snOPY snoRNA Orthological Gene Database

Family: SNORA21

CLUSTAL W (1.83) multiple sequence alignment C_elegans300048 -------------------------------------------------- C_elegans300087 -------------------------------------------------- C_familiaris300312 -------------------------------------------------- C_familiaris300446 -------------------------------------------------- C_porcellus300224 -------------------------------------------------- C_porcellus300420 -------------------------------------------------- C_porcellus300939 -------------------------------------------------- D_rerio300172 -------------------------------------------------- D_rerio300173 -------------------------------------------------- D_novemcinctus300276 -------------------------------------------------- D_novemcinctus300370 -------------------------------------------------- D_novemcinctus300411 -------------------------------------------------- D_novemcinctus300466 -------------------------------------------------- E_telfairi300073 -------------------------------------------------- E_telfairi300144 -------------------------------------------------- E_telfairi300261 -------------------------------------------------- E_telfairi300280 -------------------------------------------------- E_telfairi300364 -------------------------------------------------- E_telfairi300377 -------------------------------------------------- E_telfairi300399 -------------------------------------------------- E_telfairi300409 -------------------------------------------------- E_telfairi300410 -------------------------------------------------- E_telfairi300480 -------------------------------------------------- E_telfairi300495 -------------------------------------------------- E_telfairi300584 -------------------------------------------------- E_telfairi300721 -------------------------------------------------- E_caballus300331 -------------------------------------------------- E_europaeus300003 -------------------------------------------------- E_europaeus300020 -------------------------------------------------- E_europaeus300028 -------------------------------------------------- E_europaeus300029 -------------------------------------------------- E_europaeus300077 -------------------------------------------------- E_europaeus300132 -------------------------------------------------- E_europaeus300368 -------------------------------------------------- E_europaeus300381 -------------------------------------------------- E_europaeus300386 -------------------------------------------------- E_europaeus300458 -------------------------------------------------- E_europaeus300474 -------------------------------------------------- E_europaeus300493 -------------------------------------------------- F_catus300287 -------------------------------------------------- F_catus300324 -------------------------------------------------- G_gallus300071 -------------------------------------------------- G_gorilla300798 -------------------------------------------------- H_sapiens300710 -------------------------------------------------- M_mulatta300718 -------------------------------------------------- M_musculus300923 -------------------------------------------------- M_musculus300944 -------------------------------------------------- M_musculus300416 -------------------------------------------------- M_lucifugus300555 -------------------------------------------------- M_lucifugus300706 -------------------------------------------------- M_lucifugus300881 -------------------------------------------------- M_lucifugus300174 -------------------------------------------------- O_anatinus302230 -------------------------------------------------- O_anatinus302231 -------------------------------------------------- O_cuniculus300074 -------------------------------------------------- O_cuniculus300179 -------------------------------------------------- O_cuniculus300208 -------------------------------------------------- O_cuniculus300212 -------------------------------------------------- O_cuniculus300216 -------------------------------------------------- O_cuniculus300228 -------------------------------------------------- O_cuniculus300265 -------------------------------------------------- O_cuniculus300490 -------------------------------------------------- O_garnettii300243 -------------------------------------------------- O_garnettii300339 -------------------------------------------------- O_garnettii300462 -------------------------------------------------- O_garnettii300755 -------------------------------------------------- P_troglodytes300585 -------------------------------------------------- P_pygmaeus300778 -------------------------------------------------- R_norvegicus300287 -------------------------------------------------- R_norvegicus300447 -------------------------------------------------- R_norvegicus300772 -------------------------------------------------- R_norvegicus300828 -------------------------------------------------- R_norvegicus300900 -------------------------------------------------- R_norvegicus300921 -------------------------------------------------- R_norvegicus301058 -------------------------------------------------- R_norvegicus301059 -------------------------------------------------- R_norvegicus300225 -------------------------------------------------- S_cerevisiae300023 AACGCAAATTTAACAGCCATTCGTAACACGTACAGTATCTCGTCGAGGTT S_araneus300299 -------------------------------------------------- S_araneus300971 -------------------------------------------------- S_araneus301035 -------------------------------------------------- S_araneus301054 -------------------------------------------------- S_tridecemlineatus300028 -------------------------------------------------- T_nigroviridis300131 -------------------------------------------------- T_nigroviridis300132 -------------------------------------------------- T_belangeri300285 -------------------------------------------------- X_tropicalis300069 -------------------------------------------------- X_tropicalis300128 -------------------------------------------------- C_elegans300048 --ATGCTCTTCAAAAGCACTGG-TTT-TAGGATCCACT-----ATTATCC C_elegans300087 --ACGCTCTTCAAAAGCACTGG-TTA-TCGGACTCAGA-----CTTGTCC C_familiaris300312 ---CCCCTTTTAAAAGCAC----TCG-GTGGGCCT--TGACTGATGACCC C_familiaris300446 ---CCCCTTTTAAAAGCAC----TCA-GTGGGCCC--TGACTCATGACCC C_porcellus300224 ---CCCCTTTTAAAAGCAT----TCA-TTGGGCCTTTT-GCAAATGACTC C_porcellus300420 -----CCGTTTAAAAGCAC----TGGCTGAGGCCTCTTTGCTCACGACCC C_porcellus300939 ---CCCCCTTTAAAAGCAC----TCGCTGGGCCCC---TGCTCGTGACCC D_rerio300172 --GTCCTTCTTAAAAGCAC----TTGCTTCGTCTGCT----CAGTGGCTG D_rerio300173 --GTCCTTCTTAAAAGCAC----TTGCTTCGTCTGCT----CAGTGGCTG D_novemcinctus300276 ---CCCCTTTTAAAAGCAC----TTA-ATAGGCCTT-TTGCTAGTGACTC D_novemcinctus300370 ---CCCCTTTTAAAAGCAC----TCA-GTGGGCCTT-TTCCTGGTGACTC D_novemcinctus300411 ---CCCCTTTTAAAAGCAC----TCA-GTGGGCCTT-TTCCTGAT-ACCC D_novemcinctus300466 ---CCCCTTTTAAAAGCTC----TCA-TTGGGCCTTTT-CTTGATGACCC E_telfairi300073 ---CCCCTTTTAAAATCAC----TCA-TTGGACCTTTT-GCCAGTGACCC E_telfairi300144 ---CTCCTTTTAAAAGCAC----TCA-TTGGGCCTTCC-ACCAGTGACCC E_telfairi300261 -----------CTTGAGTGGAGGTCA-TTGGGCCTTTT-GCCAGTGGCCA E_telfairi300280 -CCCCGTTTTTAAAAGCAC----TCA-TTGGGCCTTTT-GCCAGTGACCC E_telfairi300364 ---------ATATAGGCAC----TCA-GAGGGCCTTTT-GTCAGTGACCC E_telfairi300377 ---CCGCTTTTAAAAGCAC----TCAGTTGAGCGTTTT-GCCAGTGATTC E_telfairi300399 --CCCCATTTTACAAGCAC----TCA-TTGGGCCTTTT-GCCAGTGACCC E_telfairi300409 ---CCCCTTTGGAAAGCAC----TCA-TTGGGCCTTTT-GCCTGTGACCC E_telfairi300410 ---CCCCTTTTAAAAGCAC----TCA-TTGGGCCTTTT-GCCAGTGACCC E_telfairi300480 ---CCCCTTTTAAAAGCAC----TCA-TTGGGCCTTTT-GCCAGTGACCC E_telfairi300495 ---CCACTTTTCAAAGCAC----TCA-CTGGGCCTTCT-GCCAGTGACCC E_telfairi300584 ---CCCCTTTTAAAAGCAC----TCA-TTGGACCTTTT-GCCAGGGATCC E_telfairi300721 ---CCCCTTTTAAAAGCAC----TCA-TTGGACCTTTT-GCCAGTGACCC E_caballus300331 ---CCCCTTTTAAAAGCAC----TCG-GTGGGCCTT--GGCTGATGACCC E_europaeus300003 ---CCCCTTTTAAAAGCAC----TTG-CTGGGCCTC-TTGCTAGTGACCC E_europaeus300020 ---GCCCTTTTGAAAGCAC----TCG-CTGGGCCTC-TTACTAGTGACCC E_europaeus300028 ---ACCCCTTTAAAAGCAC----TTG-CTGGGCCTC-TTACTAGTGACCC E_europaeus300029 -----ACTTTTAAAAGCAC----TCG-CTGGGCCTC-TTACTAGTGACCC E_europaeus300077 ---ACCCCTTTAAAAGCAC----TCT-CTGGGCCTC-TTACTAGTGACCC E_europaeus300132 ---ACCCCTTTAAAAGCAC----TCG-CTGGGCCTC-TTACTAGTGACCC E_europaeus300368 ---ACCCCTTTAAAAGCAC----TCG-CTGGGCCTC-TTACTAGTGATCC E_europaeus300381 ---CCCCTTTTAAAAGCCC----TCC-CTGGGCCTT-TTACTCATGACCC E_europaeus300386 ---ACCCCTTTAAAAGCAC----TCG-CTGGGCCTC-TTACTAGTGACCC E_europaeus300458 ---ACCCCTTTAAAAGCAC----TCG-CTGGGCCTC-TTACTAGTGACCC E_europaeus300474 ---ACCCCTTTAAAAGCAC----TCG-CTGGGCCTC-TTACTAGTGACCC E_europaeus300493 ---CCCTTTTTAAAAGAAC----TCA-CTGGGCCTC-TTACTAGTGACCC F_catus300287 ---CCCCTTTTAAAAGCAC----TCG-TTGGGCCT--TGACTAATGACCC F_catus300324 ---CCCCTTTTAAAAGCAC----TCA-GCGCGCCTTG--ACTAATGACCC G_gallus300071 --ACCCTTCTCAAAAGCAC----TCGTTGGGTCTGCGT--GCCGTGGCTC G_gorilla300798 ---CCCCTTTTAAAAGCAC----TCA-GTGGGCCTGTG-GCTAATGACCT H_sapiens300710 ---CCCCTTTTAAAAGCAC----TCA-ATGGGCCTGTG-GCTAATGACCT M_mulatta300718 ---CCCCTTTTAAAAGCAC----TCA-ATGGGCCTGTG-CCTAATGACCT M_musculus300923 ---TCCCTTTTGAAAGCATTCATTCA-GTG-GCCTTTT-GCTCGTGAGCC M_musculus300944 ---CCCCTTTTAAAAGCAC----TCA-GTGAGCCTTTT-GCTAGTGACCC M_musculus300416 ---CCCCTTTTAAAAGCAC----TCA-GTGAGCCTTTT-GCTAGTGACCC M_lucifugus300555 --CCTCTTTTTAAAAGCAC----TCC-TTGGGCCTT-TTGCTAATGACCC M_lucifugus300706 ---CCCCTTTTAAAAGCAC----TCA-TTGGGCCTT-TTGCTAATGACCC M_lucifugus300881 ---CCCCTTTTAAAAGCAC----TCG-TTGGGCCTC-TTGCCGATGACCC M_lucifugus300174 --CCCCTTCTAAAAAGCAC----TCA-TTGGGCCTT-TTGCCAATGACCC O_anatinus302230 ---ACCCTTCCAAAAGCAC----TCATCTGGCCTCAAC--CCCGTGACCC O_anatinus302231 ---GCCCTTTGCAAAGCAC----TTGCCTGGCCTTAT----CTGTGGCTT O_cuniculus300074 ---GCCTTTTTAAAAGCAT----TCC-ATGGGCATCT--ACTAATGATCC O_cuniculus300179 ---TCCCTTTTAAAAGTAC----TCA-GTGGGCCTTTT-GCTAATGACCC O_cuniculus300208 ---CCCCTTTTAAAAGCAC----TCA-GTGGGCCTTT--GCTAATGACCC O_cuniculus300212 ------------------TGCACTCA-GAGGGCCCTTG-GCTGATGTCCC O_cuniculus300216 ---TCCCTTTTAACAATAC----TCA-GTGGCCCTTTTTGCTTATGATCC O_cuniculus300228 ---CCCCTTTTAAAAGCAC----TCA-GTGGACCATTT-GCTAATGACCC O_cuniculus300265 ---CCCCTTTTAAAAGCAC----TCA-GTGGGCCTTTT-GCTAATGACCC O_cuniculus300490 ---CCCCTTTTAAAAGCAC----TCA-GTGGGCCTTT--GCTAATGACCC O_garnettii300243 ---TCCCTTTTTAAAGCAC----TCA-GTGGGCCTCTT-GCTAATGACCC O_garnettii300339 ---CCCCTTTTAAAAGCAC----TCA-GTGGGCCTTTT-GCTAATGACCC O_garnettii300462 ---CCCTTTTAAAAAGCAC----TCA-ATGGGCCTT-TTGCTAATGACCC O_garnettii300755 ---CCCCTTTTAAAAGCAC----TCA-GTGGGCCTTTT-GCTAATGACCC P_troglodytes300585 ---CCCCTTTTAAAAGCAC----TCA-ATGGGCCTGTG-GCTAATGACCT P_pygmaeus300778 ---CCCCTTTTAAAAGCAC----TCA-GTGGGCCTGTG-GCTAATGACCT R_norvegicus300287 ---------------------------------------GATAACATTTG R_norvegicus300447 ---CCCCTTTTAAAAGCAC----TCA-GTGTGCCTTTT-GCTGATGACCC R_norvegicus300772 ---CCCCTTTTAAAAGCAC----TCA-GTGGGC-TTTT-GCTGATGACTC R_norvegicus300828 ---CCCCTTTTAAAAGCGC----TCA-GCGGGCCTTTT-GCTGATGACCC R_norvegicus300900 ---CCCTTTTTAAAAGCAT----TCA-GTG-GCCTTTT-GCTAGTGACCC R_norvegicus300921 ---CCCCTTTTAAAAGCAC----TCC-GTGGGCCTTTT-GCTAATGACCT R_norvegicus301058 ---CCCCTTTTAAAAGCAC----TCA-GTGGGCCTTTT-GCTGATGACCC R_norvegicus301059 ---CCCCTTTTAAAAGCAC----TCA-GTGGGCCTTTT-GCTAATAACCC R_norvegicus300225 ---CCTCTTTTCAAAGCACTCA-TCA-GTG-AGCTTTT-GCTAGTGACCC S_cerevisiae300023 GAACCCCTCCGGGGCGTTCTTGACCCATGAAGAATGTGGATTGGTGTTGC S_araneus300299 ---ACCCTTTTAAAGGCAC----TTA-TTGGGCCTT-TTGCTAGTGACCC S_araneus300971 -------------------------A-CCAAGCACTTT-G----TGTTAC S_araneus301035 ---ACCCTTTTAAAAGCAC----TCA-GTGGGCCTTTC-ACTAATGACCC S_araneus301054 ---CCCCTTTTAAATGCAC----TCA-CTGGGCCTCTC-GCTAGTGACCC S_tridecemlineatus300028 ---CCCCCTTTAAAATCAC----TTA-ATGTACTTTCTTACTAGTGACCC T_nigroviridis300131 ---CCCCTTCCAAAAGCAC----TTGCTCGGTCCCCT----CAGTGGCTG T_nigroviridis300132 ---CCCCTTCCAAAAGCAC----TTGCTCGGTCCCCT----CAGTGGCTG T_belangeri300285 ---CCCTTTTTAAAAGCAC----TCA-GTGGGCCTTT--GCAAATGACCC X_tropicalis300069 ---CCTCTTCTTAAAGCAC----TTGCAGTGTCTGCT----CGGTGGCAC X_tropicalis300128 ---CCTCTTCTTAAAGCAC----TTGCAGTGTCTGCT----CGGTGGCAC C_elegans300048 AAGCCAGCCGTC--AAAACTGAGCTATAAGAAT-----TATCTTGTTTTT C_elegans300087 ATGCCAGCCGTC--AAAA-TGAGCAATATGAAA-----TATCCTGTTTTT C_familiaris300312 -ACTGAGCCGTC--AAGAAAGGGTAGAGTAAAA----AC--ACTGCTTTT C_familiaris300446 -ACTGAGCCGTC--AAGAAAGGGCAGAGGAAAA----AC--ACTGCTTTT C_porcellus300224 -ATGGAGTCATC--AAGAAAGGGCAGAGT-AAA----AA-CTCCAGTTT- C_porcellus300420 -ACCGAGCCGTC--GAGAAAGCACAGAGCACAA----AC--ACCGCTTTT C_porcellus300939 -ATTGAGCCGTC--AAGAAGG-GCAGAGTACAA----AC--ACCGCTTTT D_rerio300172 -GGTGAGTTGTC--GTGGAAGGATAAAGTAAA-----CCCCATTGCTCTT D_rerio300173 -GGTGAGTTGTC--GTGGAAGGAAAAAGTAAA-----CCCCATTACTCTT D_novemcinctus300276 -ACTGAGCCATT--AAGAAAGG---------------------------- D_novemcinctus300370 -ACTGAGCTGTC--AAGACAAAGCAGCATATAA----AC--ATCGCTTTT D_novemcinctus300411 -ACTGAGTCGTC--AAGAAAGGGAAGAATAAAA----AC--ATCACTTTT D_novemcinctus300466 -TCCAAGCCATC--ATGAAAGGGCAGAAT-AAA----AA-CATTGCTTCT E_telfairi300073 -ATTGAGCCGTC--AA-AAAGGGCAGACTAAGA----AC--ACCACTTTG E_telfairi300144 -A-----------------------GATTAAAG----AA-CACCACTTTT E_telfairi300261 -ACAGAGCTGTC--AAAAAAGGCAGA--T-TAA----AT-AACCACTTTG E_telfairi300280 -ACTGCACCTTC--AT-AAAGGGCAGATTAAAA----AG-AATCACTTTT E_telfairi300364 -ACTGAGCAGTC--AA-AAAGGGCAGATTAAAA----AG----CACTTTT E_telfairi300377 -ACTGAGCCACC--CA-AATGGGCTGATTAAAA----AA----CCCTTTT E_telfairi300399 -ACTGAGGTGTC--AA-AAAGAGCAGATTAAAA----AA-TACTACTTTT E_telfairi300409 -AGTGAGCCGTC--AA-AACTGGCAGATTAAAA----AA-TACCACTTTG E_telfairi300410 -ACTGAACCGTC--AA-AAGGGGCAGATTAAAA----AAACACCAATTTT E_telfairi300480 -ACTGAGCCGTT--AA-AAAGGGCAGATTAAAA----AA-CACCACTTTT E_telfairi300495 -ACTGAGCCGTC--AA-AAAGGGCAGATTAAAA----AA-CACCAGTTTT E_telfairi300584 -ACTGAGCCGTC--AA-AAGGAGCAGATTAAAA----AC-CACCACTTTT E_telfairi300721 -ACTGAACCGTC--AA-AAGGGGCAGATTAAAA----AA-CACCAATTTT E_caballus300331 -ACTGAGCCGTC--AAGAAGAGGCAGAGAAAAA-------CACCGTTTTT E_europaeus300003 -ATTGAGCTGTC--AAGAAAGGGAAGAGTAAAG----AC--ACCACTTTT E_europaeus300020 -ATTGAACCGCC--AAGAAAGGGAAGAGTGAAG----AC--AACACTTTT E_europaeus300028 -ATTGAGCCGTC--CAGAAAGGGAAGAGTAAAG----AC--ACCACTTTG E_europaeus300029 -ATTGAGCTGTC--AAGAAAGGGAAGAGTAAAG----AC--ACCACTTTT E_europaeus300077 -ATTAAGCTGTC--CAGAAAGGGAAGAGTAAAG----AC--ACCACTTTT E_europaeus300132 -ATTGAGCCGTC--CAGAAAGGGAAGAGTAAAG----AC--ACCACTTTT E_europaeus300368 -ATTGAGCCGTC--CAGAAAGGGAAGAGTAAAG----AC--ACCACTTTT E_europaeus300381 -ACTGAGCCATC--AAGAAAGGAAAGAGTAAAG----AC--ACCACTTTG E_europaeus300386 -ACTGAGCCGTC--CAGAAAGGGAAGAGTAAAG----AC--ACCACTTTT E_europaeus300458 -ATTGAGCCGTC--CAGAAAGGGAAGAGTAAAG----AC--ACCACTTTT E_europaeus300474 -GTTGAGCTGTC--CAGAAAGGGAAGAGTAAAG----AC--ACCACTTTT E_europaeus300493 -ATTGAGCCGTC--AAGAAAGGGAAGAGTAAAG----AC--ACCACTTTT F_catus300287 -ACTGAGCCGTC--AAGAAAGGGCAGAGGAAAA----AC--ACTGCTTTT F_catus300324 -ACCGAGCCGTC--ACTAAAGGGCGGACTGAAA----ACG--CTGCTTTT G_gallus300071 -AGTGAGTTGTC--GTGGAAGGGCAGAGAAA-------AGCATCGCTTTT G_gorilla300798 -ATTGAGCCGTC--AAGAAAGGGGAGAGTGAAA----ACA--TCGCTTTT H_sapiens300710 -ATTGAGCCGTC--AAGAAAGGGGAGAGTGAAA----ACA--TCGCTTTT M_mulatta300718 -ATTGAGCCGTC--AAGAAAGGGGAGAGTGAAA----ACA--TCGCTTTT M_musculus300923 -ACTGAGCTGTC--CTGAAGGGGCAGAGT-GAA----AA-CATCACTTTT M_musculus300944 -ACTGAGCCGTC--AAGAAGGGGCAGAGTGAAA----AA-CACCACTTTT M_musculus300416 -ACTGAGCCGTT--AAGAAGGGGCAGAGTCAAA----AA-CACCACTTTT M_lucifugus300555 -ACGGAGCCCTC--AAGAGAAAGGGCAAAGTAA----AC--ACCGCTTTT M_lucifugus300706 -ACTGAGCCGTC--AAGAAAGGGCAAAGTGAAA----AC--ACTACTTTT M_lucifugus300881 -ACTGAGCCGTC--AAGAAAGGGCAAAGGAAAA----AC--ACCGCTTTT M_lucifugus300174 -ACTGAGCCGTC--AAAAAAGGGCAAAGTAAAA----AC--ACTGCTTTT O_anatinus302230 -GATGAGCCGTC--GTGAAAGGGCAGAGCAAG-----AAACATCGCTTTT O_anatinus302231 -GGGGAGCTGTC--GTGGAAGGGCAGAGCAGAAGCAGATCCATCGCTAGT O_cuniculus300074 -ATCAAG----------AAGGGGCAGAGG-GAA----AA-AA--ACATTT O_cuniculus300179 -ACTGAGCTGTC--CAGAAGGAGCAGAGCCAAA----AA-CACCACTTTT O_cuniculus300208 -ATCGAGCCGTC--CAGAATTGGCAGAGCCAAA----AG-CACCGCTTTC O_cuniculus300212 -ATTGGACCATC--AAGAGGGGGCAGAGC-AAA----AG-CATCACTTTG O_cuniculus300216 -ATCAAGCTGTC--AAGAAGGGGCAGAGC-AAA----AA-CACAGCTTTT O_cuniculus300228 -ATTGAGCCGTC--CAAAAGGGGCAGAGCCAAA------ACACTGCTTTT O_cuniculus300265 -ATCGAGCTGTC--CAGAAGGAGCAGAGCCAAA----AA-CACCACTTTT O_cuniculus300490 -ATCGAGCCGTC--CAGAAG-AGCAGAGCCAAA----AG-CACCGCTTTT O_garnettii300243 -ATTGAGCTGTC--AAGAAAGGGCAGATTAAAA----GCA--CCACTTTG O_garnettii300339 -ATGGAGCCATC--AAGAAAGGGCAGATTAACA----GCA--CCACTTTT O_garnettii300462 -ATTGAGCTGTC--AAGAAAGGGTAGATTAGGC----TC--AGCTCTTGT O_garnettii300755 -ATTGAGCCGTC--AAGAAAGGGCAGATTAAAA----GCA--CCGCTTTT P_troglodytes300585 -ATTGAGCCGTC--AAGAAAGGGGAGAGTGAAA----ACA--TCGCTTTT P_pygmaeus300778 -ATTGAGCCGTC--AA-AAAGGGGAGAGTGAAA----ACA--TCGCTTTT R_norvegicus300287 -AAATGTAAAAA--AATAAGGGACAG--T-GAA----AA-CACCACTTTT R_norvegicus300447 -ACTGAGCTGTC--AGGAAGGGGCAGAGT-GGA----AA-CAGCACTTCT R_norvegicus300772 -ACCGGTCCGTC--AGGAAGGGGCTGAGT-GAA----AA-CACCACTTTT R_norvegicus300828 -ACTGAGCTGTC--AAGAAGGGGCAGAGA-GAA----AA-CACCACTTCC R_norvegicus300900 -ACTGAGCCATC--CTGAAGGGGCAGAGT-GAA----AA-CATCACTTTT R_norvegicus300921 -GCTGAGCCGTC--AAGAAGGGGCAGAGT-TAA----AA-CACCACTTTT R_norvegicus301058 -ACTGAGCCGTC--AAGAAGGGGCAGAGT-GAA----AA-CACCGCTTTT R_norvegicus301059 -ACTGAGAC-TTTAAGAAAGGGGCA--------------------CTTTT R_norvegicus300225 CACTAAGCCATT--GAGAAGGGGCAGAGT-GAA----AA-CACCATTTTT S_cerevisiae300023 AATATATTTATTATTGGCTTGGACTGGAGAACAA---ATTTATCGATCTT S_araneus300299 -ACTGAGCCGTC--GACAAAGGACAGTGTAAAG----AT--ATCGCTTTT S_araneus300971 -ACTGAGGCATC--AAGAACGGGCAGAGT-AAA----GA-CAACACTTTT S_araneus301035 -ATTGAGCCGTC--AAGAAAGGGCAGAGGAAAG----ACA--TCGCTTTT S_araneus301054 -ACTGAGCCGTCCAAGAAAGGGGCAGAGTAAAA----GGCATCGTCTTTT S_tridecemlineatus300028 -ATTGAGTAGTC--AAGAAAGGGCAGAACGCAA----AC--ACCACTTTT T_nigroviridis300131 -GGTGAGTTGTC--GACGAAGGGCACATTGA------CGTCGTCACTGT- T_nigroviridis300132 -GGTGAGTTGTC--GACGAAGGGCACATTGA------CGTCGTCACTGT- T_belangeri300285 -ACTGAGCCGTC--AAGAAAGGGCAGAGTAAAA----AC--ACCACTTTT X_tropicalis300069 -GATGAGTTGTC--GTGGAAGAGGATAGAAA-------GACATTGCTTTT X_tropicalis300128 -GATGAGTTGTC--GTGGAAGAGGATAGAAA-------GACATTGCTTTT C_elegans300048 -GGGTGAGGTGTA-------------TTCA-ATTCAGAATGCG-----TC C_elegans300087 -GGGTGAGGTGTA-------------ACTGTATTTAGATTAGA-----TC C_familiaris300312 -GGGTGAAGCAGCAG--------CATATTGTGTTG---TTTTG-----CT C_familiaris300446 -GGATGAAGCAGCAG--------CATGTTGTGTTG---TTTTG-----CT C_porcellus300224 --GGTGAAGTCACAG--------TAGGTTCTGTTGT---TTTC-----AT C_porcellus300420 TGGGTGAAGCGGCAG--------CGTGTTGCGTTGT---TACG-----CT C_porcellus300939 -GGGTGAAGCGGCAG--------CGTGTCGTGTTGT---TATG-----CT D_rerio300172 -GGGTGAGATGGCAGT-------CTCCACATG---CTGTTTAA-----TC D_rerio300173 -GGGTGAGATGGCAGT-------CTCCACATG---CTGTTTAA-----TC D_novemcinctus300276 ---GTGAAGCAGC-AG-------CATCTTGTGTTGT---TTTG-----CT D_novemcinctus300370 -GGGT-AAGCGGC-AG-------CATCTTGTGTTGT---TTTG-----CT D_novemcinctus300411 -GTGTGAAGCGGC-AG-------CATCTTACGTTGT---TTTG-----AT D_novemcinctus300466 -GGGTGAAGTGACAG--------TCTCTTGTGTTGT---TTTG-----CT E_telfairi300073 -GGGTGAAGTGGCAA--------TATCTCATGTTGT---TCAG-----CT E_telfairi300144 -GGGTGAAGCGGCAA--------CATCTCGTGCTTT---TCAG-----CT E_telfairi300261 -GGGTGAAGCGGCAA--------CATCTTGTGTTGT---TGAA-----CT E_telfairi300280 -GGGAGAAGCGGCAA--------CATCTC-TCTGGT---TCCG-----CT E_telfairi300364 -GATTAAAGCGGCAA--------CATCTCATATTGT---TCAG-----CT E_telfairi300377 -GGGTGAATCGGCAA--------CATCTCGTG---T---TCAG-----CT E_telfairi300399 -GGGTGAAGTGGCAA--------CATCTCGTGTTGT---TCAG-----CT E_telfairi300409 -GGGTGAAGCGGCAA--------CATCTCATGTTGT---TCAG-----CT E_telfairi300410 -GGGTGAAGCGGCAAA-------CATCTCATGTTGT---TCAG-----CT E_telfairi300480 -GGGTGAAGCGGCAA--------CATCCGGTGTTGT---TCAG-----CT E_telfairi300495 -GGGTGAAGCGGTAA--------CATCTTGTGTTGT---TCAG-----CT E_telfairi300584 -GGGT-AAGCGGCAA--------CATCTCGTGTTGT---TCAG-----CT E_telfairi300721 -GGGTGAAGCGGCAAA-------CATCTCATGTTGT---TCAG-----CT E_caballus300331 -GGGTGAAGCGGCAG--------CGTGTGTTGTTGT---TCCG-----CT E_europaeus300003 -GGGTAAAGTGAC-AG-------CATGTCGTGTTGT---T-TG-----CT E_europaeus300020 --GGTGAAGCGAC-AG-------TATGTTGTGTTGT---T-TG-----CT E_europaeus300028 -GGGTGAAGCGAC-AG-------CATGTTGTGTTGT---T-TG-----CT E_europaeus300029 -GGGTGAAGTGAC-AG-------CATGTCGCATTGT---T-TG-----CT E_europaeus300077 -GGGTGAAACGAC-AG-------CATGTTGTGTTGT---T-TG-----CT E_europaeus300132 TGGGTGAAGCCAC-AG-------CATGTTGTGTTGT---T-TG-----CT E_europaeus300368 -GGGTGAAGTGAC-AG-------CATGTTGTGTTGT---T-TG-----CT E_europaeus300381 -GGGTGAAGCAGC-TG-------CATATCATGTTGT---T-TG-----CT E_europaeus300386 -GGGTGAAGCGAC-AG-------CATGTTGTGTTGT---T-TG-----CT E_europaeus300458 -GGGTGAAGCGAC-AG-------CATGTTGTGTTGT---T-TG-----CT E_europaeus300474 -GGGTGAAGAGAC-AG-------CATGTTGTATTGT---T-TG-----CT E_europaeus300493 -GGGTGAAGCAAC-AG-------CATGTCCTGTTGT---T-TG-----CT F_catus300287 -GGGTGAAGCAGCAG--------CATGCTGTGTTG---TTTTG-----CT F_catus300324 -GGACGAAGCGGCAG--------CGTGTCATGTT------CCG-----CT G_gallus300071 -GGGTGAAGTGGCAGC-------C----CGTG---CTG-TTGA-----TT G_gorilla300798 -GGGTGAAGTGGCAA--------CATGT---GTTGT----TTG-----CT H_sapiens300710 -GGGTGAAGTGGCAA--------CATGT---GTTGT----TTG-----CT M_mulatta300718 -GGGTGAAGTGGCAA--------CATGTTGTGTTGT----TTG-----CT M_musculus300923 -GGGGGAAGTGGTGA--------CAT-----GTTGT---TTG------CT M_musculus300944 -GGGTGAAGTGGCAA--------CGTGTTGTGTTGT---TTAA-----CT M_musculus300416 -GGGTGAAGTGGCAA--------CGTGTTGTGTTAT---TTAA-----CT M_lucifugus300555 -GGGTGAAGCAGC-AG-------CATGTTGTGTTGT---TTTG-----CT M_lucifugus300706 -GGGTGAGGCGGC-AG-------CATGTTGTGTTGT---TTTG-----CT M_lucifugus300881 -GGGTGAAGCGGCAG--------CGGGTTGTGTTGC--TTTTG-----CT M_lucifugus300174 -GGGTGAAGTGGC-AG-------CATGTTGTGTTGT---TTTG-----CT O_anatinus302230 -GGGTGAAGGAGCAGC-------A---ACTTGTG-CTGCTTTA-----CT O_anatinus302231 -GGGTGAGGTGGCAGC-------A---GGCTGTG-CTG-CTGG-----CC O_cuniculus300074 -TGGTGAAGTGGCAG--------CATGTTGTGTTGT---TGTG-----CT O_cuniculus300179 -GGGTGAAGTGGCAGCA------CTTGTGCTGTTGTGTTTTTG-----CT O_cuniculus300208 -GGGTGAAGCGGCAG--------CATGTTGTGCTGT---TTTG-----CT O_cuniculus300212 -GGGTGAAGTGGCAG--------CCTGT-GTGTTGT---TTCG-----CT O_cuniculus300216 -GGATGCAGTGGTAG--------CACGTTGTATTGT---TTTG-----CT O_cuniculus300228 -GGGTGAAGTTGT-------------ATTGTGTTAT---TTTG-----CT O_cuniculus300265 -GGGTGAAGTGGCAG--------CTTGTTGTGTTGT---TTTG-----CT O_cuniculus300490 -GGGTGAAGCGGCAG--------CATGTTGTGCTGT---TTTG-----CT O_garnettii300243 -GGGTGAAGTGGCAG--------TATTTTGTGTTGT---TTTA-----CT O_garnettii300339 -GGGTGAAGTGGCCG--------CATTTTGTTTTGT---TTTA-----CT O_garnettii300462 -GGCTCAAGCAGCTAA-------GGCGCCAGTCACA---TACA-----CC O_garnettii300755 -GGGTGAAGTGGCAG--------CATTTTGTGTTGT---TTTA-----CT P_troglodytes300585 -GGGTGAAGTGGCAA--------CATGT---GTTGT----TTG-----CT P_pygmaeus300778 -GGGTGAAGTGGCAA--------CATGT---GTTGT----TTG-----CT R_norvegicus300287 -GGGTGAAGTGGCAA--------CGTGATGTGTTGT---TTAA-----CT R_norvegicus300447 -GG-TGACGAGGCAA--------CATGATGTGTTGT---TTAA-----CT R_norvegicus300772 -GAGTGAAGTGGCAA--------CATGAT--GTTGT---TTAC-----CT R_norvegicus300828 -GGGTGAAGTGGCAA--------CATAATTTGTTGT---TTAA-----CT R_norvegicus300900 -GGGAGAAGTGGTAA--------CGC-----GCTGT---TTG------CT R_norvegicus300921 -GGGTGAAGTGGCAA--------CTTGTTGTGTTGT---TTAA-----CT R_norvegicus301058 -GGGTGAAGTGGCAA--------CATGCTGTGTTGT---TTAA-----CT R_norvegicus301059 -GGGTGAAGTGGCAA--------CATGATGTGTTGT---TTTAATAGTTT R_norvegicus300225 -GGGTGAAGTGGCAA--------CATATTGCGTTGT---TAA------CT S_cerevisiae300023 -GGGTGCAACAGTCTTTCTGTCGTCTGTTTTTTAGCAGATCTAAGGGTTT S_araneus300299 -GGGTGAAGCAGC-CA-------CATGTTGTGTTGT---TTGG-----CT S_araneus300971 -GGGTGAAGTGGCGG--------CATGTTGTGTTCT---TTGG-----TT S_araneus301035 -GGGTGAAGCGGCAA--------CGTGTCATGTTGT---TCGA-----CT S_araneus301054 -GAGT-AAGCGGAAA--------CGTGTCTTGTTGC---TT-AATATCAT S_tridecemlineatus300028 -GGATGAAACGGC-AT-------CAGGCTATGTTGT---TTTG-----CT T_nigroviridis300131 -GGGTGAGACGGCAGC-------GCCTGGCTGTGGCTGACTGG-----TC T_nigroviridis300132 -GGGTGAGACGGCAGC-------GCCTGGCTGTGGCTGACTGG-----TC T_belangeri300285 -GGGTGAAGTGGCAG--------CGTGTTGTGTTGT---TTTG-----CT X_tropicalis300069 -GGGTGAAGAGGCAGC-------T---ACATGTG-CTGTTCTG-----CT X_tropicalis300128 -GGGTGAAGAGGCAGC-------T---ACATGTG-CTGTTCTG-----CT C_elegans300048 TCAAT-A-ACACGATGACAATT--------------------------- C_elegans300087 TCAAT-A-ACACGATGACAGTT--------------------------- C_familiaris300312 TCAATCG-GTGGTGTGACAAGG--------------------------- C_familiaris300446 TCAATCG-GTGATATGACAGGG--------------------------- C_porcellus300224 CCAATTA-GTGGTGTAACAGAC--------------------------- C_porcellus300420 TCATTTG-GTGGTGTGACAAGA--------------------------- C_porcellus300939 TCAATCG-GTGGTGTGACAAGA--------------------------- D_rerio300172 TCAATCC-GTGATGGAACAAAT--------------------------- D_rerio300173 TCAATCC-GTGATGGAACAAAT--------------------------- D_novemcinctus300276 TCAATCA-GTGGTGTAGTAAAG--------------------------- D_novemcinctus300370 TCAATCG-GTGGTATGACAAGG--------------------------- D_novemcinctus300411 TCAATCA-GTGGTATGACGATG--------------------------- D_novemcinctus300466 TCAATTG-GTGGCATGACAGGA--------------------------- E_telfairi300073 TCAGTCG-GTGATGTGACAAAA--------------------------- E_telfairi300144 TCAATCG-GTGACGTTACAGAA--------------------------- E_telfairi300261 TCAATCG-GTGATGTGACAAAG--------------------------- E_telfairi300280 TCCATCA-GTGTTGTGACGACA--------------------------- E_telfairi300364 TCAATCA-GTGATGTGACAAAA--------------------------- E_telfairi300377 TCAATCA-GTGATGTGACCAAA--------------------------- E_telfairi300399 TCAATCA-GTGATGTGACAAAA--------------------------- E_telfairi300409 TCAATCA-GTGATGTGACCAAA--------------------------- E_telfairi300410 TCAATCA-A-GATGTGACAAAA--------------------------- E_telfairi300480 TCAATCG-GTGATGTGACAAAA--------------------------- E_telfairi300495 TCAATCA-GTGATGTGACAAAA--------------------------- E_telfairi300584 TCAATCG-GAGATGTGACAAAA--------------------------- E_telfairi300721 TCAGTCA-ATGATGTGACAAAA--------------------------- E_caballus300331 TCAATCG-GCGTTGTGACAGCG--------------------------- E_europaeus300003 TCAGTCG-GTGGTGTGACAAGT--------------------------- E_europaeus300020 TCAATCG-GTGGTGTGACAAGT--------------------------- E_europaeus300028 TCAATCA-GTGGTGTGACAAGT--------------------------- E_europaeus300029 TCAATCC-GTGGTGTGACAAGT--------------------------- E_europaeus300077 TCAATCG-GTGGTGTGACAAGT--------------------------- E_europaeus300132 TCAATCA-GTGGTGTGACAAGT--------------------------- E_europaeus300368 TCAATTG-GTGGTGTGACAAGT--------------------------- E_europaeus300381 TCAATCC-AATGTGTGACAAGT--------------------------- E_europaeus300386 TCAATCG-GTGGTGTGACAAGT--------------------------- E_europaeus300458 TCAATCG-GTGGTGTGACAAGT--------------------------- E_europaeus300474 TCAATCC-ATGGTGTGACAAGT--------------------------- E_europaeus300493 TCCATCA-GTGGTATGACAAGT--------------------------- F_catus300287 TCAATCG-GTGGTGTGACAAGG--------------------------- F_catus300324 TCCGTTG-G---TGTCACAAGC--------------------------- G_gallus300071 TCAATGG-GCGATGTGACAACG--------------------------- G_gorilla300798 TCAATCG-GTGGTGTGACAAGG--------------------------- H_sapiens300710 TCAATCG-GTGGTGTGACAAGG--------------------------- M_mulatta300718 TCAATCG-GTGGTGTGACAAGG--------------------------- M_musculus300923 TCAATCA-GTGTTGTGACAAGA--------------------------- M_musculus300944 TCAATCG-GTGTTGTGACAAGA--------------------------- M_musculus300416 TCAATCG-GTGTTGTGACAAGA--------------------------- M_lucifugus300555 TTAATCG-GTGGTGTGACAAGT--------------------------- M_lucifugus300706 TCAATGG-GTGGTGTGACAAGG--------------------------- M_lucifugus300881 TCAATCG-GTGGTGTGACAAGG--------------------------- M_lucifugus300174 TCAATCA-GTGGTGTAACAAAG--------------------------- O_anatinus302230 TCAATCG-GCGATGAGACAGGC--------------------------- O_anatinus302231 TCAGTCA-GTGGTGTGACATGG--------------------------- O_cuniculus300074 TCAATTA-GTGCTGTTACACGA--------------------------- O_cuniculus300179 TCAATCA-GTGGTGTGACAAGA--------------------------- O_cuniculus300208 TCAATCG-GTGGTGTGACAAGA--------------------------- O_cuniculus300212 TCAGTCG-GTGCTGTGACAAGA--------------------------- O_cuniculus300216 TCAATCA-GTGATGTGACAAGA--------------------------- O_cuniculus300228 TTAATCA-GTAATGTAACTGCA--------------------------- O_cuniculus300265 TCAATCG-GTGGAACAAGATGT--------------------------- O_cuniculus300490 TCAATCG-GTGGTGTGACAAGA--------------------------- O_garnettii300243 TTATTTG-GTGGTGTGACAAGG--------------------------- O_garnettii300339 TCAATCA-GTGGTGTAACAAGA--------------------------- O_garnettii300462 TGAGCTG-G---------------------------------------- O_garnettii300755 TCAATTG-GTGGTGCAACAAGA--------------------------- P_troglodytes300585 TCAATCG-GTGGTGTGACAAGG--------------------------- P_pygmaeus300778 TCAATCG-GTGGTGTGACAAGG--------------------------- R_norvegicus300287 TCAATCG-GTGTTGTGACACGA--------------------------- R_norvegicus300447 TCAGTCG-GTGTTGTGACAAGA--------------------------- R_norvegicus300772 TCAATCG-GTGTTGTGACACAA--------------------------- R_norvegicus300828 TCAATCC-GTGTTGTGACAAGA--------------------------- R_norvegicus300900 TCAGTCA-ATGTTGTGACAAGA--------------------------- R_norvegicus300921 TCAATCA-GTGATGTGACAAGA--------------------------- R_norvegicus301058 TCAATCG-GTGTTGTGACAAGA--------------------------- R_norvegicus301059 CTTTTCT-TTTTTAAAACAAGG--------------------------- R_norvegicus300225 TCAATCC-GTGTTGCAACAAGA--------------------------- S_cerevisiae300023 ACCTTCGTGTGCCCGGATGAGGACCGTTGCAAGGATTGATAATACAACT S_araneus300299 TCAGTCA-GCGGTGTAACAACG--------------------------- S_araneus300971 TCAGTCA-GCTGTGTAACAAGG--------------------------- S_araneus301035 TCAATTG-GCGGTGTAACAAGA--------------------------- S_araneus301054 CCGGCGG-ATGT----ACAAGG--------------------------- S_tridecemlineatus300028 TCAATTG-ATGGTATGATGAGG--------------------------- T_nigroviridis300131 TCAATCA-GTGGGGAGACAAGC--------------------------- T_nigroviridis300132 TCAATCA-GTGGGGAGACAAGC--------------------------- T_belangeri300285 TCAATCC-GTGGTGTGACAAGG--------------------------- X_tropicalis300069 TCAATCA-GTGATGTGACACAA--------------------------- X_tropicalis300128 TCAATCA-GTGATGTGACAAGT---------------------------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved