-------ACAGAAAGGCA- E_telfairi300115 GCG----GTACTTT----AAGAGGCT--AAC-------ACAGAAGGGTAA E_telfairi300178 GCA----GGGCCTG----CACAGGCT--CAC-------ACAGAAGGGCAA E_telfairi300184 GCA----GTGCTTT----AAGAGGGG--AAC-------ACAGACTGGCAA E_telfairi300295 GCA----ATACTTT----AAGAGGCT--AAC-------ACAGAAGGGTA- E_telfairi300318 AT-------ATTTT----TAAAGGCG--ATC-------ATTGGT-GGTAA E_telfairi300340 AAC----AAAAGTT----AAGAGGCT--AAC-------ACAGAAGGGTAA E_telfairi300402 GCA----GCGCTTA----AAGAGGCT--AAT-------GCAGAAGGGTGT E_telfairi300433 GCA----GTACTTT----AAGAGGCT--AAC-------ACAGAAGGGTA- E_telfairi300475 GCG----GTACTTT----AAGAGGCT--AAC-------ACAGAAGGGTA- E_telfairi300487 GCG----GTACTTT----AAGAGGCT--AAC-------ACAGAAGGGTAA E_telfairi300593 CCC--------TCT----GGCG---C--AAC-------ACAGAAGGGTAA E_telfairi300640 GCA----GTACTTT----AAGAGGCT--AAC-------ACAGAAGG-TA- E_telfairi300673 GCA----GTACTTT----AAGAGGCT--AAC-------ACAGAAGGGTA- E_telfairi300734 GCA----GCACTTT----AAGAGGTT--AAC-------ACCGAAGGGTA- E_telfairi300741 GCA----GTATTTGA---AAGAGGCT--AAC-------ACAGAAAGATG- E_telfairi300764 GCG----GTACTTT----AAGAGGCT--AAC-------ACAGAAGGGTA- E_telfairi300765 GCT----GTGCTTT----AAGG-----------CTAGCACGGAAGG---- E_caballus300070 GCA----GTGCCTT----AAGAGGCT--AAC-------ACAGAAGGGCAA E_caballus300254 GCA----GTGCCTT----AAGAGGCT--AAC-------ACAGAAGGGCAA E_europaeus300034 GCA----GTGCTTC----AAGATGCT--A-C-------ACGGAAAAGTAA E_europaeus300117 TGC----AATGATT----AAGAG------ACTA---ACACAGAAAGGTAA E_europaeus300122 GCA----GTGCTTC----AAGATGCT--A-C-------ACGGAAAAGTAA E_europaeus300204 ACA----GTCCTTT----AAGAGACT--TA------ACACTGAAGGGTAA E_europaeus300219 GCAAT----GGTTT----GAGAGG---------CTAACACAGAAGG---- E_europaeus300239 CTA----GTGCTTG----AAGAGGCT--AAC-------ACAGAAAGGTAA E_europaeus300272 GCA----GTGCTTT----AAGTG------GCTA---ACACAGAAGGGGAA E_europaeus300346 TCA----GCGCTTT----AAGAGGCT--AAC-------ACAGAAGGGAAA E_europaeus300352 ACA----GTGTTTT----CAGAGATG--AAC-------ACAGGAGGGTGA E_europaeus300375 ACA----GTCCTTT----AAGAGACT--TA------ACACTGAAGGGTAA E_europaeus300380 AGA----GTACTTT----AAGAGGCT--AGC-------TCAAAAGGGTAG E_europaeus300383 --C----ACTGTTT----AAGAA------GCTA---ACACAGAAGGGTAA E_europaeus300388 GCA----GTGCTTT----TAGAGGCT--AACAC---AGAA-GAGGGACAT E_europaeus300389 -CA----GTGCTTT----AAGAGGCT--AAC-------ACAGAAGGATAA E_europaeus300428 -TA----A---TTT----AAGAAG---------TTAACATAGAAGG---- E_europaeus300433 GCA----ACG-TTT----AAGAGA---------CTAACATAGAAGA---- E_europaeus300454 GCA----GTGTGTT----AAGAGGCTA-TG--------GCAAAAGGATAA E_europaeus300464 GCTTTAAGTGCTTT----AAGACG---------TTAACATAGAAGG---- E_europaeus300544 GCA----GTTCTTA----AAAAGG---------CTAACACAGAAGG---- E_europaeus300549 GCTTTAAGTGCTTT----AAGACG---------TTAACATAGAAGG---- E_europaeus300591 TTG----GTACTTT----CAGAGGCT--AGC-------ACAGAAGAATAA E_europaeus300701 ATC----ACATTCT----AATTTGCT--AAC-------ATAGGAAGGTAA E_europaeus300721 GCA----GTGCTTT----AAAAGACTT-AAC-------ACAG-------A F_catus300053 GCA----GTGCCTT----AAGAGGCT--AAC-------ACAGAAGGGTAA H_sapiens300058 CCA----GTGCTTT----AAGAGGCT--AAC-------ACAGAAGGGTAA H_sapiens300480 CCA----GTGCTTT----AAGAGGCT--GAT-------ACAGAAGGGTAA L_africana300063 GCA----GTGCTTT----AAGAGGCT--AAC-------ACAGAAGGGTAA L_africana300379 GCA----GTGCCCA----AGGTGGCT---GC-------ACAGGAGG---- L_africana300481 GCT----GTGATTT----AAGAAGCT--AAC-------ACAGAAGGTTGA M_mulatta300012 CCA----GTGCTTT----AAGAGGCT--AAC-------ACAGAAGGGTAA M_mulatta300195 ACA----GTTCTTT----AAGAGACT--AAC-------ACAGAAAGCTAA M_mulatta300271 TTA--------AAA----AA-----T--AAC-------ACAGAAGAGTAA M_mulatta300286 ACA----GTTTTTT----AAGCGGCT--AGC-------ACAGAAGGGTAA M_mulatta300298 GTA----GTGCTTT----AAGAAGCT--AAC-------ATAGAAGGATAA M_mulatta300376 CCA----GTGCTCT----AAGAGGCT--GAT-------ACAGAAGGATAA M_mulatta300391 GCA----ATGCTTT----AAGAGGCT--AACAC---AGAAGGGTAAAGCT M_mulatta300408 ACA----GTGCCTT----AAGAGGCT--AAC-------ACAGAAGGGCAA M_mulatta300476 ACA----GTGCCTT----AAGAGC---------CTAACACAGAAGT---- M_mulatta300480 GCA----GTGCTTT----AAGGGGCT--AAC-------ACAGAAGGGTTA M_mulatta300488 ACA----GTGCTTT----AAG------------------CAGAAGGGTAA M_murinus300225 GCA----GTGCTTT----AAGAGG---------CTAACACAGAAGG---- M_murinus300268 GCA----GTGCTTT----AAGAGG---------CTAAAACAGAAGG---- M_murinus300303 GCA----GTGCTTT----AAGAGG---------CTAACACAGAAGG---- M_murinus300410 ------------------AAGAGGCT--AAC-------ACAGAGAGGCA- M_domestica300024 -CA----GTGCTTT----AAGAGGCT--AACCC---AGAATGAAGGGTAT M_musculus300704 ACGG----TACTTT----AAGA------GGC---TAACACAGAAGGGTAA M_musculus300786 AGGA----TACTTT----AAAA------GGC---TAACACAGAAGGGCAA M_musculus300787 ACTG----TACTTT----AAGA------GGC---TAACACAGAAGGGTAA M_musculus300823 ACA----GTCCTGT----AAGAGGCT--AGC-------ACAGAGGGGTAG M_musculus300924 ACTG----TACTTT----AAGA------GGC---TAACACAGAAGGGTAA M_lucifugus300855 TCA----GTGCCTT----AAGAGGCT--AAC-------ACAGAAGGGTAA M_lucifugus300856 TCA----GTGCCTT----AAGAGGCT--AAC-------ACAGAAAGGTAA M_lucifugus300027 GCA----GTGCCTT----AAGAGGCT--AAC-------ACAGAAGGGTAA M_lucifugus300035 GCA----GTGCCTT----AAGGGGCT--AAC-------ACAGAAGGGTAA M_lucifugus300101 TCA----GTGCCTT----AAGAGGCT--AAC-------ACAGAAGGGTAA M_lucifugus300177 TCA----GTGCCTT----AAGAGGCT--A-C-------ACAGAAGCGTAA M_lucifugus300246 GCA----GTGCCTT----AAGAGGCT--AAC-------ACAGAAGGGTAA M_lucifugus300495 --C----ATTAATA----ATGAACTA--CACTA---ACACAGAAGGGTAA M_lucifugus300537 ATT----CCTACTT----AAGAGGCT--AAC-------ACAGA-GGGTAA M_lucifugus300624 TCA----GTGCCTT----AAGAGGCT--AAC-------ACAGAAGGGTAA M_lucifugus300690 GCA----GTGCCTT----AAGGTGCT--AAC-------ACAGAAGGGTAA M_lucifugus300708 TCC----GTGCCTT----AAGAGGCT--AAC-------CCAGAAAGGTAA O_anatinus303218 T------GTGCTCT----AAGGGGCA----------ACACAGGAGGGAAT O_cuniculus300003 AGA----GTGCTTT----AAGAGGCT--AAC-------ATATAAGTGGAA O_cuniculus300028 AGT----GTGCTTT----AAGAGGCT--AAC-------ACAGAAGGGGAA O_cuniculus300143 ACA----GTGCTTT----AAGAGGCT--AAC-------ACAGAAGGGGAA O_cuniculus300155 AGT----GTGCTTT----AAGAGGCT--AAC-------ACAGAAGGGGAA O_cuniculus300284 AGA----GTGCTTT----AAGAGGCT--AAC-------ACAGAAGGG-AA O_cuniculus300286 ACA----GTGCTTT----AAGAGGCT--AAC-------ACAGAAGGGGAA O_cuniculus300362 AGA----ATGCTTT----AAGAGGCT--AGC-------ACAGAAGGGGAA O_cuniculus300404 AG------TGCTTT----AAGAGGCT--AAC-------ACAGAAGGGGAA O_cuniculus300435 GGA----GTGCTTT----AAGAGGCT--AAC-------ACAGGTGGGGAA O_cuniculus300510 AGA----GTGCTCT----GAGAGGCT--AAC-------ACAGAAAGGGAA O_cuniculus300002 ACC--------ATA----GCA----A--AGC-------ACAGAAGGGGAA O_garnettii300102 GCA----GTGCTTT----AAGGGA---------GGAACACAGAAGT---- O_garnettii300481 GCA----GTGCTTT----AAGAGGCT--AAC-------ACAGAAGGGTAA O_garnettii300026 GCA----GGGCTCT----AAAAGGCT--AAC-------ACGGAAGG--AA O_garnettii300162 GCA----GTGCTTT----AAGAGG---------CTAACACAGAAGG---- O_garnettii300084 GCA----GTGCTTT----AAGGGA---------GGAACACAGAAGT---- O_garnettii300054 GCA----GTTCTTT----AAGAGA---------CTAACATGGAGGG---- P_troglodytes300253 ACA----ATGCTTT----AAGAGC---------CTAACACAGAAAG---- P_troglodytes300314 GCA----GTTTTGT----AAGAGGCT--AAC-------ACATAAGGGTAA P_troglodytes300385 GCA----GTGCTTT----AAGGGGCT--AAC-------ACAGAAGGGTAA P_troglodytes300386 GTG----GTGCTTT----AAGAAGCT--AAC-------ATAGAAGGATAA P_troglodytes300464 ACA----GCGCCTT----AAGAGGCT--AAC-------ACAGAAGGGCAA P_troglodytes300017 CCA----GTGCATT----AGGAGGCT--GAT-------ACAGAAGGGTAA P_troglodytes300091 ACA----GTGCATT----AAG------------------CAGAAGGGTTA P_troglodytes300069 ATA----GATCTTT----AAGAGACT--AAC-------ACAGAAAGCTAA P_troglodytes300149 GCA----ATGCTTT----AAGAGGCT--AACAC---AGAAGGGTGAAGCC P_troglodytes300155 CCA----GTGCTTT----AAGAGGCT--AAC-------ACAGAAGGGTAA P_troglodytes300215 TTA--------AAA----AA-----T--AAC-------ACAGAAGGGTAA P_pygmaeus300271 TTT----CCTGCGC----CAGAGGCT--AAC-------ACAGAAGGGTAA P_pygmaeus300353 ACA----GTGCTTT----AAGAGC---------CTAACACAGAAAG---- P_pygmaeus300356 ATA----GTTCTTT----AAGAGACT--AAC-------ACAGAAAGCTAA P_pygmaeus300367 TTA--------AAA----AA-----T--AAC-------ACAGAAGGGTAA P_pygmaeus300421 CCA----GTGCTTT----AAGAGGCT--AAC-------ACAGAAGGGTAA P_pygmaeus300423 CCA----GTGCTTT----AAGAGGCT--GAT-------ACAGAAGGGTAA P_pygmaeus300072 ACA----GCGCCTT----AAGAGGCT--AAC-------ACAGAAGGGCAA P_pygmaeus300096 AC-----GTGCATT----AAG------------------CAGAAGGGTTA P_pygmaeus300135 GCA----GTGCTTT----AAGGGGCT--AAC-------ACAGAAGGGTAA P_pygmaeus300203 GTA----GTGCTTT----AAGAAGCT--AAC-------ACAGAAGGATAA R_norvegicus300671 ATGG----CTCTTT----AAGA------GGC---TAACACAAAAGGGTAA R_norvegicus300463 AAA--------AAA----AAGAGGTT--AAC-------ACAGAAGGGTAA R_norvegicus300843 GCAG----TACTTT----AAGA------GGC---TAACACAGAAGGATAA R_norvegicus300901 ACTG----TACCTT----AAGA------GGC---TAACACAGAAGGGTAA R_norvegicus301001 ACT----GTCCTGT----AAGAGGCT--AGC-------ACAGAAGGGTAG R_norvegicus301053 GAGG----TACTTT----AAGA------GGC---AAACACAGAAGGGCAA R_norvegicus301063 TCAG----TACTTT----AAGA------GGC---TAACACAGAAGGGTAA R_norvegicus300809 GCT----GTACTT-----AAGAGGCT--AAC-------ACAGAAGGGTAA R_norvegicus300401 GCAG----TGCTTT----AAGA------TGC---TAACACAGAAGGGTAA R_norvegicus300361 ATGG----TACTTT----AAGA------GGC---TAACACAAAAGGGTAA R_norvegicus300252 GCAG----TACTTT----AAGA------GGC---TAACACAGAAGGGTAA R_norvegicus300229 GTGG----TACTTT----AAGA------GGC---TAACACAGAAGGGTAA R_norvegicus300126 AAAG----AAGAAA----AGCA------GGC---TAACACAGAAGGGTAA R_norvegicus300144 GTGG----TACTTT----AAGG------GGC---TAACACAGACAGGTAA R_norvegicus300083 CCAG----TACTTT----AAGA------GGC---TAACACAGAAGGGTAA R_norvegicus300010 GCAG----TACTTT----AAGA------GGC---TAACACAGAAGGGTAA R_norvegicus300475 GCAG----TACTTT----AAGA------GGC---TAACACAGAAGGGTAA R_norvegicus300570 GTGG----AGAATC----TGGA------GGC---TAACACAGAAGGGTAA R_norvegicus300658 CTGGG---TTCTAT----AAGAAAGCA-GAC---TAACACAGAAGGGTAA S_cerevisiae300022 GCATAGTTTATTTTTAATAAATTATTTCAGGGTGAGATAGAGAAAGGATA S_araneus300689 TCGGT----GGTTT----CAGAGT---------CTAACACAAAAGG---- S_araneus300842 GTA----GTGCTTTA---AAGAAG---------CTAACACAGAAGAACAG S_araneus300881 ACA----ACGCTTTT---AAGAAA---------CTGACACAC--G----- S_araneus300938 GCAGT----GCTTT----AAGAGG---------CTAACACAGAAGG---- S_araneus300035 G--GT----GCTTT----CAGAGG---------TTAACACAGAAAG---- S_araneus300052 TTG----GTGCTTT----CAGGGGCTA-----------GCAGGAGGATAA S_araneus300077 ATA--------TTT----GAA----C--TTC-------AAAGAGCAGGAA S_araneus300080 TTG----GTGCTTT----AAGAGGTT--CAC-------ACAGAAGGAAGA S_araneus301004 GCA----GTACTTGCTTTAAGAGG---------CTAACACAGA-GG---- S_araneus300189 ACC-------TTTT----GTCTAGCC--AA--------ACAGAAGGGTAA S_araneus300272 GCA----GTGCCTT----AAGAGA---------TTAACAGAGA-GG---- S_araneus300283 TTGGT----GCTTT----CAGAGA---------CTCGTGTAAGAGG---- S_araneus300302 ACCAT----GCTGT----CAGAGA---------CCAACACAGAAGG---- S_araneus300366 ACA----GTGCTTT----AAAGAGTG--AGC-------ACAGGAAGGTAA S_araneus300377 GCAGTT---GCTTT----ACATTG---------ACAATGCAGAAAG---- S_araneus300470 GCA----ATGCTTTT---A-GAGG---------CTAACACAGAGG----- S_araneus300608 TCA----GGGCTCC----AAGATGCT--AAC-------ACAGAGGGTAAA S_tridecemlineatus300203 ATA------GCCTTTTCTTGTGTACT-------------TTAAAGGTTGA S_tridecemlineatus300218 GTG----ATACTTC----AAAAGGCT---TATTTTACCACAGAAGG---- S_tridecemlineatus300039 GCA----GTGCTTT----AAGAAGCT--AAC-------ACAGAAGGGTAA S_tridecemlineatus300164 GCA----GGAATTT----AAGAG------GCTC---ACACAGAAGGGCAA T_nigroviridis300074 GTT------GCCTC----TGGTGGAAA-CA---------CAGGGGGGCAG T_belangeri300014 GCC----ATGCTTT----TAGAGGCT--AAC-------ACGGAAGGGTAA T_belangeri300159 GCC----ATGCTTT----TAGAGGCT--AAC-------ACGGAAGGGTAA T_belangeri300192 GCA----GTGCTTT----AAGAGGCT--AAC-------ACAGAAGGGTAA T_belangeri300220 GCA----GTGCTTT----AAGAGGCT--AAC-------ACAGAAGGGTAA T_belangeri300331 GCA----GTGCTTT----AAGAGTCT--AAC-------ATAGAAGGTTAA T_belangeri300378 GCT----GTGCTTT----AAGAGG---------TTAACACAGAAGG---- C_familiaris300038 AG-------CA-----AGGCTCCAT----GAAA--CCCAGGGAC------ C_familiaris300096 AG-------CA-----AGGCTCCAT----GAAA--CCCAGGGAC------ C_porcellus300388 AG------------GAACCCTCCAT----AAAA--TCCAGAGAAGAGACT C_porcellus300424 ---------AGG---GACCCTCCAT----AGAA--CCCAGAGA--AGAGA C_porcellus300564 AG------------GAACCCTCCAT----AAAA--CCCAGAGAAGAGACT C_porcellus300616 AG-------AA-----AGACTCCTT----AAAG--CCCAGATAA------ D_rerio300277 ATTG------------AGCTGCTCTTG--TTAAAACCCAGGCCAGAGGTC D_rerio300278 ---------AAG---AATTCTCTCA----AAAA--CCTGA-------AGT D_novemcinctus300004 AG------------TAAGTCTCCAT----AAAA--CCCAGAGAGGAGATT D_novemcinctus300069 AG------------TAAGCCTCCAT----AAAA--CCTGGAGAGGAGA-- D_novemcinctus300134 ---------AGT---AAGTCTCCGA----AAAA--CAGGA-------AGA D_novemcinctus300226 -------GCAAAAG-AAGTCTCCAT----AAAA--TCCAGGCAGTAGGCT D_novemcinctus300305 ---------AGT---AAGTCTCCAT----AAAA--ATGAG-------AGA D_novemcinctus300353 ---------ATT---AATTCTCCAT----AAAA--CCCAGAGA--GGAGA D_novemcinctus300356 ---------AGT-------CTCCAT----AAAA--TGCAGAGA--GGAGA D_novemcinctus300614 AT------------TAAGTCTCCAT----AAAA--CCCAGAGTGGAGATG D_novemcinctus300615 -------GTAAAGT-AAGTCTCCAT----AAAA--CTCAGAGAAGAGATG D_melanogaster300121 AAAG---CAAACCCCAGCCATTG-T----AAAA----CAGCGGCGTGTTG D_melanogaster300122 AGAG---CGAATCCAAAGCCTTGCT----AAAA----CAGCGGCCTGCTG E_telfairi300086 -----------AAACGAGTTTCCAT----AAAA--CCCAGAGATGAGGTC E_telfairi300115 ATA--------AAGCAAGTCTCCAT----AAAA--CCCAGAGACGAGGTC E_telfairi300178 AG-------CA-----AGTCTCCAG----AAAA--CCCAGGGAC------ E_telfairi300184 GG------------CACCCCTCCAT----AAAA--CCCAGAGACGAGGTC E_telfairi300295 -----------AAGCAAGTCTCCAT----AAAA--CCTAGAGATGAGGTT E_telfairi300318 ---------AGT---AAGGCTCCAG----AGAA--CCCAGAGA--TGATA E_telfairi300340 ---------AGC---AAATCTGCAT----ACAA--CCCAGAGA--AGAGG E_telfairi300402 AT-------GT------GTCTCCAT----AAAA--CTCAGAGAA------ E_telfairi300433 -----------TAGCAAGTCTCCAT----AAAA--CCCAGAGACAAGGTC E_telfairi300475 -----------AAGCAAGTCTCCAT----AAAA--CCCAGAGACGAGGTC E_telfairi300487 ATA--------AAGCACGTCTCCAT----AAAA--CCCAGAGACGAGGTC E_telfairi300593 ---------AGC---GAGGCTCCAT----AAAG--CCCAGAGAC-GAGGC E_telfairi300640 -----------AAGCAAGTCTCCAT----AAAAAACCCAAAGACAAGATC E_telfairi300673 -----------AAGCAAATCTCCAT----AAAA--CCCAGAGACGAGGTC E_telfairi300734 -----------AAGCA-GTCTCCAT----GAAA--CCCAGAGATGAGGTC E_telfairi300741 -----------AAGCAAGTTTCCAT----AAAA--CCCAGAGACGAGGTC E_telfairi300764 -----------AAGCAAGTCTCCAT----TAAA--CCCAGAGATGAGGTC E_telfairi300765 -------GTAAAGT-AAGTCTCCAT----GAAA--C-------------- E_caballus300070 AG-------TA-----AGTCTCCGT----AAAA--CCCGGAGAG------ E_caballus300254 AG-------TA-----AGTCTCCAT----AAAA--CCCTGAGAG------ E_europaeus300034 AG-------AA-----AAGCTCTA---------------GAGAA------ E_europaeus300117 ---------AGT---AAATTTCCAC----AAAG--CCCA--AA--AAAGA E_europaeus300122 AG-------AA-----AAGCTCTA---------------GAGAA------ E_europaeus300204 ---------ATT--------TCCAT---AAAGT--CCCAAG--------- E_europaeus300219 -------GCAAAAT-AAGTGTCTAT----AAAA--CCCAGGGAAGAGGTT E_europaeus300239 ---------AAT---AAATCTCCAT----AAAA--GCCAGGGG--AGAAA E_europaeus300272 ---------AGT---AAATCTCCAT----AAGA--TCCAGGGA--AGGGA E_europaeus300346 ---------AGT---AAGTCTCCAT----AAAA--GGCAAGGG--AGAGA E_europaeus300352 ---------AGT---AAGTCTTCCT----AAAA--CCAAAGTTCCAAAGA E_europaeus300375 ---------ATT--------TCCAT---AAAGT--CCCAAG--------- E_europaeus300380 C------------CTACGTCCTTAT----AAAA--CTCAGAGAA------ E_europaeus300383 ---------AGT---AAGTCTCCAT----AAAA--CCCAGGGG--AGAGA E_europaeus300388 ---------AAT-------CTCCAT---AAAAG--CCCAGAGA--AGAGA E_europaeus300389 ---------AGT---AAATCTTTAT----AAAA--T-CAGGGA--AGAGA E_europaeus300428 -------GTAAAGT-AAGTTTTCAT----AAAA--CCCAGTGGAGAGATT E_europaeus300433 -------ATAAAGT-AAGTCTTCAC----AAAA--TCCAGGGAAGAGATT E_europaeus300454 ---------AGT---AAATCTCCAT----ATAA--CCCAAAGA--AGAGA E_europaeus300464 -------GTAAAGTTAAGTCTTCAT----GAAA--CCCAGAGAAGAGATT E_europaeus300544 -------GTAGAAT-TAGTCTTCAT----AAAA--CCCAGAAAAGAGTTT E_europaeus300549 -------GTAAAGTTAAGTCTTCAT----GAAA--CCCAGAGAAGAGATT E_europaeus300591 A------------GTAAATCTTTAT----AAAA--CTCAGAAAT------ E_europaeus300701 ---------AGT---AAGTCTCCA-----ATAA--CCCAGAAA--AGAGA E_europaeus300721 ---------AGT---AAGTCTCCAT----AAAA--TTCAGGGA--ACAGA F_catus300053 AG-------TA-----AGTCTCCAT----AAAA--CCCAGGGAT------ H_sapiens300058 A------------GTAAGTCTCCAT----AAAA--CCCAGAGAA------ H_sapiens300480 ---------AGTT--AAGTCTCCAC----AAAA--TCCAGGGA--AGAGA L_africana300063 AG------------TAAGACTCTAT----AAAA--CCCAGAGAA------ L_africana300379 -G-------TA-----AGTCTCCAC----AAAA--CCCAGAGAA------ L_africana300481 AT-------TC-----AGTCTCCGT----GAAA--CCCAGAGCA------ M_mulatta300012 A------------GTAAGTCTCCAT----AAAA--CCCAGAGAA------ M_mulatta300195 ---------AGT---AATTATCCAT----AGAA--CCCAGAGA--TGAGA M_mulatta300271 ---------GGT---AAGTCTCCAT----TAAA--CACAGGAA--AGAGA M_mulatta300286 A------------GTAAGTCTCCAT----AAAA--CCCGGAGAACAGACA M_mulatta300298 AA------------TAAGTCTCTAC----AAAA--CCCAGAGAA------ M_mulatta300376 ---------AGTT--AAGTCTCCAC----AAAA--CCCAGGGA--AGAGA M_mulatta300391 ---------TTC---TTTACCCTTTGGGTAAAA--CCCAAAGA--AGAGA M_mulatta300408 AG-------TA-----AGTCTCCAT----AAAA--CCCA---AA------ M_mulatta300476 ----------AAGT-AAGTTTCCAT----AAAA--CCCAGAGACTATATT M_mulatta300480 A------------GGAAGTCTCCAC----AAAC--CCCAGAGAA------ M_mulatta300488 AG-------TA-----AGTCTCCAT----AAAA--CCCAGAGAA------ M_murinus300225 -------GTAAAGT-AACTCTCCAT----AAAA--CCCAGAGAAGAGATT M_murinus300268 -------GTATAGT-AA-TCTTCAT----AAAA--CCCAAAGAAGAGATT M_murinus300303 -------GTAAAGT-AAGTCTCCAT----AAAA--CCCAGAGAAGAGATT M_murinus300410 -----------AAGCGAGTCTCCAT----AAAA--CCCAGAGAGGAGGCT M_domestica300024 ---------AAT---AATTCTCCAT---TAAA---CCCAAATC--AGAGA M_musculus300704 AG------------GAACTCTCCAT----AAAA--CCCAGAGAGTAAAAC M_musculus300786 AG------------GAACTCTCTAT----AAAA--CCCAGAGGGGAAAAC M_musculus300787 AG------------GAACTCTCCAT----CAAA--CCCAGAGAAGAGGCT M_musculus300823 A------------GGAAATCTCTAT----TAA---CTCAGAAAA------ M_musculus300924 AG------------GAACTCTCCAT----CAAA--CCCAGAGAAGAGGCT M_lucifugus300855 AG-------CA-----AGTCTCCAT----AAAA--CCCAGAGAA------ M_lucifugus300856 AG-------CT-----AGTCTCCAT----AAAA--CCCAAAGAA------ M_lucifugus300027 AC-------TG-----AGTCTCCAT----AAAA--CCCAGAGAA------ M_lucifugus300035 AC-------TA-----AGTCTCCAT----AAAA--CCCAGAGAA------ M_lucifugus300101 AG-------CA-----AGTCTCCAT----AAAA--CCCAAAGAA------ M_lucifugus300177 AG-------CA-----AGTCTCCAT----AAAA--CCCAGAGAA------ M_lucifugus300246 AC-------TG-----AGTCTCCAT----AAAA--CCCAGAGAA------ M_lucifugus300495 ---------ACC---AAGTCTTTAT----AAAA--CCCAGAAA--AGAGA M_lucifugus300537 ---------AGC---AAGTCTCCAT----AAAA--CCCAAAGA--AGAGA M_lucifugus300624 AC-------TA-----AGTCTCCAT----AAAA--CCCAGAGAA------ M_lucifugus300690 AA-------AGT---AAGTCTCGAT----AAAA--CCCAGAGA--AGAGA M_lucifugus300708 ---------AGC---AAGTCTCCAT----AAAA--CCCAGAGA--AGAGA O_anatinus303218 AA------------CATTCCTCTCT----TAAA--CCCAGAGCTGAGGCT O_cuniculus300003 ---------AGT---AAGTCTCCAT----AAAA--CCCAGAGA--AGAGA O_cuniculus300028 ---------AGA---AAAGCTCCAT----AAAA--CCTAGAGA--AGAGA O_cuniculus300143 ---------ACT---AAGTCTCCAC----AAAA--CCCAGAGA--AGAGA O_cuniculus300155 ---------AGA---AAAGCTCCAT----AAAA--CCTAGAGA--AGAGA O_cuniculus300284 ---------AAT---AAGTCTCCAT----AAAA--CCCAGGGA--AGATA O_cuniculus300286 ---------ACT---AAGTCTCCAC----AAAA--CCCAGAGA--AGAGA O_cuniculus300362 ---------AGT---AAGTTTGCAT----CAAA--CCCAGAGA--AGAGG O_cuniculus300404 ---------AGT---AAGTCTCCCT----AAAA--CCCAGAGA--AGAGA O_cuniculus300435 ---------AGT---AAGTCTCCAT----AAAA--TGCAGAGA--AGAGA O_cuniculus300510 ---------AGT---AAGTCTCCAT----AAAA--CCCAGAGA--AGAGA O_cuniculus300002 ---------AGT---AAGTCTCCAT----AAAA--CCCAGAGA--AGAGA O_garnettii300102 -------ATAAAGT-GAGTTTCCAT----AAAA--CCCAGGGAAGAGATT O_garnettii300481 ---------AGT---AAATCTCCAC----GAAA--CCCAGAGA--AGAGA O_garnettii300026 AG-------CA-----CATCTCCAT----AAAA--CCCGGAGAA------ O_garnettii300162 -------GTAAAGT-AAATCTCCAT----AAAA--CCCAGAGAAGAGATT O_garnettii300084 -------ATAAAGT-GAGTTTCCAT----AAAA--CCCAGGGAAGAGATT O_garnettii300054 -------GTAAAGT-AAATCTCCAT----AAAA--CCTGGAGAAGAGATT P_troglodytes300253 -------GTAAAGT-AAGTTTCCGT----AAAA--CCCAGAAATGATATT P_troglodytes300314 AT-------TCAAGTAAGTCTCCAT----AAAA--CCCAGAGAAGAGACA P_troglodytes300385 A------------GGAAGTCTCCAT----AAAC--CCCAGAGAA------ P_troglodytes300386 AG------------TAAGTCTCTAC----AAAA--CCCAGAGAA------ P_troglodytes300464 GG-------TA-----AGTCTCCAT----AAAA--CCCAGAGAA------ P_troglodytes300017 ---------AGTT--AAGTCTCCAC----AGAA--TCCAGGGA--AGAGA P_troglodytes300091 AG-------TA-----AGTCTCCAT----AAAA--CCCAGAGAA------ P_troglodytes300069 ---------AGT---AATTCTCCAT----AAAA--CCCAGAGA--CGAGA P_troglodytes300149 ---------AGT---CT---CCT-----TAAAA--CCCAAAGA--AGAGA P_troglodytes300155 A------------GTAAGTCTCCAT----AAAA--CCCAGAGAA------ P_troglodytes300215 ---------GGT---AAGTCTCCAT----TAAA--CCCAGGAA--AGAGA P_pygmaeus300271 ---------AGC---CAGTCTCCTT----AAAA--CCCAAAGA--AGAGA P_pygmaeus300353 -------GTAAAGT-AAGTTTCCAT----AAAA--CCCAGAGACGATATT P_pygmaeus300356 ---------AGT---AATTCTCCAT----AAAA--CCCAGAGA--CGAGA P_pygmaeus300367 ---------GGT---AAGTCTCCAT----TAAA--CCCAGGAA--AGAGA P_pygmaeus300421 A------------GTAAATCTCCAT----AAAA--CCCAGAGAA------ P_pygmaeus300423 ---------AGTT--AAGTCTCCAC----AAAA--TCCAGGGA--AGAGA P_pygmaeus300072 AG-------TA-----AGTCTCCAT----AAAA--CCCAGAGAA------ P_pygmaeus300096 AG-------TG-----AGTCTCCAT----AAAA--TCCAGAGAA------ P_pygmaeus300135 A------------GGAAGTCTCCAT----AAAC--CCCAGAGAA------ P_pygmaeus300203 AG------------TAAGTCTCTAC----AAAA--CCCAGAGAA------ R_norvegicus300671 AG------------GAAGTCTTCAT----AAAA--CCCAGAGAGGAAAAC R_norvegicus300463 ---------AGG---AAGTCTCCGT----AAAA--CCCAGAGA--GGAAA R_norvegicus300843 AG------------GAAGTCTCCAT----AAAA--CCCAGAGAGGAAAAC R_norvegicus300901 AG------------GAACTCTCCAT----AAAA--CCCAGAGAAGAGGCT R_norvegicus301001 A------------GGAAATCTCTAG----AGA---CTCAGAAAA------ R_norvegicus301053 -------------------------------------------GGAAAAC R_norvegicus301063 AG------------GAAGTCTCCAT----AAAA--CCCAGAGAGGAAAAC R_norvegicus300809 AG------------CAACTCTTCAT----AAAA--CCCAGGGAGGAGACT R_norvegicus300401 AG------------GAACGCTCCAT----GAAA--CCCAGACAGGAAAAC R_norvegicus300361 AA------------GAACTCTCCAT----AAAA--CCTAGAGAGGAAAAC R_norvegicus300252 AG------------GAAGTCTCCAT----AAAA--CCCAGAGAGGGAAAA R_norvegicus300229 AG------------GAATTCTCCAT----AAAA--CCCAGAGAGGAAAAC R_norvegicus300126 AG------------GAACTCTCCAT----AAAA--CCACAGAAGAGGCTT R_norvegicus300144 AG------------GAACTTTCCAT----AAAA--CCCAGAGAGGAAAAC R_norvegicus300083 AG------------GAAGTCTCCAT----AAAA--CCCAGAGAGAAAAAC R_norvegicus300010 AG------------GAAGTCTCCAC----AAAA--CCCAGAGAGGAAAAC R_norvegicus300475 AG------------GAAGTCTCCAT----AAAA--CCCAGAGAGGAAAAA R_norvegicus300570 AG------------GAAGTCTCCAT----AAAA--CCCAGAGAGGAAAAA R_norvegicus300658 AG------------GAAGTCTCCAT----AAAA--CCCAGAGAGGAAAAC S_cerevisiae300022 ATGAGTATCGTAGATAAATCTTCGGTTCCGAATAGTGTAACTGTTGGTGC S_araneus300689 -------GTAAAGT-AAGTCAGCAT----AAAA--TCTCAGAGAGAAG-- S_araneus300842 AAGA---GTAGATG-AAGTTTCTAT----AAAA--CTCAGAGACAAG--A S_araneus300881 -------GCACAGT-CAGTCTCCGG----AAAA--CCCAGAGAAGAT--C S_araneus300938 -------GTAAAGT-GAATCTCCAT----AAAA--CCCAGGGAGGAGATT S_araneus300035 -------GTAAAGT--AGTCTCCAA----AAAA--CCCAGAGAGGAGATT S_araneus300052 ---------AGT---AAGTTTCCAT----AAAA--CCCAAAGA--GGAGA S_araneus300077 ---------AGT---AAATCTCTAT----AAAA--CCCAGAGAC-AAAGA S_araneus300080 GT-------AA-----AGTCCCCAC----ACAA--CCAAGAAAG------ S_araneus301004 -------GTAAAAT-AAGTCTTCAT----AAAA--CCCAGAGAAGATG-- S_araneus300189 ---------AGT---AAGTCTCCAT----AAAA--TTCAGAGA--GGAGA S_araneus300272 -------GTAAAGG-CAGTCTCTGA----AAAA--TTCAG--AAAAGATT S_araneus300283 -------GTAAAAT-CAGGCTCTAT----AAAA--CCCAGGGAGGAAACT S_araneus300302 -------GGAAAGT-AAGGCTCCAT----AAAA--CCCAGAGAAGAGATT S_araneus300366 ---------AGT---AAGTCTCCAT----AAAA--TTCAGAAA--GGAAA S_araneus300377 -------GTAAAGT-AAGAATCTAT----AAAA--CCTAGAGAGGAGATT S_araneus300470 -------GTAAAGT-AAGTCTCCAT----AAAA--CCCAGAGAAGAT--T S_araneus300608 GG-------AAG----AATCATAAA----ACAT--CCCAGA--------- S_tridecemlineatus300203 TG-------------CAGCCGATAGGT-TAAAA--TCTAGAGAGGAGATT S_tridecemlineatus300218 -------GTAAAAT-AAGTCTCCAT----AAAA--CCCAGAGAAGAGATT S_tridecemlineatus300039 AG-------CA-----AACCTCCAT----AGAA--CCCAGAGAA------ S_tridecemlineatus300164 ---------AGG---AAACCTTCAC----GGAA--CCCAGAGA--AGAGA T_nigroviridis300074 ATT-------------AGCT-CTCTCA--TAAACCCGCCATGACGCCGCC T_belangeri300014 AA------------TAAGTCTCCAT----AAAA--TCCAGAGAA------ T_belangeri300159 AA------------TAAGTCTCCAT----AAAA--TCCAGAGAA------ T_belangeri300192 AG------------TAAGTCTCCAT----AAAA--CCCAGAGAA------ T_belangeri300220 AG------------TAAGTCTCCAT----AAAA--CCCAGAGAA------ T_belangeri300331 AA-------G----CAAGACTCCAT----AAAA--CTCAGAGAA------ T_belangeri300378 --------TAAAGT-AAGTCTCTGT----GAAT--TCCACAGAAGAGATA C_familiaris300038 -----------GAGCCCGCA-GAGCTCC--TCTTTGGA----------TC C_familiaris300096 -----------GAGCCCGCA-GAGCTCC--TCTTTGGA----------TC C_porcellus300388 G-------------------ACAC-TCC--TCTTTGGATC---------- C_porcellus300424 C---------------TG--AAA-C-----TCTTTGAATC---------- C_porcellus300564 T-------------------ACGC-TCC--TCTTTGGATC---------- C_porcellus300616 -----------GAGATT----AAACTCT--TCTTTGGG----------TC D_rerio300277 ---------------------ATTCTCTG-AGTCTGGATC---------- D_rerio300278 GC----------TGGCTTTGATA-TTCCATGCTTCGGATC---------- D_novemcinctus300004 AT------------------AAAACTCC--TCTTTGGATT---------- D_novemcinctus300069 -------------------------TCC--TCTTTGGATT---------- D_novemcinctus300134 AG----------AGATTGTAAAA-CTCC--TCTTTGGATC---------- D_novemcinctus300226 GTAA----------------AA---TCC--TCTTTCAATC---------- D_novemcinctus300305 GG----------AGATTACAAAA-CTCC--TCTTTAGATC---------- D_novemcinctus300353 T---------------TGTAAAACTTCA---TTTTGGATC---------- D_novemcinctus300356 T---------------TGTAAAACTCCC---CTTTGGATC---------- D_novemcinctus300614 AT------------------AAGACTCC--TCTTTGGATC---------- D_novemcinctus300615 ATAA----------------AA--ATCC--TCTTTAAATC---------- D_melanogaster300121 G----------------------CCCTCAGTGCTCGCGTC---------T D_melanogaster300122 -----------------------CTTTCAATGAGCTAGTC---------T E_telfairi300086 ACC-----------------ATAACTCC--TCTTTGGATC---------- E_telfairi300115 GGC-----------------AGAACTCC--TCTTTGGATC---------- E_telfairi300178 -----------CGGGTTGCAAGAACTCT--TCTTTGGA----------TC E_telfairi300184 TGT-----------------GGAACTCT--TCTTTGGAGC---------- E_telfairi300295 GGT-----------------ACAACTCC--TCTTTGGATC---------- E_telfairi300318 T--------------TGGAGAA--CTTC--TCTTTGGATC---------- E_telfairi300340 TC--------------AGTAGAA-CTTC--TCTTGGGATC---------- E_telfairi300402 -----------GAGATCAGA-TACCTCT--TCTTTGGA----------TC E_telfairi300433 GGT-----------------AGAACTCC--TCTTTGGATC---------- E_telfairi300475 GGT-----------------AGAACTCC--TCTTTGGATC---------- E_telfairi300487 GGC-----------------AGAACTCC--TCTTTGGATC---------- E_telfairi300593 C---------------GGTAGAA-CTCC--TCTTTGGATC---------- E_telfairi300640 GGT-----------------AGAACTCC--TCTTTGGATC---------- E_telfairi300673 GGT-----------------AGAACTCC--TCTTTGGATC---------- E_telfairi300734 GGT-----------------AGAACTCC--TATTTGGATC---------- E_telfairi300741 GGT-----------------ATACCTCC--TCTTTGGAGC---------- E_telfairi300764 GGC-----------------AGAACTCC--TCTTTGGATC---------- E_telfairi300765 -------------------------TCC--TCTTTGGATG---------- E_caballus300070 -----------GAGATTGTC-GGACTCC--TCTTTGGA----------TC E_caballus300254 -----------GAGATTGTC-AGACTCC--TCTTTGGA----------TC E_europaeus300034 -----------GAGGTTGCA-AA-CACT--TCTTTGGA----------TC E_europaeus300117 C---------------AGCAAAA-CTC-------TGAATC---------- E_europaeus300122 -----------GAGGTTGCA-AA-CACT--TCTTTGGA----------TC E_europaeus300204 ------------------TAAGA-CTGC--TGTTTGGATC---------- E_europaeus300219 ATAA----------------AAATTTTC--T---TGGATC---------- E_europaeus300239 T--------------TGT-GAAA-CTCT--TCTTTGGATC---------- E_europaeus300272 T---------------TGCAAAA-CTCT--TCACTAAATT---------- E_europaeus300346 C---------------TGCAAAA-CTCT--TCTTTGGATC---------- E_europaeus300352 AG----------AGATTGCAAAA-CTCT--TCTTTGGAAC---------- E_europaeus300375 ------------------TAAGA-CTGC--TGTTTGGATC---------- E_europaeus300380 -----------GAGATCGTA-AAACTCT--TCTTTGGA----------TC E_europaeus300383 T---------------TACAGAA-CTCT--TCTTTGGATC---------- E_europaeus300388 T---------------AATAAAA-CACC--TCTT---------------- E_europaeus300389 T---------------TGTGAAA-CTCT--TCTTTAGATC---------- E_europaeus300428 GTGG----------------AA--CTCT--TCTTTGGATC---------- E_europaeus300433 ACAA----------------AA--CTCT--TCTTTGGATC---------- E_europaeus300454 C---------------TGCAGCA--------TTCCATGT----------- E_europaeus300464 GTAA----------------AA--CTCC--TCTTTGGATC---------- E_europaeus300544 ATAA----------------AG--TTCC--TCTTTGTATC---------- E_europaeus300549 GTAA----------------AA--CTCC--TCTTTGGATC---------- E_europaeus300591 -----------GTGCTTACA-AAACTCC--TCTTTGGA----------GC E_europaeus300701 T--------------TGCAAAA--CTCT--TCTTTGGATT---------- E_europaeus300721 T---------------TGTAAAA-CCCT--TTATTGGATC---------- F_catus300053 -----------GAGAC--TA-AAACTCC--TCTCTGGA----------TC H_sapiens300058 -----------GAGACTGGA-AAGCTCC--TCTTTGGA----------TC H_sapiens300480 C---------------TGTGAAA-CTCA--TCTTAGAACC---------- L_africana300063 -----------GAGACTGGA-GAACTCC--TCTTTGGA----------TC L_africana300379 -----------GAGATTCTG-CAACTCC--TCTTTGGA----------TC L_africana300481 -----------GAGATCAGA-GAACTCT--T---TGGA----------TC M_mulatta300012 -----------GAGACTGGA-AATCTCC--CCTTTGGA----------TC M_mulatta300195 T---------------TGTAAAA-CTCC--TCTGTAGATC---------- M_mulatta300271 C---------------TGGAAAA-CTCC--TCTTTGGATC---------- M_mulatta300286 GAA--------GAGACTGTG-AAACTCC--TCTTTGGA----------TG M_mulatta300298 -----------GATATTGGA-ACACTCC--TCT--GGA----------TC M_mulatta300376 C---------------TGTGAAA-CTCC--TCTTAGAACC---------- M_mulatta300391 T---------------TGTAAA--CTTC--TCTTTGGATC---------- M_mulatta300408 -----------GACTCTATG-AA-CCCC--TCTCTGGA----------TC M_mulatta300476 GCAA----------------AA--TTCC--TCTTTGGATC---------- M_mulatta300480 -----------GAGATTGTA-AAGCTCC--TCTTTAGA----------TC M_mulatta300488 -----------GAGAATGTG-AAGCTCC--TCTTTGGAGGAGCTGGACTC M_murinus300225 TTT-----------------AAAACTCT--TCTTTGGATC---------- M_murinus300268 TC------------------AAAACTCC--TATTTGGATC---------- M_murinus300303 TTTTAAA-------------AAAACTCC--TCTTTGGATC---------- M_murinus300410 GC------------------ACGTCTCC--TCTCTGCATC---------- M_domestica300024 T---------------T-TAAAA-CTCT--TTTTTGGATC---------- M_musculus300704 T-------------------ACACCTCC--TCTTTGGATC---------- M_musculus300786 T-------------------ACACCTTC--TCTTAGGATC---------- M_musculus300787 CC------------------CCACTTCC--TCTCTGGATC---------- M_musculus300823 -----------GGCACTGCA-AACCTCC--TCTT-GAA----------GC M_musculus300924 CC------------------ACACCTCC--TCTCTGGATC---------- M_lucifugus300855 -----------GAGATGGTA-AAACTCC--TCTTTGGA----------TC M_lucifugus300856 -----------GAGATGGTA-AAACTCC--TCTTTGGA----------TC M_lucifugus300027 -----------GAGATGGTA-AAACTAC--TCTTTGGA----------TC M_lucifugus300035 -----------GAGATGGTA-AAACTCC--TCTTTGGA----------CC M_lucifugus300101 -----------GAGATGGTA-AAACTCC--TCTTTGGA----------TC M_lucifugus300177 -----------GAGATGGTA-AAACTCC--TCTTTGGA----------TC M_lucifugus300246 -----------GAGATGGTA-AAACTCC--TCTTTGGA----------TC M_lucifugus300495 T---------------GGTAAAA-CTCC--TCTTTGGACC---------- M_lucifugus300537 T---------------GGTAAAA-CTCC--TCTTTGGATC---------- M_lucifugus300624 -----------GAGATGGTA-AAACTCC--TCTTTGGA----------TC M_lucifugus300690 T---------------GGTAAAA-CTCC--TCTTTGGATC---------- M_lucifugus300708 T---------------GGTAAAA-CTCC--TCTTTGGATC---------- O_anatinus303218 A-------------------AAAACTCT--CCTCTGGATC---------- O_cuniculus300003 T---------------GGT-CGT-TTCT--TCTTTGGATC---------- O_cuniculus300028 C---------------TG-------------CCTGGAGTC---------- O_cuniculus300143 G---------------TGT-GAC-CTCT--TCTTTGGATC---------- O_cuniculus300155 C---------------TG-------------CCTGGAGTC---------- O_cuniculus300284 T---------------TGG-A---CCCC--GTCTGCAGTC---------- O_cuniculus300286 G---------------TGT-GAC-CTCT--TCTTTGGATC---------- O_cuniculus300362 T---------------TGT-CAG-CTCA--TCTTTGAATC---------- O_cuniculus300404 T---------------TGT-CAT-CTCC--TCTTTGGATC---------- O_cuniculus300435 T---------------TGT-CAC-CTCT--TCTTTGGTTC---------- O_cuniculus300510 T---------------GGT-CGT-TTCT--TCTTTGGATC---------- O_cuniculus300002 T------------GCTCGT-----TTCT--TCTTTGGATC---------- O_garnettii300102 ATAA----------------AA--CTCT--TCTTTGGATC---------- O_garnettii300481 T--------------TTTTAAAA-CTCC--TCTTTGGATC---------- O_garnettii300026 -----------GAGATTATA-AATCTTC--TCTTTGGG----------TC O_garnettii300162 TTT-----------------GAAACTCC--TCTTTGGATC---------- O_garnettii300084 ATAA----------------AA--CTCT--TCTTTGGATC---------- O_garnettii300054 TTT-----------------AAAACTCC--TCTTTGGATC---------- P_troglodytes300253 GCAA----------------AA--TTCC--TCTTTGAATC---------- P_troglodytes300314 GAA--------GAGACTGTG-AAACTCC--TCTTTGGA----------CC P_troglodytes300385 -----------GAGATTGTA-AAGCTCC--TCTTTAGA----------TC P_troglodytes300386 -----------GAGACTGGA-AAACTCC--TCTCTGGA----------TC P_troglodytes300464 -----------GACTGT--G-AA-CCCC--TCTCTGGA----------TC P_troglodytes300017 C---------------TGTGAAA-CTCA--TCTTAGAACC---------- P_troglodytes300091 -----------AAGAATGTA-AAGCTCC--TCTTTGGAGGAGCTAGACTC P_troglodytes300069 T---------------TGTAAAA-CTCC--TCTGTAGATC---------- P_troglodytes300149 T---------------TGTAAAA-CTTC--TCTTTGGATC---------- P_troglodytes300155 -----------GAGACTGGA-AAGCTCC--TCTTTGGA----------TC P_troglodytes300215 C---------------TGGAAAA-CTCC--TCTTTGGATC---------- P_pygmaeus300271 T---------------TGTAAAA-CTTC--TCTTTGGATC---------- P_pygmaeus300353 GCAA----------------AA--TTCC--TCTTTGGATC---------- P_pygmaeus300356 T---------------TGTAAAA-CTCC--TCTGTATATC---------- P_pygmaeus300367 C---------------TGGAAAT-CTCC--TTTTTGGATC---------- P_pygmaeus300421 -----------GAGACTGGA-AAGCTCC--TCTTTGGA----------TC P_pygmaeus300423 C---------------TGTGAAA-CTCA--TCTTAGAACC---------- P_pygmaeus300072 -----------GACTCTCTG-AA-CCCC--TCTCTGGA----------TC P_pygmaeus300096 -----------GAGAATGTA-AAGCTCC--TCTTTGGAGGAGCTGGACTC P_pygmaeus300135 -----------GAGATTGCA-AAGCTCC--TCTTTAGA----------TC P_pygmaeus300203 -----------GAGACTGGA-AAACTCC--TCTCTGGA----------TC R_norvegicus300671 T-------------------GCACCTCC--TCTTTGGTTC---------- R_norvegicus300463 A---------------CTGCA-C-CTCC--TCTTTGGATC---------- R_norvegicus300843 T-------------------GCACTTCC--TCTTTGGATC---------- R_norvegicus300901 CC------------------ACTCCTCC--TCTTTGGATC---------- R_norvegicus301001 -----------GGGACTGCA-AACCTCC--TCTT-GGC----------TC R_norvegicus301053 T-------------------GCACCTTC--TCTTTGGATC---------- R_norvegicus301063 T-------------------GCACCTCC--TCTTTGGATC---------- R_norvegicus300809 GTA---------------------TGCC--TCTTTGGATC---------- R_norvegicus300401 T-------------------ATACGTCC--TCTTTGAATC---------- R_norvegicus300361 T-------------------ACACCTCC--TCTTTGGATC---------- R_norvegicus300252 T-------------------GCACCTCC--TCTTTGGATC---------- R_norvegicus300229 T-------------------ACACCTCC--TCTTTGGATC---------- R_norvegicus300126 C-------------------ACTCCTCC--TCTTTGAATC---------- R_norvegicus300144 T-------------------ACACCTCC--TCTTTGGATC---------- R_norvegicus300083 T-------------------GCACCTCC--TCTTTGGATC---------- R_norvegicus300010 T-------------------GCAC-TCC--TCTTTAGATC---------- R_norvegicus300475 T-------------------GCACCTCC--TCTTTGGATC---------- R_norvegicus300570 T-------------------GCACCTCC--TCTTTGGATC---------- R_norvegicus300658 T-------------------GCACTTCC--TCTTTGGATC---------- S_cerevisiae300022 TGAGGTA---ATCCATCTTTAAAACCATCGCCGTTAGAGGTTGCTTC-TG S_araneus300689 --GA----------------AAAACTCC--T---TGGATC---------- S_araneus300842 GGCA----------------CA--GATC--CTCTTGGTTC---------- S_araneus300881 AGAA----------------AA--CTCT--T---TGGATC---------- S_araneus300938 GTA-----------------AAA-CTTC--TCTCTGGATC---------- S_araneus300035 GTAC----------------AAA-CTCC--TCCTTGGATC---------- S_araneus300052 C---------------TGGGACAAAC-----TTCTGGATCT--------- S_araneus300077 TTTATAATCCAAAGGTTATAAAA-TTTC--TCTTCGGATC---------- S_araneus300080 -----------AGCATTGTAAATCCTCT--CACTAGGG----------TT S_araneus301004 --AA----------------CA--TTCC--TCTCAGGATT---------- S_araneus300189 C--------------TGAAAAAA-TTCC--TCCTTAGAGC---------- S_araneus300272 ATAA----------------AA--CTTC--TCTTTGAGTG---------- S_araneus300283 GTAA----------------AAA-TTCC--TCCTTGGATT---------- S_araneus300302 ATAA----------------AAAGTTCC--TCTTTGGGTA---------- S_araneus300366 T---------------TGTAAAAGCTCC--TTCTTGGATC---------- S_araneus300377 GTAA----------------AA--CTCC--TCTTTGGATT---------- S_araneus300470 GTAA----------------AA--TTCT--TCTCTGGATC---------- S_araneus300608 ---------------TTGTAAAAACTTT--TCCTTGCA----------TC S_tridecemlineatus300203 GT------------------AGAACTCC--TCTTTGGATC---------- S_tridecemlineatus300218 TTAA----------------GA--CTCC--TCTTTAGATC---------- S_tridecemlineatus300039 -----------GAGATTGCA-AAACTCT--TCTTTGGA----------TC S_tridecemlineatus300164 C---------------TTAAAAA-CTCT-----CTATATC---------- T_nigroviridis300074 ---------------------AGTCGTCA-TGGC-GGATC---------- T_belangeri300014 -----------GAGATGATA-A-ACTCC--TCTTTGGA----------TC T_belangeri300159 -----------GAGATGATA-A-ACTCC--TCTTTGGA----------TC T_belangeri300192 -----------GAGATGATC-A-GCTCT--TCTTTGGA----------TC T_belangeri300220 -----------GAGATGATC-A-ACTCC--TCTTTGGA----------TC T_belangeri300331 -----------GAGACTGTA-A-AA-CT--CCTCTGGA----------AC T_belangeri300378 GTAA----------------AA--CTGC--TCTTGGGATC---------- C_familiaris300038 CTGTCTG----GAGTC-ACAGCC--------------------------- C_familiaris300096 CTGTCTG----GAGTC-ACAGCC--------------------------- C_porcellus300388 CTGTCTG----GAGTC-ACAGCT--------------------------- C_porcellus300424 TTGTGTG----AAGTC-ACAGCG--------------------------- C_porcellus300564 CTGTCTG----GAGTC-ACAGCT--------------------------- C_porcellus300616 CTGTCTG----GAGTC-ACAGGT--------------------------- D_rerio300277 CTGTCAC----AAGGC-ACATGT--------------------------- D_rerio300278 CTGTCGG----GAGAA-ACAACT--------------------------- D_novemcinctus300004 CTGTCTG----GAGTC-ACAGCT--------------------------- D_novemcinctus300069 -TGTCTG----AAGTC-ACAGCT--------------------------- D_novemcinctus300134 CTGTCTG----GAGTC-ACAGCT--------------------------- D_novemcinctus300226 CTATCTA----GAATT-GCAGCT--------------------------- D_novemcinctus300305 CCATCTG----GAGTT-ACGGCT--------------------------- D_novemcinctus300353 CTGTCTG----GAGTC-ACAGCT--------------------------- D_novemcinctus300356 CTGTCTG----GAATC-ATAGCT--------------------------- D_novemcinctus300614 CTGTCTG----GAGTC-ACAGCT--------------------------- D_novemcinctus300615 CTGTCTG----GAGTC-ACAGCT--------------------------- D_melanogaster300121 CTACCTGAACCTTGGC-ACAAAG--------------------------- D_melanogaster300122 CTACCTGTAGCCTGGC-ACAGAT--------------------------- E_telfairi300086 CTGTCTG----GAGTC-ACAACT--------------------------- E_telfairi300115 CTGTCTG----GAGTC-ACAACT--------------------------- E_telfairi300178 CTGTCTG----GAGGC-ACAGCT--------------------------- E_telfairi300184 CCATCTG----GAGTC-ACAGCT--------------------------- E_telfairi300295 CTGTCTG----GAGTC-ATAACT--------------------------- E_telfairi300318 CTGCATG----GAACT-ATAGCG--------------------------- E_telfairi300340 CTGTCTG----GAGAC-AGAGCT--------------------------- E_telfairi300402 CTGCCTG----GAGTC-TTAACG--------------------------- E_telfairi300433 CTGTCTG----GAGTC-ACAACT--------------------------- E_telfairi300475 CTGTCTG----GAGTC-ACAAAT--------------------------- E_telfairi300487 CTGTCTG----GAGTC-ACAGCT--------------------------- E_telfairi300593 CTGTCTG----GAGTC-ACAACT--------------------------- E_telfairi300640 CTATCTG----GAGTC-ACAAGT--------------------------- E_telfairi300673 CTGTCTG----GAGTC-ACAACT--------------------------- E_telfairi300734 AAAC--------AACC-A-AACT--------------------------- E_telfairi300741 CTGTCTG----AAGTC-CCAGCT--------------------------- E_telfairi300764 CTGTCTG----GAGTC-ACAACT--------------------------- E_telfairi300765 CTGTCTA----GAGTT-ATAGCT--------------------------- E_caballus300070 CTATCTG----GAGTC-ATAGCT--------------------------- E_caballus300254 CTGTCTG----GAGTC-ACAGCT--------------------------- E_europaeus300034 CTGCCTG----GAAAT---------------------------------- E_europaeus300117 CTGTCTG----GTGTC-ACAATT--------------------------- E_europaeus300122 CTGCCTG----GAAAT---------------------------------- E_europaeus300204 TTGTCTG----AAGTG-ACAGTT--------------------------- E_europaeus300219 CTATCTG----GACCC-AAGAAA--------------------------- E_europaeus300239 CTGTCTG----GAATT-ACAGTT--------------------------- E_europaeus300272 CTGTCTG----GAGTT-GCAGTA--------------------------- E_europaeus300346 CTGTCTG----CAGTC-ACAGTA--------------------------- E_europaeus300352 TTGTCTG----GAGTC-ATAGCT--------------------------- E_europaeus300375 TTGTCTG----AAGTG-ACAGTT--------------------------- E_europaeus300380 CTGTCTG----GAATC-TTAGTA--------------------------- E_europaeus300383 CTGTCTG----GAGTT-ACAGTT--------------------------- E_europaeus300388 --GTCTG----AAGTC-ATAATT--------------------------- E_europaeus300389 TTGTCTG----GAGTC-ACAGTT--------------------------- E_europaeus300428 CTGTCTG----GAGTT-ACAGTT--------------------------- E_europaeus300433 CTGTCTG----GGATC-ATTGTT--------------------------- E_europaeus300454 -TGTCTG----GAGTC-ACAGTT--------------------------- E_europaeus300464 CTGTCTG----GAGTC-ACAGTA--------------------------- E_europaeus300544 CTGTCTG----GAATC-ACAGTT--------------------------- E_europaeus300549 CTGTCTG----GAGTC-ACAGTA--------------------------- E_europaeus300591 CCATCTT----GATTC-ACAGTT--------------------------- E_europaeus300701 CTGTCTG----GAATA-AATGCT--------------------------- E_europaeus300721 CTGTCTG----CAGAT-ACAGTA--------------------------- F_catus300053 CTGTCTG----GAGTC-ACAGCG--------------------------- H_sapiens300058 CTGTCTG----GAGTC-ACAACT--------------------------- H_sapiens300480 TTGTATG----GAGTC-ACAGCT--------------------------- L_africana300063 CTGTCTG----GAGTC-ACAGCT--------------------------- L_africana300379 CTGTCTG----GAGTC-ACAGTG--------------------------- L_africana300481 CTCTCTG----GAGTT-ACAACT--------------------------- M_mulatta300012 CTGTCTG----GAGTC-ACAGCT--------------------------- M_mulatta300195 CTATCTG----GAGTC-ACAGCT--------------------------- M_mulatta300271 CTGTCTA----TAGTC-GCAGGT--------------------------- M_mulatta300286 CCATCTG----GAGCC-ATAGCA--------------------------- M_mulatta300298 CTGCCTG----GAGTC-ACAGCT--------------------------- M_mulatta300376 TTGTATG----GAGTC-ATAGCC--------------------------- M_mulatta300391 CTGTCTG----AAGTC-ACAGCT--------------------------- M_mulatta300408 CTGTCTG----GAGTC-ACAGCT--------------------------- M_mulatta300476 ATGTCTG----GAGTT-ACAGCT--------------------------- M_mulatta300480 CTTTCTG----GAGTC-ACACCT--------------------------- M_mulatta300488 CTGTCTG----GAGTC-ACAGCT--------------------------- M_murinus300225 CTGTCTG----GAGTC-ACAGCT--------------------------- M_murinus300268 CTGTCTG----GAGTC-ACAGCG--------------------------- M_murinus300303 CTGTCTG----GAGTC-ACAGCT--------------------------- M_murinus300410 CTGTCTG----GAGTC-ACAGCT--------------------------- M_domestica300024 CTGTCTG----GAGTT-ACAGTT--------------------------- M_musculus300704 CTGTCTG----GAGTC-ACAAGT--------------------------- M_musculus300786 CTGTCTG----GAGTC-ACAGAT--------------------------- M_musculus300787 CTGTCTG----GAGTC-ACAGCT--------------------------- M_musculus300823 CTTTTTG----AAGCC-ACAGCT--------------------------- M_musculus300924 CTGTCTG----GAGTC-ACAGCT--------------------------- M_lucifugus300855 CTGTCTG----GAGTC-ACAGCT--------------------------- M_lucifugus300856 CTGTCTG----GAGTC-ACAGCT--------------------------- M_lucifugus300027 CTGTCTG----GAGTC-ACAGCT--------------------------- M_lucifugus300035 CTGTCTG----GAGTC-ACAGTT--------------------------- M_lucifugus300101 CTGTCTG----GAGTC-ACAGCT--------------------------- M_lucifugus300177 CTGTCTG----GAGTC-ACAGCT--------------------------- M_lucifugus300246 CTGTCTG----GAGTC-ACAGCT--------------------------- M_lucifugus300495 CTGTCTG----GAGTC-ACAGTT--------------------------- M_lucifugus300537 CTGTCTG----GAGTC-ACAGCT--------------------------- M_lucifugus300624 CTGTCTG----GAGTC-ACAGCT--------------------------- M_lucifugus300690 CTGTCTG----GAGTC-ACAGCC--------------------------- M_lucifugus300708 CTGTCTG----GAGTC-ACAGCT--------------------------- O_anatinus303218 CTGTCGG----GAGGC-ACACTG--------------------------- O_cuniculus300003 CTGTCTG----GAGTC-AACAGA--------------------------- O_cuniculus300028 ACAGCT-------------------------------------------- O_cuniculus300143 CTGTCTG----GAGTC-ACAGCT--------------------------- O_cuniculus300155 ACAGCT-------------------------------------------- O_cuniculus300284 ACAGCT-------------------------------------------- O_cuniculus300286 CTGTCTG----GAGTC-ACAATT--------------------------- O_cuniculus300362 CTGTCTG----GAGTC-ACAGCT--------------------------- O_cuniculus300404 CTGTCTG----GAGAT-ACAGCT--------------------------- O_cuniculus300435 CTGTCGA----GTCAC-AGCT----------------------------- O_cuniculus300510 CTGTCTG----GAGTC-A-CAAAT-------------------------- O_cuniculus300002 CTGTCTG----GAGTC-ACAAAT--------------------------- O_garnettii300102 CTGTCTG----GAGTC-ACAGCT--------------------------- O_garnettii300481 CTGTCTG----GAGTC-ACAGCT--------------------------- O_garnettii300026 CTATCTG----GAGAC-ACAAGT--------------------------- O_garnettii300162 CTGTCTG----GAGTC-ACAGCT--------------------------- O_garnettii300084 CTGTCTG----GAGTC-ACAGCT--------------------------- O_garnettii300054 CTGTCTG----GAGTC-ACAGCT--------------------------- P_troglodytes300253 ATGTCTG----GAAAC-ACAGCT--------------------------- P_troglodytes300314 CCATCTG----GAGCC-ACAGCA--------------------------- P_troglodytes300385 CTTTCTG----GAGTC-ACACCT--------------------------- P_troglodytes300386 CTGCCTG----GAGTC-ACAGCT--------------------------- P_troglodytes300464 CTGTCTG----GAGTC-ACAGCT--------------------------- P_troglodytes300017 TTGTATG----GAGTC-ACAGCT--------------------------- P_troglodytes300091 CTGTCCG----GAGTC-ACAGCT--------------------------- P_troglodytes300069 CTGTCTG----GAGTC-ACAGCT--------------------------- P_troglodytes300149 CTGTCTG----GAGTC-ACAGCT--------------------------- P_troglodytes300155 CTGTCTG----GAGTC-ACAACT--------------------------- P_troglodytes300215 CTGTCTA----TAGTC-ACAGGT--------------------------- P_pygmaeus300271 CTGTCTG----GAGTC-ACAGCT--------------------------- P_pygmaeus300353 ATGTCTG----GAGTC-ACAGCT--------------------------- P_pygmaeus300356 CTGTCTG----GAGTC-ACAGCT--------------------------- P_pygmaeus300367 CTGTCTA----TAGTC-ACAGGT--------------------------- P_pygmaeus300421 CTGTCTG----GAGTC-ACAACT--------------------------- P_pygmaeus300423 TTGTATG----GAGTC-ACAGCT--------------------------- P_pygmaeus300072 CTGTCTG----GAGTC-ACAGCT--------------------------- P_pygmaeus300096 CTGTCTG----GAGTC-ACAGCT--------------------------- P_pygmaeus300135 CTTTCTG----GAGTC-ACACCT--------------------------- P_pygmaeus300203 CTGCCTG----GAGTC-ACAGCT--------------------------- R_norvegicus300671 CTGTCTG----GAGTT-ACAGAT--------------------------- R_norvegicus300463 CTGTCTG----GAGTC-ACAAAT--------------------------- R_norvegicus300843 CTGTCTGACTGGAGTC-ACAGAT--------------------------- R_norvegicus300901 CTGTCTG----GAGTC-ACAGTT--------------------------- R_norvegicus301001 CTTCT-G----AAGCC-ACAGCT--------------------------- R_norvegicus301053 CTGTCTG----GAGTC-ACAGAT--------------------------- R_norvegicus301063 CTGTCTG----GAGTC-ACAGAT--------------------------- R_norvegicus300809 CTGTGTG-----GGAGAAAAAT---------------------------- R_norvegicus300401 CTGTCTG----GAGCC-ACAGAT--------------------------- R_norvegicus300361 CTGTCTG----GAGTC-ATCAAT--------------------------- R_norvegicus300252 CTGTCTG----GAGTC-ACAGAT--------------------------- R_norvegicus300229 CTGTCTG----GAGTC-ACAGAT--------------------------- R_norvegicus300126 CTCTGTCT---GAGTG-ACAGTT--------------------------- R_norvegicus300144 CTGTCTA----GAGTC-ACAGAA--------------------------- R_norvegicus300083 CTGTCTG----GAGTC-ACAGAT--------------------------- R_norvegicus300010 CTGTCTG----GAGTC-ACAGAT--------------------------- R_norvegicus300475 CTGTCTG----GAGTC-ACAGAT--------------------------- R_norvegicus300570 CTGTCTG----GAGTC-ACAGAT--------------------------- R_norvegicus300658 CTGTCTG----GAGTC-ACAGAT--------------------------- S_cerevisiae300022 ATATTTTCGGTTAAGCGACCCATGAAATGGTGATGACCTGAGGTATGGAA S_araneus300689 CCGTCTG----GATGC-AAGA----------------------------- S_araneus300842 TTGTCTA----GAATT-AGAATA--------------------------- S_araneus300881 CTGTCCA----GAGGC-ACAGAA--------------------------- S_araneus300938 CTGTCTG----GAGCC-ACATCT--------------------------- S_araneus300035 CTGTCTG----AAGCC-ACAGCT--------------------------- S_araneus300052 CTGTCTG----GATTC-ATAGCC--------------------------- S_araneus300077 CTGTCTG----GGGTT-GCAGCA--------------------------- S_araneus300080 CTTTCAG----GAGTC-ATGGCC--------------------------- S_araneus301004 ATGTCTG----GAGTC-ACAGTG--------------------------- S_araneus300189 CTGTCTG----GAGTC-ACAGGC--------------------------- S_araneus300272 CTTTCTG----GAGCT-ACAGTG--------------------------- S_araneus300283 CTGTCTG----GAGTC-ACAGCC--------------------------- S_araneus300302 CTGGATG----CAGTC-AAGAGG--------------------------- S_araneus300366 CTGTCTG----GAGTT-ACAGCC--------------------------- S_araneus300377 CCGCCTG----GAGAC-AAACTG--------------------------- S_araneus300470 CTGTCTG----GAGTC-AAAGTG--------------------------- S_araneus300608 CTGTTTG----GAGTC-ACAGCC--------------------------- S_tridecemlineatus300203 CTGGCCG----GTGTC-ACAGCT--------------------------- S_tridecemlineatus300218 CTCTCTG----GTGTT-ATTATA--------------------------- S_tridecemlineatus300039 CTGCCTG----GAGTT-ACCAAT--------------------------- S_tridecemlineatus300164 CTGTCTG----GAGTT-ACAGTT--------------------------- T_nigroviridis300074 CTGTCGG----GAGAA-ACAAAC--------------------------- T_belangeri300014 CTGTCTG----GAGTCCACACCT--------------------------- T_belangeri300159 CTGTCTG----GAGTC-ACAACT--------------------------- T_belangeri300192 CTGTCTG----GAGTC-ACAACT--------------------------- T_belangeri300220 CTGTCTG----GAGTC-ACAGCT--------------------------- T_belangeri300331 CTGTCTG----GAGTC-ACAACT--------------------------- T_belangeri300378 CTGTCTG----GAGTC-AGAGCT--------------------------- C_familiaris300038 ----- C_familiaris300096 ----- C_porcellus300388 ----- C_porcellus300424 ----- C_porcellus300564 ----- C_porcellus300616 ----- D_rerio300277 ----- D_rerio300278 ----- D_novemcinctus300004 ----- D_novemcinctus300069 ----- D_novemcinctus300134 ----- D_novemcinctus300226 ----- D_novemcinctus300305 ----- D_novemcinctus300353 ----- D_novemcinctus300356 ----- D_novemcinctus300614 ----- D_novemcinctus300615 ----- D_melanogaster300121 ----- D_melanogaster300122 ----- E_telfairi300086 ----- E_telfairi300115 ----- E_telfairi300178 ----- E_telfairi300184 ----- E_telfairi300295 ----- E_telfairi300318 ----- E_telfairi300340 ----- E_telfairi300402 ----- E_telfairi300433 ----- E_telfairi300475 ----- E_telfairi300487 ----- E_telfairi300593 ----- E_telfairi300640 ----- E_telfairi300673 ----- E_telfairi300734 ----- E_telfairi300741 ----- E_telfairi300764 ----- E_telfairi300765 ----- E_caballus300070 ----- E_caballus300254 ----- E_europaeus300034 ----- E_europaeus300117 ----- E_europaeus300122 ----- E_europaeus300204 ----- E_europaeus300219 ----- E_europaeus300239 ----- E_europaeus300272 ----- E_europaeus300346 ----- E_europaeus300352 ----- E_europaeus300375 ----- E_europaeus300380 ----- E_europaeus300383 ----- E_europaeus300388 ----- E_europaeus300389 ----- E_europaeus300428 ----- E_europaeus300433 ----- E_europaeus300454 ----- E_europaeus300464 ----- E_europaeus300544 ----- E_europaeus300549 ----- E_europaeus300591 ----- E_europaeus300701 ----- E_europaeus300721 ----- F_catus300053 ----- H_sapiens300058 ----- H_sapiens300480 ----- L_africana300063 ----- L_africana300379 ----- L_africana300481 ----- M_mulatta300012 ----- M_mulatta300195 ----- M_mulatta300271 ----- M_mulatta300286 ----- M_mulatta300298 ----- M_mulatta300376 ----- M_mulatta300391 ----- M_mulatta300408 ----- M_mulatta300476 ----- M_mulatta300480 ----- M_mulatta300488 ----- M_murinus300225 ----- M_murinus300268 ----- M_murinus300303 ----- M_murinus300410 ----- M_domestica300024 ----- M_musculus300704 ----- M_musculus300786 ----- M_musculus300787 ----- M_musculus300823 ----- M_musculus300924 ----- M_lucifugus300855 ----- M_lucifugus300856 ----- M_lucifugus300027 ----- M_lucifugus300035 ----- M_lucifugus300101 ----- M_lucifugus300177 ----- M_lucifugus300246 ----- M_lucifugus300495 ----- M_lucifugus300537 ----- M_lucifugus300624 ----- M_lucifugus300690 ----- M_lucifugus300708 ----- O_anatinus303218 ----- O_cuniculus300003 ----- O_cuniculus300028 ----- O_cuniculus300143 ----- O_cuniculus300155 ----- O_cuniculus300284 ----- O_cuniculus300286 ----- O_cuniculus300362 ----- O_cuniculus300404 ----- O_cuniculus300435 ----- O_cuniculus300510 ----- O_cuniculus300002 ----- O_garnettii300102 ----- O_garnettii300481 ----- O_garnettii300026 ----- O_garnettii300162 ----- O_garnettii300084 ----- O_garnettii300054 ----- P_troglodytes300253 ----- P_troglodytes300314 ----- P_troglodytes300385 ----- P_troglodytes300386 ----- P_troglodytes300464 ----- P_troglodytes300017 ----- P_troglodytes300091 ----- P_troglodytes300069 ----- P_troglodytes300149 ----- P_troglodytes300155 ----- P_troglodytes300215 ----- P_pygmaeus300271 ----- P_pygmaeus300353 ----- P_pygmaeus300356 ----- P_pygmaeus300367 ----- P_pygmaeus300421 ----- P_pygmaeus300423 ----- P_pygmaeus300072 ----- P_pygmaeus300096 ----- P_pygmaeus300135 ----- P_pygmaeus300203 ----- R_norvegicus300671 ----- R_norvegicus300463 ----- R_norvegicus300843 ----- R_norvegicus300901 ----- R_norvegicus301001 ----- R_norvegicus301053 ----- R_norvegicus301063 ----- R_norvegicus300809 ----- R_norvegicus300401 ----- R_norvegicus300361 ----- R_norvegicus300252 ----- R_norvegicus300229 ----- R_norvegicus300126 ----- R_norvegicus300144 ----- R_norvegicus300083 ----- R_norvegicus300010 ----- R_norvegicus300475 ----- R_norvegicus300570 ----- R_norvegicus300658 ----- S_cerevisiae300022 CATCT S_araneus300689 ----- S_araneus300842 ----- S_araneus300881 ----- S_araneus300938 ----- S_araneus300035 ----- S_araneus300052 ----- S_araneus300077 ----- S_araneus300080 ----- S_araneus301004 ----- S_araneus300189 ----- S_araneus300272 ----- S_araneus300283 ----- S_araneus300302 ----- S_araneus300366 ----- S_araneus300377 ----- S_araneus300470 ----- S_araneus300608 ----- S_tridecemlineatus300203 ----- S_tridecemlineatus300218 ----- S_tridecemlineatus300039 ----- S_tridecemlineatus300164 ----- T_nigroviridis300074 ----- T_belangeri300014 ----- T_belangeri300159 ----- T_belangeri300192 ----- T_belangeri300220 ----- T_belangeri300331 ----- T_belangeri300378 -----

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved