snOPY snoRNA Orthological Gene Database

Family: SNORA23

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300477 -------GCTGTAA-TGTG-TGCATGGTTTT-TGTCTGTGTCTGATAGCA C_porcellus300917 -------ACTGTAA-TGTG-TGCATAGTTTC-AGTCTGTGTCTGGTAGCA D_rerio300118 -----------TGAATGGTGTGCGTGGTATC-CGTCTGCGTTTAGTGCCG D_rerio300119 ---------GGTGAATGGTGTGCGTAGTGTC-CGTCTGCGTTTAGTGCCG D_novemcinctus300575 -------GCTGTAA-TGTG-TGCATAGTTT--CATCTATGTCTGGTAGCA D_melanogaster300227 ------------------------------------------CGGGCGAA E_telfairi300694 -------GCTGTAA-TGTG-TGCATAGTTTT-CATCTATGTCTGGTAGCA E_telfairi300813 -------GCTGTAA-TGTG-TGCATAGTTTT-CATCTATGTCTGGTAGCA E_caballus300309 --------CTGTAAATGTG-TGCATAGTTTC-CGTCTGTGTCTGATAGCA E_europaeus300202 -------CTGGTCA-TGTG-TACCCAGTTTG-CATCTGTGTCTGATAGCA E_europaeus300217 -------GCATTCA-TTTT-TGC-TGTTTTT-TATCTGTGTCTGACTGCA E_europaeus300306 --------------AGTGAATACTAAATGTGGTGTTTCCCTCTGAGAAAT E_europaeus300395 -------GCATTCA-TTTT-TGC-TGTTTTT-TATCTGTGTCTGACTGCA E_europaeus300407 -------GCTGTAA-TGTG-CGCACAGTTTT-CACCTGTGTCTGGTAGCA E_europaeus300441 -------GTGGTAA-AATG-TGCACGGTTTT-TATCTGTGTCTGATAGCC E_europaeus300581 -----------------------TCAACAAATAAATTAAATTAAAAATAA E_europaeus300597 -------ATGGTCA-TGTG-TGCACAGTTTG-CATCTGTGTCTGGTAGCA E_europaeus300613 --------TTATGA-CTTAATGCACAGTTTC-CATCTGT--CTGATAGCA E_europaeus300654 -------TAATTAA-TGTG-TGCACAGTTTT-TATCTGTGTCTGGTAGCA H_sapiens300735 CATGGCTGCTGTAA-TGTG-TGCATAGGTTT-CATCTGTGTCTGGTAGCA M_mulatta300649 -------GCTGTAA-TGTG-TGCATAGGTTT-CATCTGTGTCTGGTAGCA M_murinus300482 -------TTTGTAA-TGTG-TGCATAGTTTT-CATCTATGTTTGCTAGCA M_murinus300515 -------GTTTTAA-TGTG-TGCATAGTTTC-TATCTATGACTGGTAGCA M_domestica300017 --------CAGCCTTTGTG-TGCATAGCTTC-CATCTGTGTCTGGTAGCA M_domestica300176 --------CAGCCTTTGTG-TGCATAGCTTC-CATCTGTGTCTGGTAGCA M_domestica300177 --------CAGCCTTTGTG-TGCATAGCTTC-CATCTGTGTCTGGTAGCA M_musculus300764 -------TGAGTCC-TGTG-TGCATAGTTTT-CATCTATGTCTGGTAGCA O_anatinus302294 -------GCAGCAAT-GTG-TGCATAGTTGT-CATCTGTGTCTGGTAGC- O_cuniculus300063 -------GCTATAA-TGTG-TGCATAGCTTT-AATCTGTGTCTGGTAGCA O_cuniculus300455 -------GCTATAA-TGTG-TGCATAGCTTT-AATCTGTGTCTGGTAGCA O_garnettii300343 -------GTTGTAA-CGTC-TGCATAGTTCT-CATCTATGGCTGGTAGCA O_garnettii300605 -------GTTGTAA-CGTG-TGCATAGTTTTTCATCTATGACTGGTAGCA P_troglodytes300661 -------GCTGTAA-TGTG-TGCATAGGTTT-CATCTGTGTCTGGTAGCA P_pygmaeus300291 -------GCTGTAA-TGTG-TGCATAGGTTT-CATCTGTGTCTGGTAGCA R_norvegicus301088 -------CTAGTGC-TGTG-TGCATAGTTGT-CATCTATGTCTGGTAGCA S_araneus300172 ------CGCT-TAA-CATG-TGCATAGTTTT-CACCTGTGTCTGGTAGCA S_araneus300946 -------GCTTTAA-TGTG-TGCATAGTTTT-CATCTGTGTATGATAGCA S_araneus300965 -------GCTGTGT-TGTG-TGCATAGTTTT-TGTCTGTGTCATGTAGCA S_araneus300999 -------GCTGTCA-CGTG-TGCATGGCGTT-CATCCATGTCTGATCGCA S_tridecemlineatus300272 -------GCTATAA-TGTG-TGCATGGTTTT-CATCTGTGTCTGGTAGCA T_nigroviridis300019 ---------GGTGAACGGTGTGCACAGTGGC-CGTCTGTGTCATGTGTGG X_tropicalis300099 ---------GCAGGCCTGTGTGCACAGTGTC-AGTCTGTGTCT-GTGGAG X_tropicalis300100 --------CAGGCCCAGTG-TGCGCAGTGTC-AGTCTGTGTTT-GTGGAG C_familiaris300477 GTGTCTGCCTGTGTTTTGCATTCAG-ATCTTGCTATCCACACA-AATGTC C_porcellus300917 GTATCTGTTTGTGTTTTGCATTCAG-ATCTTGCTATCCACACA-AAC--- D_rerio300118 TCTCTGGTCTGTGTCTTACAGGCTGTGGGACGGTTCTCACACC---GCAC D_rerio300119 TCTCCGGTCTGTGTCTTACAGGCTGTGGGACGGTTCTCACACC---GCAC D_novemcinctus300575 ATGTCTGTCTGTGTTTTGCATTCAG-AGCTTGCTATCCACACA-A-TGCC D_melanogaster300227 TCTGATATCGTGGTTGGGCATTCAACCAGTCGCT--CCACAGT-ATCAAT E_telfairi300694 GTATCTGTTTGTGTTTTACATTCAG-ATCTTGCTGCCCACACA-AATACT E_telfairi300813 GTATCTGTTTGTGTTTTACATTCAG-ATCTCGCTGTCCACACA-AATACT E_caballus300309 GTGTCTGTCTGTGTTTTGCATTCAG-ATCTTGCTATCCACACA-AACATC E_europaeus300202 GAGTCTGCCTGCATCTTGCATTCAG-ACCCTGTTATCCACACA-AACACC E_europaeus300217 GTGTCCATCTGTATTTTGCATTCAG-ATCTAACC--TCACAAT-AA---- E_europaeus300306 AT---CATGATCAGAATATACTAGAGAGCTTGCTATTTGCACA-AACAAC E_europaeus300395 GTGTCCATCTGTATTTTGCATTCAG-ATCTAACC--TCACAAT-AA---- E_europaeus300407 GT--CTATCTCTGTTTTAAATTCAG-ATCTTGCTATCCACACA-AGCAAT E_europaeus300441 ACGTCTGCCTGTGCTTTGCATTCAG-ATCTTGTCATCCACACA-AACACC E_europaeus300581 AT---TTGCAGTGTAAGATACTTTCCTTAAAGTCCTTTACACA-AACACC E_europaeus300597 GTGTCTGTCTGTGTTTTGCATTCAG-ATTTTGTTATCCACACA-AAAGCC E_europaeus300613 G----TGCCTGTATTTTGCATTCAG-ATCTTGCTGTCCACACA-AACAGT E_europaeus300654 GTGTCTGTCTGTGTTTTGCATTCAG-ATCTTGCTATCCACACA-AGCAAC H_sapiens300735 GTGTCTGTCTGTGTTTTTCATTCAG-ATCTTGCTATCCACACA-AACATC M_mulatta300649 GTGTCTGTCTGTGTTTTGCATTCAG-ATCTTGCTATCCACACA-AACGTC M_murinus300482 GTATCCAT----GTTTTGCATTCAG-ATCTTGCTATCCACACA-GTCATC M_murinus300515 GTGTCTGTCTGTGTTTTGCATTCAG-ATCTTGCTATCCACACA-GATGTC M_domestica300017 TTGTCTGTTTGTGTTTTGCATTCAG-ATGCTGCTGCCCACATATAA--TC M_domestica300176 TTGTCTGTTTGTGTTTTGCATTCAG-ATGCTGCTGCCCACACATAA--TC M_domestica300177 TTGTCTGTTTGTGTTTTGCATTCAG-ATGCTGCTGCCCACACATAA--TC M_musculus300764 GTATCTGTCTGCGTTTTGCATTCAG-ATCTTGCTATCCACACA-AACGA- O_anatinus302294 TAGTCTGTTTGCGTTTTGCATCCAG-ACTTTGCTATCCACACGTA---CC O_cuniculus300063 GTGTCTGTCTGTGTTTTGCATTCAG-ATGTTGTTACTCACACATAATGTC O_cuniculus300455 GTGTCTGTCTGTGTTTTGCATTCAG-ATGTTGTTACTCACACATAATGTC O_garnettii300343 GTGTCTGT----GTTTTGCGCGAAG-ATCTTGCTATCCACACA-AACGTC O_garnettii300605 GTGTCTGTCTGTGTTTTGCATGCAG-ATCTTGCTATCCACACA-AACATC P_troglodytes300661 GTGTCTGTCTGTGTTTTGCTTTCAG-ATCTTGCTATCCACACA-AATATC P_pygmaeus300291 GAGTCTGTCTGTGTTTTGCATTCAG-ATCTTGCTATCCACACA-AACGTC R_norvegicus301088 GTTTCTGTCTGTGTTTTGCATTCAG-ATCTTGCTATCCACACA-AAAGA- S_araneus300172 GTACCTAT----GTTTTGCATTCAG-ATCTTGCCATTCACACA-AACATC S_araneus300946 ATATCTGTTTGTGTTTTGCATTCAG-ATCTTGCTATTCACACA-TACATC S_araneus300965 GTGTCTATCTGTGTTCTGCATTCAG-ACCCCGCTACTCACACA-AACATC S_araneus300999 GTTCCTGTCTGTGTTTTGCATTCAG-GTCTTGCTATCCACACA-AACCTC S_tridecemlineatus300272 ATGTCTGTCTGTGTTTTGCATTCAG-ATCTTGCTATCCACACA-AATGTA T_nigroviridis300019 TTGCGGGGCTGCGTTTTGCAGACTGGGCAGCACCACTCACACC---ACAC X_tropicalis300099 CAGCTGGTATGTGTTTTTCATGCCG-GCAGTTTCATACACACG---TCCC X_tropicalis300100 CTGCTCGCTTGCGTTCTGCATTCTG-GCAGCGCCATACACACG---CAAC ** C_familiaris300477 ATGCAGCCAAAGAGTAAGT-TGGGATCATAGTACTGG-TCTAGTGT--TG C_porcellus300917 ATGCAGCCAGAGAATAACT-TGGGATCATAGTACTGG-TCTAGTGT--TG D_rerio300118 TCACGGCCACAGAGCCACC-GGAGATCATAGTACTGG-CCTAGTGT---- D_rerio300119 TCACGGCCACAGAGCCACC-GGAGATCATAGTACTGG-CCTAGTGT---- D_novemcinctus300575 ATGCAGCCAGAGAGTAACT-TGGGGTCATAGTACTGG-TCTAGTAT--TG D_melanogaster300227 GATTTGCC-CAGATAAAACGTATTCTCATAGTACAA--TTTGTTGG--TA E_telfairi300694 CTGCAGCCATAGAGTAACT-TGGGATCATAGTACTGG-TCTAGTGC--TG E_telfairi300813 CTGCAGCCTTAGAGTAACT-TGGGATCATAGTACTGG-TCTAGTGT--TG E_caballus300309 ATGCAGCCAAAGAGTAAGT-TGGGATCATAGTACTGG-TCTAGTGT--TG E_europaeus300202 ATGCAGCCAAAGAGTAAGG-TGGGGTCATAGTACTGG-CTTCGTGC--TG E_europaeus300217 --GCAGCTAGGGAGTAAAC-TGGTATCATAGTGCTGG-TTTAGTGT--TG E_europaeus300306 ATGTAGCCAAAGAGTAAAT-TGGGATCATAGTACTGG-TCTAGAGTG--- E_europaeus300395 --GCAGCTAGGGAGTAAAC-TGGTATCATAGTGCTGG-TTTAGTGT--TG E_europaeus300407 ATGCAGCCAGAGAGTAAGT-TGGGATCATAGTACTGG-TTTAGTGT--TG E_europaeus300441 ATGCAGCCGAAGAGTAAGT-TATGGTCATAGTACTGG-CTTCATGC--TG E_europaeus300581 ATACAGCCAAAGAGTAAGT-TGGGGTCATAGTACTGG-TTTCGTGTTGTC E_europaeus300597 ATGCAGCCAAAGAGTAATT-TGAGGTCATAGTACTGG-CTCTGTGC--TG E_europaeus300613 AGGCAGCCAGAGAGTAAGT-TGGAATCATAGTTTTGG-CCTGGTGT--TG E_europaeus300654 ATGCAGCCAGAGAATAAGT-TGGGATCATAGTACTGG-TTTAGTGT--TG H_sapiens300735 ATGCGGCCAAAGAGTAACT-TGGGATCATAGTACTGG-TCTAGTGT--TG M_mulatta300649 ATGCAGCCAAAGAGTAACT-TGGGATCATAGTACTGG-TCTAGTGT--TG M_murinus300482 ATGCAGCCAAAGAGTAACT-TGGGATCATAGTCCTGG-TCTAGTGT--TG M_murinus300515 ATGCAGCCAAAGAGTAACT-TGGGATCATAGTACTGG-TCTAGTGT--TG M_domestica300017 CTGCAGCCAGAAAGAAAAA-TGGGATCATAGTACTGG-CCTAGTGA--TG M_domestica300176 CTGCAGCCAGAAAGAAAAA-TGGGATCATAGTACTGG-CCTAGTGA--CG M_domestica300177 CTGCAGCCAGAAAGAAAAA-TGGGATCATAGTACTGG-CCTAGTGA--CG M_musculus300764 ATGCAGCCAAAGAATAAGT-TGGGATCATAGTACTGG-CCTAGTGT--TG O_anatinus302294 CTGCGGCCAAAGATGAACC-TGGGATCATAGTACTGG-TCTAGTGA--AG O_cuniculus300063 ATGCAGCCAAAGAATAACA-TGGGATCATAGTACTGG-TCTAGTGT--TG O_cuniculus300455 ATGCAGCCAAAGAATAACA-TGGGATCATAGTACTGG-TCTAGTGT--TG O_garnettii300343 ATGCAGCCCAAGAGAAGCT-TGGGATCTTAGGACTGG-TCTAGTGT--TG O_garnettii300605 ATGCAGCCAAAGAGAAACT-TGGGATCATAGTACTGGGTATAGTGT--TG P_troglodytes300661 ATGCGGCCAAAGAGTAACT-TGGGATCATAGTACTGG-TCTAGTGT--TG P_pygmaeus300291 ATGCAGCCAAAGAGTAACT-TGGGATCATAGTACTGG-TCTAGTGT--TG R_norvegicus301088 GTGCAGCCAAAGAATAACT-TGGGATCATAGTACTGG-TCTAGTGT--TG S_araneus300172 AA--------AGAGAAACCCTAGAATCATAGTACTGG-CCTGGTGT--TG S_araneus300946 AAGCAGCCAGAGAGTAAACTTGGGATCATAGTACTGG-TCTAGTGT--TG S_araneus300965 AAGCCGTCGGAGAATAAACTTGGGATCAGAGTACTGG-CCAAGTGTG-TG S_araneus300999 ATGCAGCCGGAGATTAAGT-TGGGATCGTAGTACTGG-CCTAGTGT--TG S_tridecemlineatus300272 TTGTAGCCAAAGAGTAACT-TGGGATCATAGTACTGG-TCTAGTGT--TG T_nigroviridis300019 CTGCAGCCACAGAACAACA-GGAGATCATAGTACTGG-CCCTAGAC---- X_tropicalis300099 CTGCAGCCCAAGACTAACA-TGAGATCATAGTACTGG-TCTAGTGA---- X_tropicalis300100 CTGCGGCCAGAGATCAACG-TGAGATCATAGTACTGG-TCTAGTGA---- * ** ** C_familiaris300477 TCTCTCTG-GACATAACCTGCCACTGACCAGCCTCCAAATTCCCATACAC C_porcellus300917 TTCTTTTG-GACACA-TCTACCACTGGCCAGCCTCCAAATTCCCAGACAA D_rerio300118 TGTCTAAATGAC-CA-ACCACCACTGACCAGCCTCCATAGTCTCCAACAA D_rerio300119 TGTCTAAATGAC-CA-TCCACCACTGACCAGCCTCCATAGTCTCCAACAA D_novemcinctus300575 TCTCTTTG-GACACT-TCCACCACTGGCCAGCCTCCAAATTCCCATACAC D_melanogaster300227 TTTCCTCA---CACTTTGCCTCTCTGAAT-GCGACAAAA----------- E_telfairi300694 TCTCTTTG-GACACA-TTCGCCACTGGCCAGCCTCCAAACTCCCGTACAT E_telfairi300813 TCTCTTTG-GACACA-TTCGCCACTGGCCAGCCTCCAAACTCCCATACAT E_caballus300309 TGTCTTTG-GACATA-TCTACCACTGGCCAGCCTCCAAATTCCCACACAC E_europaeus300202 TGTCTTTG-AACATA-CTCACCACAAGTCAGCCTCCAAATCCCCACACAC E_europaeus300217 TCTTTTCA-GACATA-TCTACCTCTGGCCAGACTTCAAATCCTCAATCTC E_europaeus300306 TCCCTCTA-GATCTT-CCCACTCCTGGTCAGCATCTAAATTCCCACACAG E_europaeus300395 TCTTTTCA-GACATA-TCTACCTCTGGCCAGACTTCAAATCCTCAATCTC E_europaeus300407 TCTTTTCA-GACATG-ACTACCACTGGCCAGCCTCCAAATTCCCACACAC E_europaeus300441 GCTGGTTG-GACATA-TTCACCACAGGCCAGCCTCCAAATCCTCATACAT E_europaeus300581 TCTCTTTG-GACATA-CTCACTATCAGTCAGCCTCCAAATCCCCACACAC E_europaeus300597 TCCCTTTG-GACACA-TTCACCACAGGCCAGCCTCCAAATCCCCACACAT E_europaeus300613 TCACTTTA-GACACT-TTTAGTACTGGTCAGTGTCCAGATTCCCACGCAC E_europaeus300654 TCTCTTCA-GACATA-ACTACCACTGGCCAGCCTCCAAATTCCCACACAC H_sapiens300735 T--CTCTG-GACACA-TCTACCACTGGCCAGCCTCCAAATTCCCACACAC M_mulatta300649 T--CTCTG-GACACA-TCTACCACTGGCCAGCCTCCAAATTCCCACACAC M_murinus300482 TCTTTTCT-GACACA-TCTGCCACTGGCCAGCCTCCAAATTCCTACACAT M_murinus300515 TCTCTTGT-GACACA-TCTACCACTGGCCAGCCTCCAAATTCTCGCACAC M_domestica300017 TCTTTTTG-GACAAA-CCTACCACTGGTCAGCCTCCAAACTCCCAGACAT M_domestica300176 TCTTTTTG-GACAAA-TCTAACACTGGTCAGCCTCCGAACTCCCAGACAT M_domestica300177 TCTTTTTG-GACAAA-TCTACCACTGGTCAGCCTCCGAACTCCCAGACAT M_musculus300764 TGTTTTTTTAACACA-TCTCCCACTGGCCAGCCTCCAAATTCCCAGACAC O_anatinus302294 TCTTTG-G-GACAAA-TCTTGCACTGGCCAGCCTCCAAACTCCCAGACAT O_cuniculus300063 TCTCTTTG-GACATA-ACCACCACTGGCCAGCCTCCAAACTCCCATACAC O_cuniculus300455 TCTCTTTG-GACATA-ACCACCACTGGCCAGCCTCCAAACTCCCATACAC O_garnettii300343 TCTCTTAA-GACGTA-TCTACCACTGGCCAGCCTCCAGATTCCCTCACAC O_garnettii300605 TCTCTTAT-GACACA-TCTACCACTGGCCAGCCTCCAAATTCCCGCACAG P_troglodytes300661 T--CTCTG-GACACA-TCTACCACTGGCCAGCCTCCAAATTCCCACACAC P_pygmaeus300291 T--CTCTG-GACACA-TCTACCCCTGGCCAGCCTCCAAATTCCCACACAC R_norvegicus301088 TGTGTTTG-AACACA-TCTCCCACTGGCCAGCCTCCAAATTCTCAGACAA S_araneus300172 TCTCTTGG-GACATA-ACTCCCACTGACCTGCCTCCAGATTTCCATACAT S_araneus300946 TCTCTTGG-GACATACTCTCCCACTGACCAGCCTCCAAATTCCCACACAC S_araneus300965 TCTCTTGG-GACATG-TCTCCCACGGGCCAGCCTCCATATTCCCATACAC S_araneus300999 TCTCTGTG-GACATA-ACCACCACTGGCCAGCCTCCAAATTCCCACACAG S_tridecemlineatus300272 TCTCTTTG-GACATA-TCTACCACTGGCCAGCCTCCAAATTCCCATACAT T_nigroviridis300019 GTCTTTATGGAC-CC-ATCACCTTCGGCCAGCCTCCAAACTCTCCTACAC X_tropicalis300099 TGTCCCAGTGACGCT-CCTACCACTGGCCAGCCTCCAATCTCTCTGACAT X_tropicalis300100 TGTCTAACCGACGCT-TCTACCACTGGCCAGCCTCCAATCTCTCAGACAC * C_familiaris300477 AG C_porcellus300917 AG D_rerio300118 AA D_rerio300119 AA D_novemcinctus300575 AG D_melanogaster300227 -- E_telfairi300694 AC E_telfairi300813 AC E_caballus300309 AG E_europaeus300202 AG E_europaeus300217 CT E_europaeus300306 AA E_europaeus300395 CT E_europaeus300407 AA E_europaeus300441 AG E_europaeus300581 AG E_europaeus300597 AG E_europaeus300613 AG E_europaeus300654 AA H_sapiens300735 AG M_mulatta300649 AG M_murinus300482 AA M_murinus300515 AG M_domestica300017 TT M_domestica300176 AT M_domestica300177 AT M_musculus300764 AA O_anatinus302294 TC O_cuniculus300063 AA O_cuniculus300455 AA O_garnettii300343 AG O_garnettii300605 AA P_troglodytes300661 AG P_pygmaeus300291 AG R_norvegicus301088 AA S_araneus300172 TA S_araneus300946 AA S_araneus300965 TG S_araneus300999 AA S_tridecemlineatus300272 TG T_nigroviridis300019 GC X_tropicalis300099 AA X_tropicalis300100 AA

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved