snOPY snoRNA Orthological Gene Database

Family: SNORA20

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300185 ----CTTCCCATTGATT-GCTGCT-CTAGTCTTTTAGTGATATAAGCAGT C_porcellus300887 ----CTTCCCATTTATTTGCTGCT-GTAGTCTGTCAGTGACATGAGCAGT D_novemcinctus300059 ----ATTCCCATTTATTTGCTGCT-AT-GTCTCTCAGTGATATGAGCAGT D_novemcinctus300362 ----GTTCTCATTTATTTGCTGCT-GTTGTCTCTCAGTGATATGAGCAGG D_novemcinctus300388 ----CTTTGCATTTATTTGCTGCT-GTTGTCTCTGAGTGATATGAGCAGT E_telfairi300009 ----TTTCCCATTGATTTGCTGCT-ATTGTCTGTCAGTGATATGAGCAGT E_telfairi300101 ----TTTCCCATTGATTTGCTGCT-GTTGTCTGTCAGTGATAAGAGCAGT E_telfairi300205 ----TTTCCCATTGATTTGCTGCT-TTTGTCTCTCAGTGATATGAGCAGT E_telfairi300210 ----TATCCCATTGATTTGCTGCT-ATTGTCTGTCAGTGACATGAGCAGT E_telfairi300268 ----TTTCCCATTGATTTGCTACT-ATTGCCTGTCAGTGATATGAGCAGT E_telfairi300389 ----ACCCCCAGTGATTTGCTGCT-ATTATCTGTCAGTGATGTGAGCAGT E_telfairi300496 ----TTTCCCATTGATTTGCCGCT-ATTGTCTGTCAGTGATATGAGCAGT E_telfairi300564 ----TCCCCCATTGATTTGCTGCT-ATTGTCTGTCAGTGATATGAGCAGT E_telfairi300614 ----TTTCCCATTGATTTGCTGCT-ATTGTCTGTCAGTGATATGAGCAGT E_telfairi300691 ----TTTCCCATTGATTTGCTGCT-ATTGTCTGTCAGTGATATGAGCAGG E_caballus300384 ----CTTCCCATTGATTTGCTGCT-ATAGTCTCTCAGTGATATGAGCAGT F_catus300282 ----CTTCCCATTGATTTGCTGCT-CTAGTCTTTCAGTGATCAGAGCAGT H_sapiens300538 ----CTTCCCATTTATTTGCTGCTTGTAGTCTCACAGTGATACGAGCAGT L_africana300471 ----CTTCCCATTTATTTGCTGCT-ATCGTCTCTCAGTGATATGAGCAGT M_mulatta300057 ----CTTCCCATTTATTTGCTGCTTATAGTCTCACAGTGATATGAGCAAT M_mulatta300236 ----CTTCCCATTTATTTGCTGCC-ATAGCCTCATAATGATACAAGCAGT M_mulatta300472 ----TTTCCCATTTATTTGCTGGT-ATAGTCTCACAATGATATGACCAGT M_mulatta300570 ----CTTCCCATTTATTTGCTGCTTATAGTCTCACAGTGATATGAGCAGT M_murinus300039 ----------TGTTGTATACTGCG-ATAGTCTTACAATGATATGATCAGT M_murinus300233 ----CTTCTCACTTATTTGTTGCT-ACAGTCTCACAGTGATAAGAGCAGT M_murinus300284 ----------------TTTCTTAGAAAACAGAGCTGGAAGTT-------- M_murinus300495 ----CTTCCCATTTATTTGCTGCC-ATAGTCTTACAATGATATGGGCAGT M_musculus300675 ----TTTCCCATTAATTTGCTGTT-CTAGTCTGTCAT-------AGCAGT M_musculus300913 ----TTTCCCATTAATTTGCTGCT-CTAGTCTGTCAGTGATAGGAGCGGT O_cuniculus300215 ----TTTCCCATTTGTTTGCTGCT-GTGGTGTCCCAATGCTATGAGTCGT O_cuniculus300294 ----CTTGCCATTTACTTGCTACT--TGATCTCTCAATGCTATGAGCAGT O_cuniculus300331 ----CTTTCCGTTTATTTGCTGCT-ATGGGCTCTCAGTGCTATCAGCAGT O_cuniculus300425 ----CTTCCCATCTATTTGCTGCT-GTAGTCTCTCCATGCTATGAGCAGT O_cuniculus300474 ATATTCAAATAAAGACAGTTTGAAAAACACTTGCCAATGCTTTGAGCAGT O_garnettii300659 ----TTTCCCATTTATTTGCTGCC-ATAGTCTTACAATGATATGAGCAGT P_troglodytes300042 ----CTTCCCATTTATTTGCTGGT-ATAGTCTCACAATGATATGACCAGT P_troglodytes300127 ----CTTCCCATTTATTTGCTGCT-ATAGTCTCATAATGATACAAGCAGT P_troglodytes300204 ----CTTCCCATTTATTTGCTGCTTATAGTCTCACTGTGATATGAGCAAT P_troglodytes300331 ----CTTCCCGTTTATTTGCTGGT-ATAATCATACAATGATATGAGCAGT P_troglodytes300495 ----CTTCCCATTTATTTGCTGCTTGTAGTCTCACAGTGATACGAGCAGT P_pygmaeus300302 ----CTTCCCATTTATTTGCTGGT-ATAGTCTCACAATGATATGACCAGT P_pygmaeus300309 ----CTTCCCATTTATTTGCTGCT-ATAGTCTCATAATGATACAAGCAGT P_pygmaeus300546 ----CTTCCCATTTATTTGCTGCTTATAGTCTCACAGTGATATGAGCAAT P_pygmaeus300708 ----CTTCCCATTTATTTGCTGCTTGTAGTCTCACAGTGATATGAGCAGT R_norvegicus300008 ----TTTCCCATTAATTTGCTGCT-CTAGTCTGTCAGTGATAGGAGCGGT R_norvegicus300408 ----ACCCCCATTAATTTGCTGCT-CTTTTCTATCAGTGATAGGAGCGGT R_norvegicus300590 ----TTTCCCATTAATCTGTTGCT-CTTGTCTGTCAGTGATAAGAGTGGT R_norvegicus301070 ----TTTCCCATTAATTTGCTGCT-CTAGTCTGTCAGTGATAGGAGCAGT S_araneus300899 ----CTTCCCATTGATTTGCTGCT-CTGCTCTGGCAGTGATCTGAGCAGT S_araneus301072 ----CTTCCCATTGATTTGCTGTT-CTAGTCTGGCAATGATATGAGCAGT S_araneus301084 ----CTTCCCATTGATTTGCTGCT-CTAGTCTGGCAATGATATGAGCAGT S_tridecemlineatus300226 ------------------ATTCAAACAAATCTGTTAGAACTTCTCTCATT T_belangeri300045 ----CTTCCCATTTATTTGCTGCT-ATTGTCTTTCAGTGATATGAGCAGT T_belangeri300313 ----CTTCCCATTTATTTGCTGCT-ATTGTCTTTCAGTGATATGAGCAGT C_familiaris300185 T-ATATACATGAGAGAGAACAGTATTAGG--GTGTTGCAA----AAGGAG C_porcellus300887 T-ATACGCGTGGGATACAGTAGTGTTGGGC--CATTGTAC----ACTGAG D_novemcinctus300059 T-ATACGTGTGGGATAAAATAATACTGGGC--TATTGTAA----ATTGAG D_novemcinctus300362 T-ATATGCATGGAATAAAATAATACTGGGT--TTTTGTAA----ATTGAG D_novemcinctus300388 T-ATACGCATGGGATAAAATAATATTGGGC--TATTGTAA----ATCAAA E_telfairi300009 T-ATACGCATGGGATAAAAATATAGAGGAC--CCTTGCAA----ATTGAG E_telfairi300101 T-ATACGCATGGGATAAAA-TATATGAGAC--CCTTGCAA----ATTGAG E_telfairi300205 T-ATATGCATGGGATAAAA-TATATGAGAT--GCTTGCAA----ATTGAG E_telfairi300210 T-ATAAGCTTGGGATAAAA-TATATGAGAC--GCTTGCAA----ATTGAG E_telfairi300268 T-ATACGCATGGGATAAAA-CATATGGGGC--CCTTGCAA----ATTGAG E_telfairi300389 T-ATACGCATGGGACAAAA-TACACGAGAC--TCTTGCAA----ATTGAG E_telfairi300496 T-ATACACATGGGATAAAA-TATATGAGAC--CCTTGCAA----ATTGAG E_telfairi300564 T-ATGTGCATAGGATAAAA-TATATGAGAC--CCTTTCAA----ATTGTG E_telfairi300614 T-ATACACATGGGATAAAA-TATATGAGAC--CCTTGCAA----ATTGAG E_telfairi300691 T-ATACGCATGGAATAAAA-T----GAGAC--CCTTGCAA----ATTGAG E_caballus300384 T-ATACGCATGGGATAAAATAATACTGGGC--CATTGTAA----ATTGAG F_catus300282 T-ATACGCGTGGGAGAGAACAATAGTAGGCCGTGCGCTAC----CACGAG H_sapiens300538 T-ATACGCATGGGATAAAATAACATTGGGC--CACTGTAA----ATTGAG L_africana300471 T-ATACGCATGGGATAAAA-TATGCTGGAC--GTTTGTAA----ATAGAG M_mulatta300057 T-ATACACATGGGATAAAATAATATTGGGA--CACTG-------GTTAG- M_mulatta300236 T-ACATGCATGGGATAAAATAATATTGGGA--CATTGTAA----ATTGAA M_mulatta300472 T-ATACTCATGGGAAAAAATAATATTGGGC--CATTGTAA----ATTGGC M_mulatta300570 T-ATACGCGTGGGATAAAATAACATTGGGT--CACTGTGA----ATTGAG M_murinus300039 T-ATACGCATGGGATAAAATAATACTGGCC--CATTATAA----ATTGAG M_murinus300233 T-ATACACATGGGATAAAACAGTATTGGGC--CATTATAA----ATTAAG M_murinus300284 --ATACACATGGGATAAAATAATACTGGGC--CATTATAA----ATTGAG M_murinus300495 T-ATACGCATGGGATAAAATAATACTGGTC--CATCATAA----ATTGAG M_musculus300675 T-ATACACATGGGATA-----ATATTGGGC--CATTGTAC----ATAGAG M_musculus300913 T-ATACGCATGGGATAAAACAATATTGGGC--CATTGTAC----ATGGAG O_cuniculus300215 T-CTATGCATGGGATAAACTAATACTGGGC--CGTTGTAA----ACGGAG O_cuniculus300294 T-ATATACATGGGATAAAATAGTATCGGGC--CATTGTAA----ATGGAG O_cuniculus300331 T-GTACAAATGGGATAAACTAATATTGGGC--CATTGTAA----ATGCAG O_cuniculus300425 T-ATACGCGTGGGATAAAATAACACTGGGC--CATTGTAACTAAATGGAG O_cuniculus300474 T-ATACACATGGGATAAAATAATATTGGGC--CATTGTAA----ATGGAG O_garnettii300659 T-ATACGCATGGGATAAAATAATAGTGGGC--CATTGTCA----GTTGAG P_troglodytes300042 T-ATACTTATGGGAAAAAATAATATTGGGC--CATCGTAT----ATTGAC P_troglodytes300127 T-ATATGCATGGGATAAAATAATATTGGGA--CATTGTAA----ATTGAA P_troglodytes300204 T-ATACACATGGGATAAAATAATATTGAGC--CACTGTAA----ATTGAG P_troglodytes300331 T-ATACTCTTTGGAAAAAATAATATTGGGC--CATTGTAA----ATTGAT P_troglodytes300495 T-ATACGCATGGGATAAAATAACATTGGGC--CACTGTAA----ATTGAG P_pygmaeus300302 T-ATACTTATGGGAAAAAATAATATTGGGC--CATTGTAA----ATTGAC P_pygmaeus300309 T-ATATGCGTGGGATAAAATAATATTGGGG--CATTGTAA----ATTGAA P_pygmaeus300546 T-ATACACATGGGATAAAATAATATTGAGC--CACTGTAA----ATTGAG P_pygmaeus300708 T-ATACGCATGGGATAAAATAACATTGGGC--CACTGTAA----ATTGAG R_norvegicus300008 T-ATACGCATGGGATAAAACAATATTGGGC--CATTGTAC----GTGGAG R_norvegicus300408 T-ATACGCATGGGATAAAACAATATTGGGC--TATTGTAC----ACGGAG R_norvegicus300590 T-ATACACATGGAATAAAACAATATTGGGC--CATTATAC----ATGGAG R_norvegicus301070 T-ATACGCATGGGATAAAACAATATTGGAC--CATTTTAC----GTGAAG S_araneus300899 T-ATACGCGTGGGATATAGTGACAGGAGAC--TTTTGTAA----ATGGGG S_araneus301072 T-ATACGCATGGGATAGAGTGACATGGGAT--CTTTGTAA----ATGGGG S_araneus301084 T-ATATGCATGGGATAGAGTGACATGGGAT--CTTTGTAA----ATGGGG S_tridecemlineatus300226 CAATACATATGGGATAAAACAATATTGGGC--CATTGTAA----ATTGAG T_belangeri300045 T-ATACGCATGGGATAAAATAATGGTGCAC--CATTGTAA----ATTGAG T_belangeri300313 T-ATACGCATGGGATAAAATAATGGTGCAC--CATTGTAA----ATTGAG * * * C_familiaris300185 ATGGG---AGTA--ACCAT-TTCATCTCTTCTGTG-AAGTCCAGACATTG C_porcellus300887 ATG----AAGTG--GCTACGTCA-TCTCTTCTGCA-TGGTCTGGACATGT D_novemcinctus300059 ATG----GAATA--ACCAT-TTCATCTCTTCTGCA-TGGTCTAGACATTG D_novemcinctus300362 ATG----GAGTA--ACAAT-TTCTTCTCTTCTGCA-TGGTCTAGACATAG D_novemcinctus300388 ATG----GAGTA--ACCAT-TTCATCTCTTCTCCA-TGGTTTAGACATTG E_telfairi300009 ATGAA---AATA---TCATTTTC-TCTCTTCTGGCATGGTCTGAATATCG E_telfairi300101 ATGAA---AATA--ATCATTTTC-TCTCTTCTG-CATGGCCTGGACATTG E_telfairi300205 ATGAA---AATA--ATCATGTTC-TCTCTGCTG-CATGGTCTGGATATTG E_telfairi300210 ATGCA---AATA--ATCATATTC-TCTCTTCTG-CATGGTCTGGGCATTG E_telfairi300268 ATGAA---AATA--ATCGT-TTC-TCTCTTCTG-TATGGTCTGGACATTG E_telfairi300389 ATGAA---AGTA--ATCATTTTC-TCTCTTCTG-TGTGGTCTGGACATTG E_telfairi300496 ATGAA---AATA--ATCATTTTC-TCTCTTCTG-CATGGCCTGGACATTG E_telfairi300564 ATGAA---AATA--ATCATTTTC-TCTTTTCTG-CATGGTCTGGACATTG E_telfairi300614 ATGAA---AATA--ATCATTTTC-TCTCTTCTG-CATGGCCTGGACATTG E_telfairi300691 ATGAA---AATA--ATAATTTTC-TCTCTTCTG-CATGGCCTGGACATTG E_caballus300384 ATG----GAGTA--ACCAT-TTCATCTCTTCTGCA-TGGCCAAGACATGG F_catus300282 ATGG----AGTA--ACCAT-TTCATCTCTTCTGCA-CGGTCCAGACACTG H_sapiens300538 ATG----AAGTA--ACCATTTTCATCTCTTCTGCA-GGGACTAGACATTG L_africana300471 ATGAAGTCACTA----TATTTTA-TCTCTTCTG-CATGGTCTAGACATGC M_mulatta300057 --------------------TTCATCTCTTCTGCA-TGGACTAGACATTG M_mulatta300236 ATG----AAGTC--ACCCTTTTCATCTTTTCTGCA-TGGACAAGACACTG M_mulatta300472 ATC----AAGTA--ACTATTTTCATCTCTTCTGCG-TGGACTATATATAT M_mulatta300570 ATG----AAGTA--ACCATTTTCATCTCTTCTGCA-TAGACTAGACATTG M_murinus300039 GTG----AAGTA--ACCATTTTCATCTCTTGTGCA-TGGACTAGACATTG M_murinus300233 ACAGAGTAAATA--ACCATTTTCATCTCTTTTGCA-TAGATTAGACATTG M_murinus300284 GTG----AAGTA--ACCATTTTCATCTCTTGTGCA-TGGACTAGACATTG M_murinus300495 GTG----AAGTA--ACCATTTTCATCTCTTGTACA-TGGACTAGACATTG M_musculus300675 A-------AGTG--TGTTTTGTC-CCTC-CTGCA--TGGTCCAGACATTG M_musculus300913 ATG----AAATG--TGTTTTGTC-TCTC-GTACA--TGGTCTAGACATTG O_cuniculus300215 ATG----AAGTA---ATAGTGTCATCTCTCCTGCA-TGGTCTAGACATCG O_cuniculus300294 ATG----AAGTAGTAACAGTGTCATCTCTCCTATG-TGGTCTGCACATTG O_cuniculus300331 ATG----AAGTA---ACAGTGTCATCTTTCCTGCG-TGGTCTAGATGTTG O_cuniculus300425 GTG----ACGTA--ACTGAGTCA-TCTCTGCTCCG-TGGTCTAGACATGG O_cuniculus300474 ATG----AAAT-----GAGTGTCATCTCTCCTACG-CAGTCTAGACATTG O_garnettii300659 ATG----AAATA--ACCATTTTCATCTTTTGTGCA-TGGACTAGACATTA P_troglodytes300042 AT-----GAGTA--ACTATTTTCACCTCTTCTGCA-TGGACTATCTATAT P_troglodytes300127 ATG----AAGTA--ACCATTTTCATCTTTTCTGCA-TGGACAAGACATTG P_troglodytes300204 ATG----AAGTA--ATCGTTTTCATCTCTTCTGCA-TGGACTAGACATTG P_troglodytes300331 ATG----AAGTA--AGTATTTTCATATCTTCTGTAATGGACTAGATGTTG P_troglodytes300495 ATG----AAGTA--ACCATTTTCATCTCTTCTGCA-TGGACTAGACATTG P_pygmaeus300302 AT-----GAGTA--ACTATTTTCACCTCTTCTGCA-TGGACTATACATAT P_pygmaeus300309 ATG----AAGTA--ACCATTTTCATCTTTTCTGCG-TGGACAAGACATTG P_pygmaeus300546 ATG----AAGTA--ACCATTTTCATCTCTTCTGCA-TGGACTAGACATTG P_pygmaeus300708 ATG----AAGTA--ACCATTTTCATCTCTTCTGCA-TGGACTAGACATTG R_norvegicus300008 ATG----AAGTG--TGTTTTTGT-CTCTTGTAGAA-TAGTCTAGACACTG R_norvegicus300408 ATG----AAGTG--TGTTTTGTC-TCTT-GTACA--TGGTCTGGACATTG R_norvegicus300590 ATG----GAGTG--TGTTTTGTC-TGTCTAGACAC-TGTTCTTGGTACCT R_norvegicus301070 ATG----AAGTG--TGTTTTTGT-CTCTTGTAGAA-TGGTCTAGACATTG S_araneus300899 GTG----CAGTG--TCTGTTCCA-TCCCCGGTGCA-TGGTCTCGACATTG S_araneus301072 ATG----AAGTG--ACAGTTTCA-TCCTGCCTGCA-TGGTCTCAATATTG S_araneus301084 ATG----AAGTG--ACAGTTTCA-TCCCGCCTGCA-TGGTCTTAATATTA S_tridecemlineatus300226 GTG----AAGT-----CACTTTCATCTCTTCTTCA-TGGTCTAGATAGTG T_belangeri300045 ATGAGCCGATTA--CCCGTTTCA-TCTCTTC-GTCATGGTCTACACATTG T_belangeri300313 ATGAGCTGATTA--CCCGTTTCA-TCTCTTC-GTCATGGTCTACACATTG

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved