snOPY snoRNA Orthological Gene Database

Family: SNORA21,snoRNA:Psi28S-3316

CLUSTAL 2.0.10 multiple sequence alignment D_melanogaster300177 TCGCACCTAAAAGCGTTTTCTCGTCGGCTCGTTAAATGCTCTTGAAAATCGTAGATGTGT D_melanogaster300178 ACGCACCTAAAAGCGTTTTCTTGCCAGCCCGTTAAGTGCTCTCGAAAATCGTAGATGTGT D_melanogaster300182 CAGCACCTAAAAGCGTTTTCTTATCAGCTTGATAAATGCTCTTGAAAATCGTAGATGTGT D_melanogaster300184 GTGCACCTAAAAGCGTTTCCTTGCAAGCCCGTTAACTGCTCTTGGAAATCGTAGATGTGT D_melanogaster300186 TTGCACCTAAAAGCGTTTTCTTGTCAGCCTGATAAATGCTCTTGAAAATCGTAGATGTGT **************** ** ** * *** ****** * *************** D_melanogaster300177 GCCAGAGCGAAGCT--CAGTTGCAAGTGATACGGCCATTTTTTG-TGGCAGATATCCATA D_melanogaster300178 GCCAGAGCAATCGTCGCAGTTGCAAGTGATCTAGATCCGTGACAGAATCAGATCCAATTA D_melanogaster300182 GCAATAGCAATATCTACAATAGCTTGGGATTCAGTTTCTATATA-ACTTCAATCCGTTCA D_melanogaster300184 GCAAAATCAATCCTCACAATAGCAAGTGATTTTAGTTCCTC-TA-ACTCAAATCCATTTA D_melanogaster300186 GCAAAATCAATCCTCACAATAGCAAGTGATTTTAGTTCCCT-TA-ACTCTAATCCGTTTA ** * * * * ** * ** * *** ** * D_melanogaster300177 ACGCTGACTACAAGT------ D_melanogaster300178 AAGCTGGGCTCATTTATATAT D_melanogaster300182 GA-TTGTAAACATCC------ D_melanogaster300184 CA-TTGTGAACATAC------ D_melanogaster300186 CA-TTGTGAACAGTC------ ** **

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved