snOPY snoRNA Orthological Gene Database

Family: SNORA19

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300070 -------TTGCACAAAGAAAGGAGAG-GATAAAAGAGAGAA-CCAGTATG C_familiaris300338 ----------------GTGCACATTT-TGTTGACCTGCTTTCTCTTGCGT C_familiaris300354 ----------------GTGCACATTT-CATTGACCTGCTTT-TCTTGTAT C_porcellus300965 ----------------GTGCACATTT-TGTTGACCTGCTTTCTCTTGCGT C_porcellus301039 ----------------ATGCACATTT-CATTGACCTGCTTTCTTTCATAT D_rerio300227 ----------------GTGCACATTT-CATTGTCCCATTC-TTCC-CATG D_novemcinctus300068 ----------------TAGCACATTT-CATTGACTTGCTTTCTTTT---- D_novemcinctus300562 ----------------TTGCACATTT-CATTGACCTGCTTTCTTTT---- D_melanogaster300174 ---------------------------CGTGCACTTAATTAGGTATCTCT E_telfairi300470 ----------------GTGCACATTT-CATCGACGTGCTACCATTT--GT E_telfairi300812 ----------------GTGCACATTT-CATTGACCTGCTTCCATTT--AT E_telfairi300868 ----------------GTGCACATTT-CATTGACCTGCTTCCATTT--AT E_caballus300355 ----------------GTGCACATTT-CATTGACCTGCTTTCTCTCGTAT E_europaeus300141 ----------------GTGCACATTT-CATTGATCCACTTACTTCTGTTT E_europaeus300161 -------------------------------------------------- E_europaeus300263 ----------------GTGCACATTT-CACTGGCCCGCTTTCTTCTGTTT E_europaeus300498 -------------------------------------CAGGACAAATTAT E_europaeus300516 ----------------GTGCACATTT-CATTGACCTGCTTTCTTCTATCT E_europaeus300607 ----------------GTGCACATTT-CATTGACCTGCTTTCTTCTGCTG E_europaeus300670 ----------------GTGCACGTTT-CATTGACTTGCTTTCTTCTGTTT E_europaeus300713 ----------------GTGCACCTTT-TATTGACATGCTATTTTCTGTTT F_catus300044 ----------------GTGCACATTT-CATTACCCCGTGTTCTCTTGTAT F_catus300320 ----------------ATGCACATTT-CATTGACCTGCTTTCTTTTGTAT G_gallus300094 ----------------ATGCACATTT-CATTGACCTGCTTTCATTGCAAG H_sapiens300474 ----------------GTGCACATTT-CATTGACCTGCTTTCTTTT---- L_africana300050 ----------------GCGCACATTT-CTTTGGCCTACTT-CTTTTACAT L_africana300062 GAATATGTTCCTTTCACCTTCTTGCT-CTAATGACAACCCAGCTTTCCCT L_africana300223 -------------------------------------------------- L_africana300378 ----------AGACACAATTCAATCCATAACAACCTGTTTTCTTATATAT L_africana300460 ----------------GTGCACATTT-CACTGACCTGCTTTCTTTTATAT M_mulatta300137 ----------------GTGCACATGT-CATTGACCTGCTTTCTTCTGTAT M_mulatta300138 ----------------GGGCACATTT-CATTGTCTTTTTTCTTTATTTCA M_murinus300084 ----------------GTGCACATTC-CATTGACCTGCTTTCATTTGTAT M_domestica300013 ----------------GTGCACATTT-CATTGACCTGCTTTCATTGTTCA M_domestica300108 ----------------CTGCACATTT-CATTGACCTGCTTTCGTTGTAT- M_domestica300109 ----------------GTGCACGTTT-CATTGACCTGCTTTCATTGTTCA O_anatinus304382 ----------------GTGCACATTT-CGTTGACCTGCCTTCT-CTATAA O_anatinus304383 ----------------GTGCACATTT-CATTGACCTGCTTTCATTGCATT O_anatinus304384 ----------------AAGCACATCC-CACTGTCTTTTTTTCTGTTCTGG O_cuniculus300047 ----------------TTGCACATTT-TATTGACCTGCTTTCTTTTGCAT O_cuniculus300335 ----------------CTGCACATTT-CATTGTCCTGCTTTCTTT-GTAT O_cuniculus300448 ----------------CTGCACATTT-CATTGGCCTGCTTTCTTT-ATAT O_garnettii300007 -TATCACAAAGTATTATTCTTCTTTT-GATGTTTTTTCAACCATTTAAAA O_garnettii300014 ----------------ATGCACATTT-CATTGACCTGCTTTCTTC----- O_garnettii300049 ----------------GTGCACATTT-CATTGACCTGTTTTCTTTA---T O_garnettii300053 -----------------TCGATAATG-TTTCTAAAGTCCTGTCG---TAT O_garnettii300073 ------------------------------------------GTGTAAAA O_garnettii300105 -----------------------------------ATGGTCAACATCAAG O_garnettii300127 -------------------------------------------------- O_garnettii300142 AAACACAAGTTCAAGAATAAAATGAT-TAAGAATTTTCAGGAAATATATA O_garnettii300148 --------------------------------AGGTAATAGCATTGAAAG O_garnettii300163 ----------------GAGCACATTT-CATTGACCTGCTTTCTATG---T O_garnettii300165 -------------------------------TGGCATGAATGGACAAGAA O_garnettii300202 -----------------------------------ATGAATGGTTATATG O_garnettii300213 ----------------GTGCACATTT-CATTGACCTGCTTTCTTTA---T O_garnettii300252 --------------------TTGATG-TTT-TAAAATGCTGCCTGGTTAT O_garnettii300264 ----------------GTGCACATTT-CATTGACCTGCTTTCTTTA---T O_garnettii300321 ----------------GTACACATTT-CATTGACCTGCTTTCTCTG---T O_garnettii300351 -------------------------------------------------- O_garnettii300365 -------------------ATAACCA-GATAGCTGAAATTTTATGAAGAA O_garnettii300373 ----------------GTGCACATTT-CATTGACCTGCTTTCTTTA---T O_garnettii300376 -------------------------------------------CTGCAAG O_garnettii300382 -------------------TTTTATT-TTAAAAATAGTTCACCCTTTTGT O_garnettii300408 -----------------------AGG-AACAAAATTGACACCATTGAAAA O_garnettii300414 --------------------TTGATG-TTT-TAAAATGCTGCCTGGTTAT O_garnettii300434 -------TTTCATAAAAAATTCTATT-GGTAGCTAAAAAACAA-AACAAA O_garnettii300452 ----------------GTGCACATTT-CATTGACCTGCTTTCTTTA---T O_garnettii300461 ------------------AAGTAGAG-TGTTAAGATCAGAAGTCCATATG O_garnettii300472 ------------------TTGTCACC-ATCAGAA-ACTACATCCTTTTAT O_garnettii300507 ----------------GTGCACATTT-CATTGACCTGCTTTCTCTG---T O_garnettii300565 -------------------------------------------------- O_garnettii300590 -------------------------------------------------- O_garnettii300674 ----------------GTGCACATTT-CATTGACCTGCTTTCTTTA---T O_garnettii300684 --------------------ACATTT-CGTTGACCTGCTTTCTTT---AT O_garnettii300718 ----------------GATCACATTA-TGACAGAATAGGAAAACAAAAAA O_garnettii300732 ----------------------------------------CAGCAAGAAA P_troglodytes300719 ----------------GTGCACATTT-CATTGACCTGCTTTCTTTT---- P_pygmaeus300669 ----------------GTGCACATTT-CATTGACCTGCTTTCTTTTGTTT R_norvegicus300029 ------------------------AT-TTAAAA--CAAT----CTAGACT R_norvegicus300048 ----------------------AATC-ACAATAACTTAAGAAGTAAAGTG R_norvegicus300097 ------------------------------------------TAGTAATA R_norvegicus300120 -------------------------------------------------- R_norvegicus300193 ---------------------TTGGT-CATT-ACCTGCTTT--TTTGAAT R_norvegicus300255 -------GAGCATACATAAATGACTT-TTAAGAACCAATGAGGTTTGACT R_norvegicus300345 -----------------------------------------ATGGAGATG R_norvegicus300425 ----------------CTGCACATTT-CATTGACCTGCTTTCCTTTGACT R_norvegicus300848 ----------------CTGCACATT--CATTGACCTGCTTTCCTTTGACT R_norvegicus300903 ----------------TTGCACATCT-TATTGACCTGCTTTCTTTGGAAT R_norvegicus300980 ----------------CTGCACATTT-CATTGACCTGCTTTCCTTTGACT R_norvegicus301105 ----------------CTGCACATTT-CATTGACCTGCTTTCTTTTGAAT S_araneus300616 ----------------GTGCACATTT-CATTGACCTGTTTTGTAACGTTC S_araneus300997 ----------------GTGCACATTT-CATTGACCTGCTTTCTAATGTTC S_araneus301065 ----------------GTGCATAATTGCACGGACCTGCTTTCCAGTGTTC S_tridecemlineatus300270 ----------------ATGCACATTT-CATTGACCTGCTTTCCTTTGTAT T_nigroviridis300089 ----------------GGGCACAGTT-CATTGTCCGGCTC-CGCTGTCCG T_belangeri300343 ---------------GTGCACATTTC-ATTGACCTGCTTCCTATTGTATA X_tropicalis300129 ----------------CTGCACATTT-CATTGACACACTC-CTAGAATTG C_familiaris300070 TA--AGCA---GTGCTA--TTTCTAATG-TGCTA--CAAAGGGTTGAAGG C_familiaris300338 AT--GTGAGCAGTGTTA--TTTCTTATG-TGCAGGAGAAATAGTTAAAGG C_familiaris300354 AT--GTGAGCAGTGTTA--TTTCTTACG-TGCTATACAAATAGTTGAAGG C_porcellus300965 AT--GTGAGCAGTGTTA--TTTCTTATG-TGCAGGAGAAATAGTTAAAGG C_porcellus301039 AT--GTGAGCAGTGTTA--TTTCTTATG-TGCTATACAAATATTTGAAGG D_rerio300227 TA--A-GAACTGAGATA--TTTCTTATG-TGCTAGAT-AAACTCTGGAGG D_novemcinctus300068 GT--GTGAGCAGTGTTA--TTTCTTATG-TACTATTCAAATAGTTGAAGG D_novemcinctus300562 GT--GTAAGCAGTGTTA--TTTCTTCTG-TGCTATACAAATAGT-GAAGG D_melanogaster300174 GCCAATCGAGGCTCTGA--TGCTCAGTG--AATGTGCGCATAGC-AAAGA E_telfairi300470 AT--GTGAGCAGTGTTA--TTTCTTATG-TGCGAATCGAGTAGCTGAAGG E_telfairi300812 AT--GTGAGCAGTGTTA--TTTCTTATG-TGCTAAACAAGTAGCTGAAGG E_telfairi300868 AT--GTGAGCAGCGTTA--TTTCTTATG-TGCTAAACAAGTAGTTGAAGG E_caballus300355 AT--GTGAGCAGTGTTA--TTTCTTATG-TGCTATATAAACAGTTGAAGG E_europaeus300141 GT--GTGAGCAGTTTAT--TTCTTTATG-TGCTATATAAACAGATGAAGG E_europaeus300161 ------------TACCA--CATCTTATG-TGCTGTACAAATAGATGAAGG E_europaeus300263 GT--GTGAGCAGTGTTA--TTTCTTCTG-TGCTATACAAATAGATGAAGG E_europaeus300498 TT--AATAAACAGAAAC--CCTCTTATG-TGCTATACAAATAGCTCAAGG E_europaeus300516 GT--GTGAGCAGTCTTA--TTTT-TATG-TGCTATACAAACAGATGAAGG E_europaeus300607 GT--GTTAGCAGTGTTA--TTTCTGATG-TGCTATAGAAATAGCTGAAGG E_europaeus300670 GT--GGGGGCAGTGCTA--TTTCCTATG-TGCTGTACAAATCGATGAAGC E_europaeus300713 GT---TGAGCAGTGATA--TTGCTTATG-TGCTGTACAAATAGATGAAGG F_catus300044 AT--GCGAGCGGTGTTA--TTTCTTGTG-TGCTGTACGGATAGTTGAAGG F_catus300320 AT--GTGAGCAGTGTTA--TTTCTTATG-TGCTATACAAATAGTTGAAGG G_gallus300094 TG--ATGAGCAGTGTTA--TTTCTGGTG-TGCTAAAGAAATATTTGAAGG H_sapiens300474 AT--GTGAGTAGTGTTA--TTTCTTATG-TGCTATACAAATAATTGAAGG L_africana300050 AT--GTGAGCGGTGTTA--TTTGTTATG-TGCTATGCAAATTTTTTTTGT L_africana300062 AT--GTGAGCAGTATTA--TTTCTTCTG-TATTCTTCAAGGAGTTGAAGG L_africana300223 TT--GGAACCAACTCGA--CAGCACCTAATACAATACAAATAGTTGAAGG L_africana300378 AT--ATGAGCAGCCTTA--TTTCTTATG-TGCCATACAAATACTTGAAAG L_africana300460 TT--GTGAGCAGTGTTA--TTTCTTTTG-TGCTATACAAATAGTTGAAGG M_mulatta300137 AT--GTGAGCAGTGTTA--TTTCTTATG-TGCTATACAAATAATTGAAGG M_mulatta300138 AG--AGGAAAGATA-----TTTCTGATG-TGCTAAACAAACATTTGGAGG M_murinus300084 AT--GTGAGCAGTACTT--TTTCTGATG-TGTTATACAAATAGTTCAAGG M_domestica300013 AG--G-GATGAGTGTTAA-TTTTTGATG-TGCTATATAATTTATACATGG M_domestica300108 TG--T-GAGCAGTGTTA--TTTCTGATG-TGCTATATAATTTGTAGAAGG M_domestica300109 CG--A-AAGCAGTGTTA--TTTCTGACG-TGCTATACAATTTATAGAAGG O_anatinus304382 TG--GTGAGCAGTGTTA--TTTCTCATG-TGCAAAACAAATGATTGAAGG O_anatinus304383 GT--G-GAGCAGTGTTA--TTTCTGATG-TGCTATATAAACTGTTGAAGG O_anatinus304384 AG--AGGAAAAAAGCAG--TTTCTGTTG-TGCTAGATGAAC--TTGAAGG O_cuniculus300047 GT--GTGAACAGTGTTA--TTTCTT----CGTTATTCAAAGAGTTGAAGG O_cuniculus300335 GT--GTGAACAGTATTA--TTTCTTATG-TGCTATACAAAGAGTTGAAGG O_cuniculus300448 GT--GTGAGCAGTGTTA--TTTCTTATG-TGCTACACAAATAGTTGAAGG O_garnettii300007 AT--ACAAACAC---TA--TTTCTTATG-TGCCATACAAATAGTTGAAGG O_garnettii300014 ATAGGTGAGCGGTGTTA--TTTCTTATG-TGCTACACAAATAGGTGAAGG O_garnettii300049 AT--GTGAGCAGTGTTA--TTTCTCATG-TGCTATACAGATAGTTGAAGG O_garnettii300053 AT--GTGAGCAGTGTTA--TTCTTTATG-TGCTATACAAATAGTTGAAGG O_garnettii300073 AT--TCCTGATCT--------TCTTATG-TGCTATACAGATAGTTGAAGG O_garnettii300105 AC--TTGAAGTGA-------GTCTTATG-TGCTATACAGATAGTTGAAGG O_garnettii300127 -------------------------ATG-TGCTATACAAATAGTTGAAGG O_garnettii300142 TG--AGCA---GTGTTA--TTTCTTATG-TG-TATACAAATAGTTGAAGG O_garnettii300148 TT--TTTCTCCTCATTA--TTTCTTATG-TGCTGTACAAATAGTTGAAGG O_garnettii300163 GA--GCA-GTGTTA-----TTTCTCACG-TGCTATACAAATAGTTGAAGG O_garnettii300165 TG--GAGAAAGGTGTTA--TTTCTTATG-TGCTATACGAATAGTTGAAGA O_garnettii300202 TG--AGCA---GTGTTA--TTTCTTATA-TGCTATGCAAATAGTTGAAGA O_garnettii300213 AC--GTGAGCAGTGTTA--TTTCTTATG-TGCTATACAGACAGTTGAAGG O_garnettii300252 AT--GTGAGCAGTGTTA--TTTCTTATG-TGCTATACAGATAGTTGAAGG O_garnettii300264 AT--GTGAGCAGTGTTA--TTTCTTATG-TGCTATCCAAATAGCTGAAAG O_garnettii300321 AT--GTGAGCAGTGTTC--TTCT----G-TGCTATACAAATAGTTGAAGG O_garnettii300351 -A--AGC-----TGTTA--TTTCTTACA-GC-TATACAAATAGTTGAAGG O_garnettii300365 AA--TAAGAATTTA--A--TTTCCTATG-TGCTATACAAATAGTTGAAGG O_garnettii300373 AT--GTG-GTAGTGATTATTTTCTCACG-TGCTATACAAATAGTTGAAGG O_garnettii300376 AG--AAGTTTTTTGTTA--TTTCTTATG-TGCTATACGAATATGTGAAGG O_garnettii300382 AT--GTGAGCAATGTTT--TTTCTTATG-TGCTATACAAATAGTTGAAGG O_garnettii300408 TT--GTAATCCT---TA--TTTCTTATG-TGCTATACAAATAGTTGAAGG O_garnettii300414 AT--GTGAGCAGTGTTA--TTTCTTATG-TGCTATACAGATAGTTGAAGG O_garnettii300434 AC--CAAGAAGAG-------TTCTTATG-TGCTATACAGATAGTTGAAGG O_garnettii300452 AT--GTGAGCAGTGTTA--TTTATTACG-TGCTATACAAATAGCTGAAGG O_garnettii300461 TG--AGCA---GTGTTA--TTTCTTATG-TGCTATACAAATAGTTGAAGT O_garnettii300472 AT--GTGTGCAGTGTTA--TTTTTTATG-TGCT--ACAAATACTTGAAAG O_garnettii300507 AT--GTGAGCAGTGTTA--TTTCTCACG-TGCTATACAAATAGTTGAAGG O_garnettii300565 ------------------------------AAAAACCGAATAGTTGAAGG O_garnettii300590 TT--ACACAAAA---TA--TAACT--TG-TGCTATCCAAATAGTTGAAGG O_garnettii300674 AT--GTGAGCAGTGTTA--TTTCTCATG-TGCTATACAGATAGTTGAAGG O_garnettii300684 AT--GTGAGCAGTGTTA--TTTCTTAT-----TATACCAATAGTGGAAGG O_garnettii300718 AC--CCAAACCTTGTTA--TTTCTCATG-TGCTATACAGATAGTTGAAGG O_garnettii300732 AA--ATGA-CCTTGTTA--TTTCTCATG-TGCTATACAGATAGTTGAAGG P_troglodytes300719 AT--GTGAGTAGTGTTA--TTTCTTATG-TGCTATACAAATAATTGAAGG P_pygmaeus300669 AT--GTGAGTAGTGTTA--TTTCTTATG-TGCTATACAAATAATTGAAGG R_norvegicus300029 GT--GTGAGCAGTGTTA--TTTCTTATG-TGCTATACAAATAGTTGAAGG R_norvegicus300048 AT--GTGAGCATTGTAA--TTTCTTATG-TGCTATACAAATAGTGGAAGG R_norvegicus300097 AT--AATAATAATAATA--ATTCTTATG-TGCTATACAAATAGTTGAAGG R_norvegicus300120 ----AAGAAAATATCAT--CCCCTTATG-TGCTATACAAATAGTTGAAGG R_norvegicus300193 AT--GTGAGCAGTGTTA--TTTCTTATG-AGCTATACAAATAGTTGAAGA R_norvegicus300255 GT--GTGAGCAGTGTTA--TTTCTTATG-TGCTATACTAATAGTTGAAGG R_norvegicus300345 AT--TAAGATATATATA--TATCTTATG-TGCTATACTAATAGTTGAAGG R_norvegicus300425 GT--GTGAGCAGTGTTA--ATTCTTATG-TGCTATACTAATAGTTGAAGG R_norvegicus300848 GT--GGGAGCAGTGTTA--ATTCTTATG-TGCTATACTAATAGTTGAAGG R_norvegicus300903 AT--GTGAGCAGTGTTA--TTTCTTACG-TGCTATACACATAGTTGAAGG R_norvegicus300980 GT--GTGAGCAGTGTTA--ATTCTTATG-TGCTATACTAATAGTTGAAGG R_norvegicus301105 AT--GTGAGCAGTGTTA--TTTCTTATG-TGCTATACAAATAGTTGAAGG S_araneus300616 TC--GTGAGAAGTGTTA--GTACTCATG-TGCTGCATAAT-AGTTGAAG- S_araneus300997 TT--GTGAGCAGTGTTA--TTTCTCATG-TGCTACATTAT-AATTGAAGG S_araneus301065 TTTTGTGAGCAGTGTTA--TTTCTTGTG-TGCTACATAAA-AGTTGAAGA S_tridecemlineatus300270 AT--GTGAGCAGTGTTA--TTTCTTATG-TGCTACACAAATAGTTGAAGG T_nigroviridis300089 TC--G-GGGCTGCGATA--TTTCTGATG-TGCTAGA--ACGAGCTGGAGG T_belangeri300343 AT--GTAAGCAGTGTTA--TTTCTTATG-TGCTATACAGATTGTTGAAGG X_tropicalis300129 TG--ATGAGCCGTGTTA--TTTCTAATG-TGCTAAA---TCAATAGGAGG C_familiaris300070 GTA----ATTAG-CAGTATAACTA--A--ACAATC----AT-CTGCCAGT C_familiaris300338 TTA----ATTAG-CAGTATAACGAAAT----AGTA----ATACTGCCAGC C_familiaris300354 TTA----ATTAG-CAGTATAACTAAAT----GGTA----ATGCTGCCAGT C_porcellus300965 TTA----ATTAG-CAGTATAACGAAAT----AGTA----ATACTGCCAGC C_porcellus301039 TTA----ATTAG-CAGAATAACTATAA--ATAGTA----ATGCTGCCAGT D_rerio300227 TAA----ATTAG-CAGTTTGGCTTCATTGTGCCTC-----A-CTGCCAGT D_novemcinctus300068 GTA----ATTAG-CAGTATCA----CTAAATAGTA----ATGCTGCCAGT D_novemcinctus300562 TTA----ATTAG-CAGTATTAT-AACTAAATAATA----ATGCTGCCAGT D_melanogaster300174 AGATGTGCTTAGTTGGACTTGCTACATTCCATGCGT----GGCCACACGG E_telfairi300470 TCA----ATTAG-CAGTTTAACTAAAT--GTAGTA----ATGCTGTCGGT E_telfairi300812 TTA----ATTAG-CAGTTTAACTGAAC--GTAGTA----ATGCTGCCAGT E_telfairi300868 TTA----ATTAG-CAGTTTAACTAAACATGTAGTA----ATGCTGCCAGT E_caballus300355 TTA----ATTAG-CAGTATAACTAAATAGTC--------ATGCTGCCAGT E_europaeus300141 TTA----ATTAA-CAGTATAGCCAAGTAGT--------TATGTTACCAGT E_europaeus300161 TTA----ATTAA-CAGTGTAACTAAAT----AGTC----ATGCTGCCAGT E_europaeus300263 TTTA---ATTAG-CAGTGTAACTAAATAAT--------CATGCTGCTAGT E_europaeus300498 TTA----ATTAG-CAGTATAACTAAAC----AGTC----ATGCTGCCAGT E_europaeus300516 TTCGAACATTAG-CAGTATATCTAAATAGTTGTGCTTCCATGCTGCCAGT E_europaeus300607 TTA----ATTAG-CAGTGTAACTAAATAGT--------CGCGCTGCCAGT E_europaeus300670 TTC----ATTAA-GAGTCTAACTAAATAGT--------CATGCTGCTAGT E_europaeus300713 TTA----ATTAG-CAGTATAACTAGATAGA--------CATGCTGCCAGT F_catus300044 TTA----ATTAG-CAGTATAACTAAAT----AGTA----ATGCTGGCAGT F_catus300320 CTA----ATTAG-CAGTATAACTAAAT----AGTA----ATGCTGCCAGT G_gallus300094 CTA----ATTAG-CAGCTTAGCTGTACGTAGTTAC-----TGCTGCCAGT H_sapiens300474 CTA----ATTAG-CAGTATAACTATAA--ATAGTA----ATGCTGCCAGT L_africana300050 TTA----TGCAAATAGTTGAAGGTTAA---------------TTAGCAGT L_africana300062 TTA----GTTAG-CTGTATAACTA--A--GTAGCA----ATGCTGCCAGT L_africana300223 TTA----ATTAG-CAGTGTAACTA-AA--GTAGGA----ATGCTGCCAGT L_africana300378 TTA----ATTAG-CAGTATAAAT------------------------AGT L_africana300460 TTA----ATTAG-CAGTATAACT---A-AGTAGTA----ATGCTGCCAGT M_mulatta300137 CTA----ATTAG-CAGTATAACTATAA--AAAGTA----ATGCTGCCAGT M_mulatta300138 TTA----ATTAG-CAGCATGACTA-ATTTAGTCAT-----TGCTGCCAGT M_murinus300084 TAA----GTTAG-CAGTATAGCTATAA--AGAGTA----ATGTTGCCAGT M_domestica300013 TTA----ATTAG-CAGCAGAACTTGATATA---AT------GCTGCTAGT M_domestica300108 TTA----ATTAG-CAGCATAACTTGGAATATTAGTA---CTGCTGCCAGT M_domestica300109 TTA----ATTAG-CAGTATAACTTGGTATAGTAAT------GCTGCCAGT O_anatinus304382 TTA----ATTAG-CAACTTGGCTTGCTTTCAG-----CTCTGTTGCCAGT O_anatinus304383 TTA----ATTAG-CAGCACAACTCTATATAGTAAA-----TGCTGCCAGT O_anatinus304384 TAA----ATTAG-CGGCATGTCTA-ATGTAGCCAT-----TGGCGTCAGT O_cuniculus300047 TTA----ATTAG-CCGTGTAACT-TCA-AGTAGTA----ATGCTGCCAGT O_cuniculus300335 TTA----ATTAG-CAGAATA--------GGTAGTA----ATGCTGCCAGT O_cuniculus300448 TTA----ATTAG-CAGTATAACTATCA-AGTAGTA----ATGCTGCCAGT O_garnettii300007 TTA----ATTAA-CAGTGTAACTATAA--ATAGTA----ATGCCGCCAGT O_garnettii300014 TTA----ATTAG-CAGTATAACTATCA--ACAGTA----ATGCTGCCCGT O_garnettii300049 TTA----ATTAG-CAGTATAACTATAA--ATAGTA----ATGCTGCCAGT O_garnettii300053 TTA----ATTAG-CAGTATAATTA--------GTA----ATGCTGCCAGT O_garnettii300073 TTA----ATTAG-CAGTATAACTATAA--ATAGTA----ATGCTGCCAGT O_garnettii300105 TTA----ATTAG-CAGTATAACTATAA--ATAGTA----ATGCTGCCAGT O_garnettii300127 TTA----ATTAT-CAGTGTAACTATAA--ATAGTA----ATGCGACCAGT O_garnettii300142 TTA----ATTCA-CAGTATAACTATAA--ATAGTA----ATGCTGCCAGT O_garnettii300148 TTA----ATTAG-TGGTATAATTATA------GTA----ATGCTGACAGT O_garnettii300163 TTA----ATTAG-CAGTATCACTATAA--ATAGTA----ATGCTGCCAGT O_garnettii300165 TTA----ATTAG-CAGTATAACTATAA--ATAGTA----ATGCTGCCAGT O_garnettii300202 TTA----ATTAG-CAGTATAACTATAA--GTAATA----ATGCTACTAGT O_garnettii300213 TTA----ATTAG-CAGTATAACTATAA--ATAGTA----ATGCTGCCAGT O_garnettii300252 TTA----ATTGG-CAATGTAACTATAA--ATAGTA----ATGCTGCCAGT O_garnettii300264 TTA----ATTAGGCAGTATAACTATAA--ATAGTA----ATGCTGCCAGT O_garnettii300321 TTA----ATTAG-CAGTATCACTATAA--ATAGTA----ATGCTGCCAGT O_garnettii300351 TTA----ATTAG-CAGTATAACTATAA--ATAGTA----ATGCTGCCAGT O_garnettii300365 TTA----ATTAG-CAGTATGACTATAA--ATAATA----ATGTTGCCAGT O_garnettii300373 TTA----ATTAG-CAGTATCACTATAA--ATAGTA----ATGCTGCCAGT O_garnettii300376 TTA----ATTAG-CAGTATAACTATAA--ATAATA----ATGCTGCCAGT O_garnettii300382 TTA----ATTGG-CAATGTAACTATAA--ATAGTA----ATGCTGCCAGT O_garnettii300408 TTA----ATTAC-CAGTATAACTATAA--ATAGTA----ATGTTGCCAGT O_garnettii300414 TTA----ATTAG-CAGTATAACTATAA--ATAGTA----ATGCTGCCAGT O_garnettii300434 TTA----ATTAG-CAGTATAACTATAA--ATAGTA----ATGCCGCCAGT O_garnettii300452 TTG----ATTAG-CAGTCTAACCATAA--ATAGTC----ATGCTGACAGT O_garnettii300461 TTA----ATTAG-CAGTATAACTATAA--ATAGTA----ATGCTGCCAGT O_garnettii300472 TTA----CTTAG-CAGTATAACCATAA--ATAATA----ATGCTGCCAGT O_garnettii300507 TTA----ATTAG-CAGTATCACTATAA--ATAGTA----ATGCTGCCAGT O_garnettii300565 TAA----ATTAG-CAATATAACTACAA--ATAGTA----ATGCTGCCAGC O_garnettii300590 TTA----ATTCA-CAGTATAACTATAA--ATAGTA----ATGCTGCCATT O_garnettii300674 TTA----ATTAG-CAGTATAACTATAA--ATAGTA----ATGCTGCCAGT O_garnettii300684 TTA----ATTAG-CAGTATAAGTATAC--ATAGTA----AGGCTGCCAGT O_garnettii300718 TTA----ATTAG-CAGTATAACTATAAG-ATAGTA----ATGCTGCCAGT O_garnettii300732 TTA----ATTAG-CAGTATAACTATAA--ATAGTA----ATGCTGCCAGT P_troglodytes300719 CTA----ATTAG-CAGTATAACTATAA--ATAGTA----ATGCTGCCAGT P_pygmaeus300669 CTA----ATTAG-CAGTATAACTATAA--ATAGTA----ATGCTGCCAGT R_norvegicus300029 TTC----ATTAG-CAAAGTAACTACAT--ATAGTA----ATTCTGCCAGT R_norvegicus300048 TTA----ATTAG-CAGAGTAACTGCAT--ATAGTA----ATTCTGCCAGT R_norvegicus300097 TTA----ATTAG-CAGAGTAACTTCAT--ATAGTA----ATTCTGCCAGT R_norvegicus300120 TTA----ATTAG-CAGAGTAACTGCAT--ATAGTA----ATTCTGCCAGT R_norvegicus300193 TTA----ATTAG-CAAAGTAACTTCAT--ATAGTA----ATTCTGCCAGT R_norvegicus300255 TTC----ATTAG-CAGAGTAACTGCAT--ATAGTA----ATTCTGCCAGT R_norvegicus300345 TTC----ATTAG-CAGAGTAACTGCAT--ATAGCA----ATTCTGCCAGT R_norvegicus300425 TTC----ATTAG-CAGAGTAACTGCAT--ATAGTA----ATTCTGCCAGT R_norvegicus300848 TTC----ATTAG-CAGAGTAACTGCAT--ATAGTA----ATTCTGCCAGT R_norvegicus300903 TTA----ATTAG-CAGAGTAACTGCAT--ATAGTA----ATTCTGCCAGT R_norvegicus300980 TTC----ATTAG-CAGAGTAACTGCAT--ACAGTA----ATTCTGCCAGT R_norvegicus301105 TTA----ATTAG-CAGAGTAACTGCAT--ATAGTA----ATTCTGCCAGT S_araneus300616 CTA----ATTAG-CAGTATGATTAAATAGTA--------ATACTGCCAGT S_araneus300997 CTA----ATTAG-CAGTATGACTAAATAGTA--------ATACTGCCAGT S_araneus301065 CTA----ATTAG-CAGTATAACTAA-TAGTA--------ATGCCGCCAGT S_tridecemlineatus300270 TTA----ATTAG-CAGAATAACTATAA--ATAGTA----ATGCTGCCAGT T_nigroviridis300089 TTA----ATTAG-CAGAGCGGCTGCTGGGTGCCTC-----GTCTGCCAGT T_belangeri300343 TTA----ATTAG-CAGTATAACTATAA--ATAGTA----ATGCTGCCAGT X_tropicalis300129 CTA----ATTAG-CAGTGTAACGGAATTGTTACCA-------CTGCCAGT C_familiaris300070 CTCCTT-CAGACAAAC- C_familiaris300338 CCCCTT-CAAACAGAA- C_familiaris300354 CTCCTT-CAGACACAT- C_porcellus300965 CCCCTT-CAAACAGAA- C_porcellus301039 CTCCTT-CAGACAGAA- D_rerio300227 CCCCTT-CATACAATA- D_novemcinctus300068 CGTCTT-CAAACAAAA- D_novemcinctus300562 CTTCTT-CAAACAAAA- D_melanogaster300174 TACAATTTCGACAGCG- E_telfairi300470 CTCATT-CATACAAAA- E_telfairi300812 CTCCTT-CACACAAAA- E_telfairi300868 CTCCTT-CATACAAAA- E_caballus300355 CTCCTT-CAGACAGTT- E_europaeus300141 CTCTTT-CAGACAGTT- E_europaeus300161 CTCCTT-TGAACAGTT- E_europaeus300263 GTCCTT-CAGACAGTT- E_europaeus300498 CTCCTT-CACACAGTT- E_europaeus300516 CTCCTT-CAGATAGTT- E_europaeus300607 CTCCTT-CAGACAGTT- E_europaeus300670 CT-----CAGATAGTT- E_europaeus300713 CTCCTT-CACACGGGT- F_catus300044 CTCCTT-CAGACAAAT- F_catus300320 CTCCTT-CAGACAAAT- G_gallus300094 CTCCTT-CATACAAAG- H_sapiens300474 CTCCTT-CAGACAAAA- L_africana300050 ATAA---AAAACAAAA- L_africana300062 CTCCTT-CAAAGAAAA- L_africana300223 CTCCTT-TAAAAAAAA- L_africana300378 ATCCTT-CAAACAAAC- L_africana300460 CTCCTT-CAGACAAAC- M_mulatta300137 CTCCTT-CAGACAAAA- M_mulatta300138 CACCTT-CAAACAAGT- M_murinus300084 CTCCTT-CGTATAAAA- M_domestica300013 -TCTTT-CAAACAAAC- M_domestica300108 CCCCTT-CAAACAAAT- M_domestica300109 CTCCTT-CAAACACAC- O_anatinus304382 CTCCTT-CAGACATTA- O_anatinus304383 CCCCTT-CAGACAGAT- O_anatinus304384 CCCCTT-CATACAATT- O_cuniculus300047 CTCCTT-CACACACAC- O_cuniculus300335 CTCTTT-AAGACAGAC- O_cuniculus300448 CTCCTT-CAGACACAA- O_garnettii300007 CTCCTT-CAGACAAAA- O_garnettii300014 CTCCTT-CAGACCAGT- O_garnettii300049 CTCCTT-CAGACAAGA- O_garnettii300053 CTCCTT-CAGACAAGA- O_garnettii300073 CTCCTT-CAGACAAGA- O_garnettii300105 CTCCTT-CAGACAAGA- O_garnettii300127 CTCCTT-CAGATAAGA- O_garnettii300142 CTCCTT-CAGACAAGG- O_garnettii300148 CTCCTT-T-GACAAGAA O_garnettii300163 CTCCTT-CAGACAAGA- O_garnettii300165 CTCCTT-CAGACAAGA- O_garnettii300202 CTCCTT-CAGACAAGA- O_garnettii300213 CTCCTT-CAGACAAGA- O_garnettii300252 CTCCTT-CAGACAAGA- O_garnettii300264 CTCCTT-CAGACAAGA- O_garnettii300321 CTCCTT-CAGATAAGA- O_garnettii300351 CTTTTT-CAGACAAGA- O_garnettii300365 CTCTTT-TAGACAAGA- O_garnettii300373 CTCCTT-CAGACAAGA- O_garnettii300376 CTCCTT-CAGACAAGA- O_garnettii300382 CTCCTT-CAGACAAAA- O_garnettii300408 CTCCTT-CAGACAAAA- O_garnettii300414 CTCCTT-CAGACAAGA- O_garnettii300434 CTCCTT-CAGACAAGA- O_garnettii300452 CTCCTT-CAGACAAAA- O_garnettii300461 CTCCTT-CAGACAAAA- O_garnettii300472 CTCCTT-CAGACAAAA- O_garnettii300507 CTCCTT-CAGACAAGA- O_garnettii300565 CTCCTT-CAGGAAAAA- O_garnettii300590 TTCTCT-CAGACAAAA- O_garnettii300674 CTCCTT-CAGACAAGA- O_garnettii300684 TTCCTT-CAGACAAAG- O_garnettii300718 CTCCTT-CAGACAAGA- O_garnettii300732 CTCCTT-CAGACAAGA- P_troglodytes300719 CTCCTT-CAGACAAAA- P_pygmaeus300669 CTCCTT-CAGACAAAA- R_norvegicus300029 CCCCTT-CAGACAAAA- R_norvegicus300048 CCCCTT-CAGACAAAA- R_norvegicus300097 CTCCTT-CAGACAATA- R_norvegicus300120 TCCCTT-CAGACAAAA- R_norvegicus300193 CTCCTT-CAGACAAAA- R_norvegicus300255 CCCCTT-CAGACAAAA- R_norvegicus300345 ACCCTT-CAGACAAAA- R_norvegicus300425 CCCCTT-CAGACAAAA- R_norvegicus300848 CCCCTT-CAGACAAAA- R_norvegicus300903 CCCCTT-CAGACAAAA- R_norvegicus300980 CCCCTT-CAGACAAAA- R_norvegicus301105 CCCCTT-CAGACAAAA- S_araneus300616 CTCCTT-CAGACAGCT- S_araneus300997 CTCCTT-CAGACAGTT- S_araneus301065 CTCCTT-CAGACAGCT- S_tridecemlineatus300270 CTCCTTTCAGACAAAA- T_nigroviridis300089 CCCCTT-CACACACTG- T_belangeri300343 CTCCTT-CAGACATAA- X_tropicalis300129 CCCCTT-CTCACAGCC-

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved