snOPY snoRNA Orthological Gene Database

Family: SNORA21

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300415 CTCCCAGCTCTCATGATGA-ACCCATATGCCTCTGAGCTGCCATGATTCT C_porcellus300546 GCCCCATCTCTCAGGATGA-A-CCCCACGCCTCTGAGCCTCCATGATTCT D_novemcinctus300510 TTCCCAGCTCTCGTGATGA-CTCCATGTGCCTCTGAGCTGCCATGATTCT E_telfairi300870 CTCCCCGCTCTCATGATGA-GCCCATGTGCCTCTGAGCTGCCGTGATTCA E_caballus300302 CCCCCAGCTCTGGTGATGA-ACCCACGTGCCTCTGAGCTGTCGTGATTTT F_catus300260 CCCCCAACTCTCACGATGA-ACCCATATGCCTCTGAGTTGCCATGATTCT H_sapiens300558 CCCCTATCTCTCATGATGA-ACACATATGCCTCTGAGCTGCTGTGATTTC H_sapiens300769 --CCACATGCGGCTGATGA-CAGCACTT-CTGCTGAGACGCTGTGATTGC M_mulatta300537 CCCCCTTCTCTTATGATGA-ACACATGTGCCTCTGAGCTGCTGTGATTTC M_murinus300481 TGCCCATCTCTTATGATGA-AACCGTTTGCCTCTGAGCTGCCATGATTTT M_musculus300886 --CTCCTGTCTGATGATGA-GCCC-ATT-GCCCTGAGCTCTTGTGAT-GC O_garnettii300075 -------CTCTTATGATGA-ACCCATTTGCTTCTGAGCTACTGTGATTT- O_garnettii300758 CCCCCGTCTCTTATGATGA-ACCCATTTGCTTCTGAGCTGCTGTGATTTT P_troglodytes300601 CCCCTATCTCTCATGATGA-ACACATATGCCTCTGAGCTGCTGTGATTTC P_pygmaeus300657 TCCCTATCTCTCATGATGA-ACACATATGCCTCTGAGCTGCTGTGATTTC R_norvegicus300866 --CTCCTGTCTCATGATGA-TCCCCACT-GCCCTGAGCTGTTGTGAT-GC S_araneus300781 TCCCCAAGTCTAATGATGATACCCAATTTCCTCTGAGCCACTGTTATTCT S_tridecemlineatus300283 -----TGCTTTTATGATGA-AACCATGTGCTTCTGAGCTGCCATGATTCT S_tridecemlineatus300285 TCCTTGTCTCTCATGATGA-AACCCTGTGCCTCTGAGCTGCCATGATTCT T_belangeri300352 CCCCCATCTCTCAGGATGA-GCCCCTCTGCCTCTGAGCTGCCATGATTCT ***** * ***** * ** C_familiaris300415 -GGCTTCAAAGTAAACGCTCTGAAGAGATGGAGCAGAGG- C_porcellus300546 -GGCTTCAAAGTAAACGCTCTGAAGAGACGG-GCAGAGG- D_novemcinctus300510 -GGCTTCAAAGTAAACGCTCTGAAGAGATGG-GCAGAGG- E_telfairi300870 -GGCTTCAAAGTAAACGCTCTGAAGAAATGGAGCCGAGC- E_caballus300302 -GGCTTCAAAGTAAACGCTCTGAAGAGATGGGGCAGAAG- F_catus300260 -GGCTTCAAAGTAAACGCTCTGAAGAGATGG-GGCGGAGG H_sapiens300558 TGGCTTCAAAGTAAACGCTCTGAAGAAGAGATGGGG---- H_sapiens300769 TCTGTCCAAAGTAAACGCCCTGACGCACTGTGG------- M_mulatta300537 TGGCTTCAAAGTAAACGCTCTGAAGAAGAGATGGGG---- M_murinus300481 -GGCTTCAAAGTAAACGCTCTGAAGAAGAGTCAGGA---- M_musculus300886 TGGCTTCAAAGTAAACGCTCTGAAGTGAAGGAGCAGGGC- O_garnettii300075 -GTCATTAAATTTAGCCTTTTAATCTGTAAAGGC------ O_garnettii300758 TGGCTTCAAAGTAAACGCGCTGAAGAAGAGTTGGGA---- P_troglodytes300601 TGGCTTCAAAGTAAACGCTCTGAAGAAGAGATGGGG---- P_pygmaeus300657 TGGCTTCAAAGTAAACGCTCTGAAGAAGAGATGGGG---- R_norvegicus300866 AGGCTTCAAAGTAAACGCTCTGAAGCAATGGAGCAAGGC- S_araneus300781 -GGCTTCAAAGTAAATGCTCTGATGAGATGGGG------- S_tridecemlineatus300283 -GGCTTCAAAGTAAATGCTCTGAAGAGTTGGGGAAAAGA- S_tridecemlineatus300285 -GGCTTCAAAGTAAACGCTCTGAAGAGACAG-GCAGAGG- T_belangeri300352 -GGCTTCAAAGTAAACGCTCTGAAGAGAGGG-GG------ *** * * * *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved