snOPY snoRNA Orthological Gene Database

Family: SNORA21

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300392 -GTGCAAAC--TCGATCA---CTAGCTCTGCATGATGTTGCAGAAGTGAG C_porcellus300370 AAGCCAGTTTCTTCCTCACTTTTACTTTTTAAAATAAACTTTGCAGCTAA C_porcellus300946 -GTGCAAAC--TCGATCA---CTAGCTCTGCATGATGTGGCAGAAGCTAA D_novemcinctus300249 -GTGCAAAC--TCAATCA---CTAATGCTGT-TGA----GCAAAAGCAAG D_novemcinctus300287 -GTGCAAAC--TCGATCA---CTAGCTCTGCATGAAGTTGCAGAAGCAAG E_telfairi300092 -TTGCAAAC--TCGATCA---CTAGCTCTCCATGATGTTGCAGAAGCAAG E_telfairi300190 -TTGCGAAC--TCAGTCA---CTAGCTCTGTATGATGTTACGGAAAGAAG E_telfairi300476 -TTGCAAAC--TCGATCA---CTAGCTCTCCATGATGTTGCAGAAGCAAG E_telfairi300500 -TTGCAAAC--TCGATCA---CTAGCTCTGCATGATGTTGCAGAAGCAAG E_telfairi300592 TGTTAAAAA--TAAATGA---ATC-CTTTGCATGATGTTGCAGAAGCAAG E_telfairi300869 -TTGCAAAC--TTGATCA---CTCGCTCTGCATGATGCTGCAGAAGCAAG E_caballus300316 -GTGCAAAC--TCGATCA---CTAACTCTGCATGATGTTGCAGAAGTGAA E_europaeus300299 -GTTCAAAC--TCAATCA---CTAACT--GCATGTTT---CAGAAGTGAG E_europaeus300425 -ATATAAAC--TCAATCA---CTAACTGTGC--GATGTGGCAGAA-CGAG E_europaeus300557 -GAGCAGAC--TCGATCC---CTAAC--TGCACGGTATTGCAGGAGTGAA E_europaeus300593 -GTGCAGAC--TTGATCA---CTAACAATGCATGTTGTTGCAGAAGTGAA E_europaeus300646 -GTGCAAAC--TCGATCA---CTAACTCTGCATGAAGTTGCAGAAGTGAG G_gallus300121 -TTGCAAAC--TCGATCA---CTAGCTCTGCATGATGTTGCAGAAGCAAG H_sapiens300670 -GTGCAAAC--TCGATCA---CTAGCTCTGCGTGATGTGGCAGAAGCGAA L_africana300381 -CTGCAAAC--TCGATCA---CTAGCTCTGCATGATGTTGCGGAAGCGAG M_mulatta300586 -GTGCAAAC--TCGATCA---CTAGCTCTGCATGATGTGGCAGAAGCGAA M_murinus300375 -GTGCAAAC--TCGATCA---CTAGCTCTGCCTGATGTGGCAGAAGCTAA M_murinus300441 -GTGCAAAC--TCGATCA---CTAGCTCTGCCTGATGTGGCAGAAGCTAA M_murinus300473 -GTGCAAAC--TCGATCA---CTAGCTCTGCCTGATGTGGCAGAAGCTAA M_domestica300077 -TTGCAAAC--TCGATCA---CTAGCTCTGCATGATGTTGCGGAAGCAAG M_musculus300430 --AAGTGTC--TCCAGCA---CTAATTCTGCATAATGTGGCAGCAGCTGA M_musculus300772 -CTGCAAAC--TCGATCA---CTAGCTCTGCATAATGTGGCAGCAGCTAA M_musculus300773 -GAGCAAAC--TCGATCA---CTAGCTCTGCATAATGTGGCAGCAGCTGA O_anatinus304274 -CGGCAAAC--TCGATCA---CTGGCTTTGCATGATGTTGCAAATGCAAA O_anatinus304275 -TTGCAAAC--TCGATCA---CTAGCTCTGCATGGTGTTGCAGAAGCAAG O_cuniculus300019 -------------AAAAAGACTAAAACATGATGTGTGTGGCAGAAGTGAA O_cuniculus300274 -GTGCAGAC--CCCATCA---CTGGCTCTGTGTGATGTGGCAGAAGCGAA O_cuniculus300402 -GTGCAAAC--TCGATCA---CTGGCTCTGCATGATGTGGCAGTAGCAAA O_garnettii300093 -GTGCAAAC--TCAATCA---CTGTCTCTGCATGATGTGGCAGGAGCTCA O_garnettii300098 -GTGCAAAC--TCGATCA---CTGGGTCTGCATGATGTGGCAGGAGCTAA O_garnettii300201 -GTGCAAAC--TCAATCA---CTGTCTCTGCATGATGTGGCAGG------ O_garnettii300442 -----GTCCC-TACAAAAGGATTATTTATGCATGATGTGGCAGGAGCTAA P_troglodytes300530 -GTGCAAAC--TCGATCA---CTAGCTCTGCGTGATGTGGCAGAAGCGAA P_pygmaeus300588 -GTGCAAAC--TCGATCA---CTAGCTCTGCATGATGTGGCAGAAGCGAA R_norvegicus301004 -GTGCAAAC--TCGATCA---CTAGCTCTGCATGATGTGGCAGCAGCTAA R_norvegicus301005 -GTGCAAAC--TCGATCA---CTAGCTCTGCATGATGTGGCAGCAGCTAA S_araneus300183 -GCACAAAC--CAGATCT---CTAACTCTGCATGATATTGCAGAAGTGAG S_araneus300858 -GTGAAACTATTCTGTCA---TAAGAATGTTCTCATGTCTCAGAAGTGAG S_araneus300898 -GTGCAAAC--TCGATCA---CTAACTCTGCATGATGTTGCAGATGTGAG S_araneus300914 -----AAATC-TAGGTCATTACTAACTCTGCCTGGTGTTGCAGAAGTAAG S_araneus301066 -GTACAAAC--TTGATCA---CTAACTCTACATGATGTTGCAGAAGTGAG S_tridecemlineatus300046 --TACAAAAA-TCTGTCA---CTAGCTCTGCATGACATGGCAGAAACTAA T_belangeri300004 -GTGCAAAC--TCGATCA---CTAGCTCTGCGAGATGTGGCGGACGCTAA T_belangeri300398 -GTGCAAAT--TCAATCA---CCACCTCTGCATGGTATGACAGAAGTGAA T_belangeri300410 -GTGCAAAC--TCGATCA---CTAGCTCTGCGTGATGTGGCAGACGCTAA C_familiaris300392 GGGAA-CCAGGTTTGCTAAAGTAATTGTGGTG-ATAGAAATG-TAT---T C_porcellus300370 GGGAA-CCAGGTTTGCTAAAGTAATTGTGGTG-ATAGGACTG-TAT---T C_porcellus300946 GGGAA-CCAGGTTTGCTAAAGTAATTGTGGTG-ATAGGACTG-TAT---T D_novemcinctus300249 GGGAAACCAGGTTTGC-AAAGTAATTATGGT----AGAAATG-TAT---T D_novemcinctus300287 GGGAA-CCAGGTTTGCTAAAGTAATTGTGGTG-ATAGAAATG-TAT---T E_telfairi300092 GGGAA-CCAGGTTTGCTAAAGTAATTGTGGGG-ATAGTAATG-GCT---T E_telfairi300190 GGGGAACCAGGTTTGCTAAAGTAATTGTGATAGATATGATTT-TA----- E_telfairi300476 GGGAA-CCAGGTTTGCTAAAGTAATTGTGGGG-ATAGTAATG-GCT---T E_telfairi300500 GG-AA-CCAGGTTTGCTAAAGTAACTGTGGGG-ATAGTAATG-GTT---T E_telfairi300592 GGGAA-CCAGGTTTGCTAAAGTAATTGTGGGA-ATAGTAATG-TTT---T E_telfairi300869 GGGAA-CCAGGTTTGCTAAAGTAATTGTGGGA--TAATAATGGTTT---T E_caballus300316 GGGAA-CCAGGTTTGCTAAAGTAATGGTGGTG-ATAGAAACA-TAT---T E_europaeus300299 AGGAA-CTAGGTTTGCTAAAGTAATTGTGGTG-ATAGAATTG-TAT---A E_europaeus300425 GGGAA-CCAGGTTTACTAAAGTAATTGTAATG-ATAGAAATG-TAT---T E_europaeus300557 GGG-AACCAAGTTTGCTAAGGTCATTGTGGTGGATAGGAATT-CA----- E_europaeus300593 GAG-AACCAGGTTTGCTAAAATAACTGTGGTG-ATAGAAATG-TAT---T E_europaeus300646 GGGAA-CCAGGTTTGCTAAAGTAATTGTGGTG-ATAGAAATG-TAT---T G_gallus300121 GGGAA-C-AGGTTTGCTAAAGTAAACATGGTA-ATAGAACCA-TAT---T H_sapiens300670 GGGAA-CCAGGTTTGCAAAAGTAACTGTGGTG-ATGGAAATG-TGT---T L_africana300381 GGGAA-CCAGGTTTGCTAAAGTAATTGTGGTG-ATAGAAATG--AT---T M_mulatta300586 GGGAA-CCAGGTTTGCAAAAGTAACTGTGGTG-ATAGAAATG-TGT---T M_murinus300375 GGGAA-CCAGGTTTGCTAAAGTAATTATGGTG-ATAGAAATG-TAC---T M_murinus300441 GGGAA-CCAGATTTGCTAAAGTAATTATGGTG-ATAGAAATG-TAC---T M_murinus300473 GGGAA-CCAGGTTTGCTAAAGTAATTATGGTG-ATAGAAATG-TAC---T M_domestica300077 GGGAA-CCAGGTTTGCTAAAGCAATTATGGTG-ATAGAAATT-GAT---T M_musculus300430 GGGAA-CCAGGTTTGCTGGAGTAATTGTGGTG-ATAGCAATG-TAC---C M_musculus300772 GGGAA-CCAGGTTTGCTAGAGTAATTGTGGCG-ACAGCAATG-TAC---C M_musculus300773 GGGAA-CCAGGTTTGCTAGAGTAATTGTGGTG-ACAGCAATG-TGC---C O_anatinus304274 GGGAA-CCAAGTTTGCTACAGCAAGTTTGGTG-GAA-----A-TCT---C O_anatinus304275 GGGAA-CCAGGTTTGCTAAAGAAAGTGAGGAG-ATGGAAATC-TTT---C O_cuniculus300019 AGAAA-TCGTGTTTGCTAAAGTAATTGTGGTG-ATAGAAATAGTTT---- O_cuniculus300274 GGGAG-ACAGGTTTGCTAAAGTAATTGTGGTG-ATAGAAATG-TCT---G O_cuniculus300402 GGGAA-CCAGGTTTGCAAAAGTAACTGTGGTG-ATAGAAATG-TTT---T O_garnettii300093 GGAAA-CCAGGTTTGCTAAAGTAATCATGGCG-ATAGGAATG-TAT---T O_garnettii300098 GGGAA-CCAGGTTTGCTAAAGTAATTATGGTG-ATAGGAATG-TAT---T O_garnettii300201 -----------TTTGCTAAAGTAATTATGGTG-ATAGGACTG-TAT---T O_garnettii300442 GAGAA-CTAGGTTTGCGAAAGTAATTATGGTG-CTAGGAATGTATC---- P_troglodytes300530 GGGAA-CCAGGTTTGCAAAAGTAACTGTGGTG-ATGGAAATG-TGT---T P_pygmaeus300588 GGGAA-CCAGGTTTGCAAAAGTAACTGTGGTG-ATGGAAATG-TGT---T R_norvegicus301004 GGGAA-CCAGGTTTGCTAGAGTAACTGTGGTG-ATAGCAATG-TAC---C R_norvegicus301005 GGGAA-CCAGGTTTGCTAGAGTAACTGTGGTG-ATAGCAATG-TAC---C S_araneus300183 GGGAA-CCAGGTATGCTAAAGTAACTGCAGTG-ATAGAAATG-GAC---T S_araneus300858 GGGAA-CCAGGTTTGCTAAAGTAACAGCAGTG-ATAGAAATG-TAT---T S_araneus300898 GGGAA-CCAGGTTTGCTAAAGTAACTGCAGTG-ATAGAAATG-GGT---T S_araneus300914 GGGAA-CCAGGTTGACTAAAGTACCTGCAGTG-ATTGGCGCA-TAT---T S_araneus301066 AGAAT-CCAAGTTTTTTAAAGTAACTGAAGTG-ATAGAACTG-GAT---T S_tridecemlineatus300046 GGGAA-CAGTGTTTGATAGAGTAATTGCAAGA-ATAGGAATG-TAT---T T_belangeri300004 GGGA--CCAGGCTTGCTAAAGTAATTTTGGTG-ATAGAAATA-TGTAGTT T_belangeri300398 AGGAA-ATGGGATTGCTAAAGAAATTTTGGTG-ATAGAAATG-TAT---T T_belangeri300410 GGGAA-CCAGGTTTGCTAAAGTAATTTTGGTG-ATAGAAATA-TGTAGTT C_familiaris300392 AGCCTCAGAAGGTAC-TTACTGAGCTGACCTATTCTATCCC-ATTACAGT C_porcellus300370 AGCCTCAGAAG-----CTACTGGGGTAGTTCATTCTATCCT-CATATAGT C_porcellus300946 AGCCTCAGAAG-----CTACTGGGGTAGTTCGTTCTATCCT-CATATAGT D_novemcinctus300249 AGCCTCAGGAT-----CTACTGGAGTGGTCCATTCTATCCT-AATACAGT D_novemcinctus300287 AGCCTCAGGAA-----CTACTGGGGTGGCCCATTCTATCCT-AATACAGT E_telfairi300092 AGCCT--CAGG---GACTACTGAGGTAGCCCATTCTTTCCT-ACTGCAGT E_telfairi300190 --CCTCAGGAG-----CTGCTGAGGTGGCCTGTTCAATTCT-AATATGGT E_telfairi300476 AGCCT--CAGG---GACTACTGAGGTAGCCCATTCTTTCCT-ACTGCAGT E_telfairi300500 AGCCT--CAGG---GACTACTGAGGTGGCCAGTTCTGTCCT-ACTACAGT E_telfairi300592 AGCTT--CAGG---GACTACTGAGGTGGCTCATTCTTTCCT-ACTACAGT E_telfairi300869 AGCCT--CACG---GATTACCGAGGTGGCCCATTCTTTCCT-ACTGCAGT E_caballus300316 AGCCTCAGAAG-----CTACTGAGGTGGCCCATTCTATCCC-AGTACAGC E_europaeus300299 AACCTCAGAAA-----CTACTGAGGTGGCCCATTCTATCCC-AGTACAGT E_europaeus300425 AGCCTCTGAAA-----CTCCTGAGGTGGTCCATTCTATCCT-AGTATAGT E_europaeus300557 -GCCTCAGCAG-----CTGCTGAGGTGTCC-GTTCTGTCCT-GCTGTG-- E_europaeus300593 TGCTTCAGAAG-----CTACTGAAGTGGCCTGCTCTACCCT-ACCCTATT E_europaeus300646 CGTCTCAGAAG-----CTACTGAGGTGGCCTATTCTATCCT-AGTACAGT G_gallus300121 AGCCTTAGAAATCAAATGATTGGGGCTGTTAATTCTATACC-ATGATAAG H_sapiens300670 AGCCTCAGACA-----CTACTGAGGTGGTTCTTTCTATCCT-AGTACAGT L_africana300381 AGCCTCAGGAG-----CTACTGAGGTGGCCCTTTCTATCAT-AATACAGT M_mulatta300586 AGCCTCAGACA-----CTACTGAGGTGG--CTTTCTATCCT-AGTACAGT M_murinus300375 AGCCTCAGATG-----TTACTGAGGTTGCCCATTCTATCTT-AGTACAGT M_murinus300441 AGCCTCAGATG-----TNN------------------------------- M_murinus300473 AGCCTCAGATG-----TTACTGAGGTTGCCCATTCTATCTT-AGTACAGT M_domestica300077 TGCCTCAGAATTGACATTTTTGAGGCGCCTCATTCTATCCCTAAGACAAG M_musculus300430 AACCTCAGAAG-----CTACTGAGAT-GTCCATTCTGTCAC-AGTACAGT M_musculus300772 AACCTCAGAAG-----CTACTGAGGT-GCCCATTCTGTCAC-AGTACAGC M_musculus300773 AACCTCAGAAG-----CTACTGAGGT-GCCCATTCTGTTAC-AGTACAGT O_anatinus304274 AGCCCCGGAAA-CGCATTACAGAGGCTGACTCTTCTGATCC-AAAACACA O_anatinus304275 GGCCTTAGAG---GAAATGTCGGGGCTGTCTTTTCTCTCTC-CCTACACG O_cuniculus300019 AGCCTC--AGA---AGCTGCTGAGGTGGCCCATTCTATCCC-AGTACAAG O_cuniculus300274 AGCCTCAGAGG-----CTGCTGAGGGAGCCCATTCTATCCC-AGGACGGA O_cuniculus300402 AGCCTCAGAAG-----CTGCTGAGGTGGCCCATTCTATCCC-AGTACAGT O_garnettii300093 CGCCTCAGATG-----TTACTGAGGTTGCCCATTCTATTCT-AGTACAGG O_garnettii300098 A-CCTCAGATG-----TTACTGAGGTTGCCCAT-CTATCCT-AGTACAGG O_garnettii300201 AGCCTCAGATG-----TTACTGAGGTTACCCATTCCATCCT-AGTACAGG O_garnettii300442 AGCCTCTCAGA---TGTTACTGAGGTTGCCCATTCTATCCT-ACTACAGG P_troglodytes300530 AGCCTCAGACA-----CTACTGAGGTGGTTCTTTCTATCCT-AGTACAGT P_pygmaeus300588 AGCCTCAGACA-----CTACTGAGGTGGCTCTTTCTATCCT-AGTACAGT R_norvegicus301004 AACCTCAGGAG-----CTACTGAGGT-GCCCATTCTGTCCC-AGAACAGT R_norvegicus301005 AACCTCAGGAG-----CTACTGAGGT-GCCCATTCTGTCCC-AGTACAGT S_araneus300183 AACTTAACATA---TTATACTGAGGA-GCCTATTTTAGTAC-AAGATTTT S_araneus300858 AACTTCAGATG-----CTACTGAGGTTGCCCGCTCTACCCT-AGTACAGA S_araneus300898 AACCT--CAGC---TCCTACTGAGGTTGCTTACTCTATCCT-ACTACAGG S_araneus300914 AACCCCAGGGC------TACTGAGGTTGCCTATTCTGTCCC-AGTACAGT S_araneus301066 AACTT--CAG--------ATTGAGGTTGTCTCTTCTACTGC-AGGGTGAA S_tridecemlineatus300046 AGCCTCAGAAG-----TTACTGAGGTGGCCCATTCTATCCT-AGCACAGT T_belangeri300004 AGCCTCA--AG-----CTATTGAGGTGGCCCGTTCTATCCT--GTACAGT T_belangeri300398 ATCTTCAGAAG-----ATACTGAGGTTGTCCATTCTATCCT-AGTACTGT T_belangeri300410 AGCCTCA--AG-----CTATTGAGGTGGCCCATTCTATCCT--GTACAGT C_familiaris300392 G- C_porcellus300370 A- C_porcellus300946 A- D_novemcinctus300249 A- D_novemcinctus300287 G- E_telfairi300092 G- E_telfairi300190 A- E_telfairi300476 G- E_telfairi300500 A- E_telfairi300592 A- E_telfairi300869 T- E_caballus300316 G- E_europaeus300299 G- E_europaeus300425 A- E_europaeus300557 -- E_europaeus300593 A- E_europaeus300646 A- G_gallus300121 G- H_sapiens300670 C- L_africana300381 A- M_mulatta300586 C- M_murinus300375 A- M_murinus300441 -- M_murinus300473 A- M_domestica300077 A- M_musculus300430 C- M_musculus300772 C- M_musculus300773 C- O_anatinus304274 A- O_anatinus304275 C- O_cuniculus300019 G- O_cuniculus300274 G- O_cuniculus300402 G- O_garnettii300093 A- O_garnettii300098 A- O_garnettii300201 A- O_garnettii300442 A- P_troglodytes300530 C- P_pygmaeus300588 C- R_norvegicus301004 C- R_norvegicus301005 C- S_araneus300183 TA S_araneus300858 G- S_araneus300898 G- S_araneus300914 G- S_araneus301066 A- S_tridecemlineatus300046 G- T_belangeri300004 A- T_belangeri300398 G- T_belangeri300410 A-

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved