snOPY snoRNA Orthological Gene Database

Family: SNORA18

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300028 -------------------------CTGGAAGTACATCCC--AATGGGTT C_familiaris300047 -------------------------GTTGAGGTCTATCCC--AATTGGCT C_familiaris300061 -------------------------GTTGAGGTCTATCCC--AATTGGCT C_familiaris300160 ------------------------TAAAAGTTCCCTCTACCCAGTGGGGC C_familiaris300282 -------------------------GTTGAGGTCTATCCC--AATTGGCT C_familiaris300287 -------------------------GTTGAGGTATATCCT--AATGGGGC C_familiaris300465 -------------------------TTTGAGGTCTATCCC--GATGGGGC C_porcellus300012 -------------------------GGTGAGGTCTAGCAT--GATAGGA- C_porcellus300085 -------------------------CTTGAGGTCAATCTC--GATGGAGC C_porcellus300757 -------------------------CTTGAGGTCTATCCC--GATGGAGC D_rerio300213 -------------------------TCTGAGGTCTATCCC--GACTGGCC D_novemcinctus300340 -------------------------GCTGAGGTCTATTCC--AATGGG-C D_novemcinctus300350 -------------------------GCTGAGGTCTATCCC--GATGGG-G D_novemcinctus300392 -------------------------GCTTAAGTCTATCTC--TATGTG-C D_novemcinctus300397 -------------------------GCTGAGGTCTATCCC--GATGGG-G E_telfairi300040 -------------------------AATGAGGTCTGTCTC--GATGGGGC E_telfairi300056 -------------------------GTTGAGGTCTATTCC--AATGGGGC E_telfairi300067 -------------------------GTTGAGGTCTATCCC--GATGGGGC E_telfairi300133 ---------------------------CATTATACGTCCC--AATGGGGC E_telfairi300173 -------------------------GTTGAGGTCTGTCCC--GATGGGGC E_telfairi300237 -------------------------CTGGAGGTCTATCCC--GATGGGGC E_telfairi300242 -------------------------GTTGAGGTCTATCCC--GATGGGGC E_telfairi300382 -------------------------GTTGAAATCTATCCT--AATGGGGC E_telfairi300420 --------------------------------------AAAGAGCGTTGC E_telfairi300463 -------------------------GTTGAGGTCTACCCC--GATGGGGC E_telfairi300482 -------------------------GTTGAGGTCTACCCC--GATGGGGC E_telfairi300514 -------------------------GTTGAGGTCTATCAG--GATGA--C E_telfairi300731 -------------------------GTTGGGGTCTATCCC--AATGAGGC E_telfairi300736 ------------------------------------------GTTGAGGC E_caballus300009 -------------------------ATTGAGGTCTATCCA---ATGGGGC E_caballus300014 -------------------------ATTGAGGTCTATCCA---ATGGGGC E_caballus300015 -------------------------ATTGAGGTCTATCCA---ATGGGGC E_caballus300018 -------------------------ATTAAGGTCTATCCA---ATGGGGC E_caballus300046 -------------------------ATTGAGGTCTATCCA---ATGGGGC E_caballus300061 -------------------------GTTGAGGTCTACCCA---ATGGGGC E_caballus300065 -------------------------ATTGAGGTCTATCCA---ATGGGGC E_caballus300071 -------------------------ATTGAGGTCTATCCA---ATGGGGC E_caballus300072 -------------------------ATTGAGGTCTATCCA---ATGGGGC E_caballus300074 -------------------------ATTGAGGTCTATCCA---ATGGGGC E_caballus300116 -------------------------GTTGAGGTCTATCCC--CATGGAGC E_caballus300137 -------------------------ATTGAGCTCTATCCA---ATGGGGC E_caballus300147 -------------------------GTTGAGGTCTATCCC--GATGGGGC E_caballus300153 -------------------------GTTGAGGTCTATCCC--AGTGGGGT E_caballus300188 -------------------------ATTGAGGTCTATCCA---ATGGGGC E_caballus300196 -------------------------ATTGAGCTCTATCCA---ATGGGGC E_caballus300237 -------------------------GTTGAGGTCTATCCG--GATGGGGC E_europaeus300110 -------------------------ATTGAGGTCTATCCC--GATGGGGC E_europaeus300604 -------------------------GTTGAGGTCTATCCC--AATGGGGC F_catus300089 -------------------------GTTGAGGTCTATCCC--GATGGGGC F_catus300170 -------------------------GTTGAGGTCTGTCCT--GATGGGGC F_catus300183 ------------------------CTTGAAGTCATGACCTGAGCCCAAAT F_catus300187 -------------------------GTCAAGGTCAATCCC--GATGGGGC G_gallus300033 -------------------------GTTGAGGTCTATCCC--GATAGGAT G_aculeatus300087 -------------------------GCTGAGGTCTATCCC--GACGGGCC G_aculeatus300089 -------------------------GCTGAGGTCTATCCC--GACGGGCC G_gorilla300684 -------------------------TTTGAGGTCTT-TCCC-GACGGGAC G_gorilla301063 -------------------------GTTGAGGTCTA-TCCC-GATGGGGC G_gorilla300205 -------------------------GTTGAGGTCTA-TCCC-GATAGGTC G_gorilla300272 -------------------------GTGGAGGTCTA-TTCC-AATGGGGC G_gorilla300273 -------------------------GAGGAGGTCCATTTTAAAAAA---- G_gorilla300551 -------------------------GAGGAGGTCCATTTTAAAAAA---- H_sapiens300751 -------------------------GTTGAGGTCTA-TCCC-GATGGGGC M_mulatta300176 -------------------------AAAAAAAAAAAACCC--GATGGGGC M_mulatta300191 -------------------------GTCGAAGTCTA-TTCC-AATGGGGC M_mulatta300203 -------------------------TTTGAGGTCTA-TCCC-GATGGGAC M_mulatta300269 -------------------------GTTGAGGTCTATCCC--GATGGGGC M_mulatta300429 -------------------------GGGGAGGTTCATTTTAAAAAATAAT M_mulatta300435 -------------------------GTTGAGGTCTAACAT--GATAGGGA M_mulatta300454 -------------------------GTTGAGGTCTAATCCT-GATAGGGC M_mulatta300478 -------------------------GTTGAGGTCTG-TCCC-AATGGGGC M_mulatta300664 -------------------------GTTGAGGTCTA-TCCC-GATGGGGC M_mulatta300443 -------------------------GGAAAGGTTACTAAAAGAACACTGC M_murinus300248 -------------------------GTTGAGGTCTATCCC--GGTGGGGC M_murinus300261 -------------------------GTTGAGGTCTATGCT--AATGGGGC M_murinus300304 -------------------------GTTGAGGTCTGTCCG--GGTGGGGC M_murinus300329 -------------------------GTTGAGGTCTATTTT--GTTGAAGC M_murinus300336 -------------------------TATCAGGTTACTCATGTCAAAAAGG M_murinus300340 -------------------------TATCAGGTTACTCATGTCAAAAAGG M_murinus300348 -------------------------GTTGAGGTCTATCCC--ACTGGGGC M_murinus300368 -------------------------ATTGAGGTCTATCTT--GGTGGGGC M_murinus300478 -----------AGTGAGCATCCTTACTTGTATATATTTTTT-TAAAAAAA M_murinus300042 -------------------------GTTGAAGTCTACCCC--AGTGGGGC M_murinus300060 --------------------------------------GTATAAGAAAAA M_murinus300108 -------------------------GTTGAGGTCTATCCC--GGTTGGGC M_murinus300126 -------------------------GTTGAGGTCTATGCT--GATGGGGC M_murinus300154 -------------------------GTTGAGGTCTGTCCG--GGTGGGGC M_murinus300195 -------------------------GTTGAGGTCTATCCC--GGTGGGGC M_musculus300096 -------------------------TTTGAGGTCTATCCC--GACGGGGC M_musculus300958 -------------------------GTTGAGGTCTATCCC--A---GGGC M_lucifugus300560 -------------------------ATTGAGGTCTATCCC--GATGGGTC M_lucifugus300877 -------------------TGTGGGTTAGATAAAGAGTATAGAATCTTTT M_lucifugus300878 CATGAAGACCATTATCCATATTGCAGCAGCAGAACAATTTTTTCTCAAAA M_lucifugus300130 -------------------------ATTGAGGTCTATCCC--GATGGGTC M_lucifugus300201 -------------------------ATTGAGGCCTATCCC--AATGGGTC M_lucifugus300244 -------------------------ATTGAGGTCTATCCC--GATGGGTC M_lucifugus300440 -------------------------GTTGAGGTCTATCCC--AATGGGTC O_anatinus304403 -------------------------TTTGAGGTCTATCCC--GATGGGAC O_cuniculus300035 -------------------------GTTGAGGTCTATCCC--GATAGGGC O_cuniculus300218 -------------------------GCCTAGGTCTATGCC--AACAGGGC O_cuniculus300268 -------------------------GTTGAGTCTTTCTCC--A-TGAGGT O_cuniculus300317 -----------------------GTAACCAGCTGACCTCA---GTGGG-C O_cuniculus300399 -------------------------GTTGAGGTCTATCCC--GATGGGGC O_garnettii300012 --------------AAGGATATCACATTCTATTTTTTCTTCCTGAAAACA O_garnettii300157 -------------------------GTTGGAGTCTATCCC--AGTGGGGA O_garnettii300326 ---------------------------------CTTTCTTAATATTTAAT O_garnettii300329 --------------------------------------------AAAGAA O_garnettii300390 -------------------------GTTGAGGTCTATCCC--GATGGGGC O_garnettii300483 -------------------------TTTGAGGTCTACTCT--GATGGAGC P_troglodytes300051 -------------------------GAGGAGGTCCATTTTAAAAAA---- P_troglodytes300224 -------------------------ATTGAGGTCTA-TCCC-GATAGGTC P_troglodytes300313 -------------------------------------------------- P_troglodytes300347 -------------------------TTTGAGGTCTT-TCCC-GATGGGAC P_troglodytes300372 -------------------------GGAAAGGTTACTAAAAGAACACTGC P_troglodytes300384 -------------------------GTGGAGGTCTA-TTCC-AATGGGGC P_troglodytes300674 -------------------------GTTGAGGTCTA-TCCC-GATGGGGC P_troglodytes300225 -------------------------ATTGAGGTCTAACAC--GATAGGGC P_pygmaeus300412 -------------------------GTTGAGGTCTAACAC--GATAGGGC P_pygmaeus300543 -------------------------------------------------- P_pygmaeus300064 -------------------------GAGGAGGTCCATTTTAAAAAAGAAT P_pygmaeus300146 -------------------------GGAAAGGTTACTAAAAGAACACTGC P_pygmaeus300249 -------------------------GTGGAGGTCTA-TTCC-AATGGGGC P_pygmaeus300299 -------------------------GTTGAGGTCTA-TCCC-GATGGGGC P_pygmaeus300365 -------------------------------------------------- P_pygmaeus300377 -------------------------TTTGAGGTCTT-TCCC-GATGGGAC R_norvegicus300913 -------------------------GTTGAGCTCTATCCC--A---GGGC R_norvegicus300317 -------------------------TTTGAGGTCTATCCC--GATGGGGC R_norvegicus300858 -------------------------TTTGAGGTCTATCCC--GATGGGGC R_norvegicus300072 -------------------------GTTAATGTGTATGGT--GATGGGCC R_norvegicus301009 -------------------------TTTGAGGTCTATCCC--GATGGGGC S_araneus300455 -------------------------CAGGAGGGTAAAGTAAGACAA---- S_araneus300729 ----------------------------------------CCAG-AGGAA S_araneus300097 -------------------------GTTGAGGTCTATCCC--GATGGGGC S_tridecemlineatus300206 -------------------------GTGGAGGTCCATCCT--GATAGGGC S_tridecemlineatus300176 -------------------------ATCGAGTTGAAGTCT---GT----C T_belangeri300005 -------------------------AGTGAGATCTATTCT--GATGGGGC T_belangeri300031 -------------------------GTTGAGGTCTGTCCT--GATAGGGC T_belangeri300183 -------------------------GTTGAGGTCTATCCC--GATGTGGC T_belangeri300201 -------------------------GTTGAGGTCTATCCC--AATGTGGC T_belangeri300225 -------------------------GTTGAGGTGTGTGTCCTAATGGGGC C_familiaris300028 TTTTT---CTATAGACCC-ACATTATTGGGAA-------TGCCTCATAGA C_familiaris300047 TTTT----CTGCAGACCT-ACATTACTGGAGA-------TGCATCATCAA C_familiaris300061 TTTT----CTGCAGACCT-ACATTACTGGGGA-------TGCATCATCAA C_familiaris300160 TTTTT---CTATAGACCT-ACATCGCGGGAAA-------TGCCTTCTAGA C_familiaris300282 TTTT----CTGCAGACCT-ACATTACTGGAGA-------TGCATCATCAA C_familiaris300287 TTTTTT-TTTGTAGACCA-ACGTGGTTGGAAA-------TGCCTCATTGA C_familiaris300465 TTTTT---CTGTAGACCT-ACATCGTTGGAAA-------CGCCTCATAGA C_porcellus300012 ----G---CTGTAGCTGT-ACAATGTTGGAAA-------TGCCTCATAAA C_porcellus300085 TT------CTGTAGT----ACGTCGCTGGAAA-------CACCTCGTAGA C_porcellus300757 TT------CTGTAGCTAC-ACATCGCTGGAAA-------CGCCTCATAGA D_rerio300213 CCTCT---CAGTAGGGCT-TAGTCGTTGGAAA-------TGCCTCAAAGA D_novemcinctus300340 TCTCT---CTGTAGACCC-ACATTCTTGGAAA-------TGCCTCACAGA D_novemcinctus300350 TCTCC-----GTAGACCC-ACATCATTGAAAA-------CGCCTCACAGA D_novemcinctus300392 TCTCT---CTGTAGAACC-ACATCGTTGGAAA-------CGCCTCACAGA D_novemcinctus300397 TCTCT-----GTAGACCC-ACATCGTTGGAAA-------CGCCTCACAGA E_telfairi300040 TTTGT---CTGCAGACCC-ACACCCTTGGAAA-------CGCCTCATGGA E_telfairi300056 TTTCT---TTGT-GACCC--CATCATTGGAAA-------TAC--CATAGA E_telfairi300067 CTTGT---CTGTAGACCC-ACATCATTGGAAA-------TGCCTCACAGA E_telfairi300133 TTTGT---CTGGAGACCC-ACATCGTTGGGAA-------AACCTCATACA E_telfairi300173 TTTCT---CTGTATACCC-ACATCGTGGGAAA-------CGCCTCATAGA E_telfairi300237 CTTGT---CTGTAGACCC-ACATCGTTGGAAA-------CGCCTCACAGA E_telfairi300242 CTTGT---CTGTAGACCC-ACATCGTTGGAAA-------CGCCTCACAGA E_telfairi300382 TTTCT---CTATAGACCC-ACATTGTTG-AAA-------CGTCTCATAGA E_telfairi300420 TTTGT---CTGTAGCCC-CACATCGTTAGAAA-------CGCCTCATAGA E_telfairi300463 TTTTT---CTGTAGACCC-ATATCGTTGGAAA-------CACCTCATAGA E_telfairi300482 CTTGT---CTGTAGACCC-ACATTGTTGGAAA-------CACCTCACAGA E_telfairi300514 TTTGT---CTGTTGACCC-TCATCATTTGAAA-------TGCCTCATAGA E_telfairi300731 CTTGT---CTGTAGACCC-AAATCGTTGGAAA-------CGCCTCACAGA E_telfairi300736 TCTGT---CTGTAGACCC-ACATCTTTGGAAA-------TGCCTCATAGA E_caballus300009 TTTTT---CTGTAGACTC-ACATTATTGGAAA-------TGTCTCGTCAA E_caballus300014 TTTTT---CTGTAGACTC-ACATTATTGGAAA-------TGTCTCATCAA E_caballus300015 TTTTT---CCGTAGACTC-ACATTATTGGAAA-------TGCCTTGTCAA E_caballus300018 TTTTT---CTGTAGACTC-ACATTATTGGAAA-------TGCCTTGTCAA E_caballus300046 TTTTT---CTGTAGACTC-ACATTATTGGAAA-------TGTCTCGTCAA E_caballus300061 TTTTT---CTGTAGACTG-ACATCATTGGAAA-------TGCCTTGCTGA E_caballus300065 TTTTT---CTGTAGACTC-ACATTATTGGAAA-------TGCCTTGTCAA E_caballus300071 TTTTT---CTGTAGACTC-ACATTATTGGAAA-------TGGCTTGTCAA E_caballus300072 TTTTT---CTGTAGACTC-ACATTATTGTAAA-------TGTCTCGTCAA E_caballus300074 TTTTT---CTGTAGACTC-ACACTATTGGAAA-------TGGCTTGTTAA E_caballus300116 TTTTC---CTGTAGACTC-ACATTGTTGGAAA-------TGCCTCACAGA E_caballus300137 TTTTT---ATGTAGACTC-ACATTATTGGAAA-------TGCCTTGTCAA E_caballus300147 TTTTT---CTGTAGACCC-ACATCGTTGGAAA-------CGCCTCATAGA E_caballus300153 GTTTT---CTGTAGACCT-ACATTGTTGGAAA-------TGCCTCATAGA E_caballus300188 TTTTT---CCATAGACTC-ACATTATTGGAAA-------TGCCTTGTCAA E_caballus300196 TTTTT---ATGTAGACTC-ACATTATTGGAAA-------TGCCTTGTCAA E_caballus300237 TTTTT---CTGTAGACCT-ACATTGTTGGAAA-------CGCCTCACAGA E_europaeus300110 TCT-G---CTGTGAACCC-TTGTCGTTGGAAA-------CGCCTCATAGA E_europaeus300604 TCT-G---CTGTGGACTC-TTGTCTTTGGAAA-------TGCCTC--AGT F_catus300089 TTTTT---CTGTAGACCT-ACATCGTTGGAAA-------CGCCTCATAGA F_catus300170 TTTTTTCTCTGCAGACCT-ACATTGTTGGAAA-------CACCTCATGGA F_catus300183 --------CAGAGTCGGACACTCCATTGGAAA-------CACCTCATAGA F_catus300187 TTTTT---CTGTAGACCT-GCATCGTTGGGAA-------CACCTCAGAGA G_gallus300033 CTCTT---CTGTAGGTTC-ATGTCGTTGGAAA-------CGCCTCACAGA G_aculeatus300087 TTTCA---CTGTAGGGCC-GTGTCGTTGGAAA-------TGCCTCACACC G_aculeatus300089 TTTCA---CTGTAGGGCC-ATGTCGTTGGAAA-------TACCTCACACA G_gorilla300684 TTTTC----TGTAGGCTGCACATCATTGGAAA-------CGCCTCATAGA G_gorilla301063 TTTTC---TTGTAGCCTGCACATCGTTGGAAA-------CGCCTCATAGA G_gorilla300205 TTTTC---CTGTAGCCTGCACGTTGTTGGAAA-------TGCCTCATAGA G_gorilla300272 TTTTC---CTGTAGC-TGCATGTTGTTGGAAA-------TTCCTCATAGA G_gorilla300273 ------------------GAATAGATTGGAAA-------TGCCTCATAGA G_gorilla300551 ------------------GAATAGATTGGAAA-------TGCCTCATAGA H_sapiens300751 TTTTC---CTGTAGCCTGCACATCGTTGGAAA-------CGCCTCATAGA M_mulatta300176 TTTTC---CTGTAGCTTGCACGTCGTTGGAAA-------CGCCTCATAGA M_mulatta300191 TTTTC---CTGTAGC-TGCATGTCGCTTGAAA-------CTCCTCATAGA M_mulatta300203 TTTTC---CTGGAGGCTGCACGTTGTTGGAAA-------TGCCTCATAGA M_mulatta300269 TTTTC---CTATAGCCTGCACGTCGTTGGAAA-------CGCCTCATAGA M_mulatta300429 --------ATTAAAATATGAATAAATTTGAAA-------TGCCTCATACA M_mulatta300435 TTTTT---CTGTAGCCAC-ACCAT-CTGAAAA-------CATCT---AGT M_mulatta300454 TTTTG---CTGTAGCCTGCATGTTGTTGGAAA-------TGCGTCACGGA M_mulatta300478 TTTTC---CTGTAGCCTGCACGTCGTTGGAAA-------CACCTCATAGA M_mulatta300664 TTTTC---CTGTAGCCTGCATGTCGTTGGAAA-------CGCCTCATAGA M_mulatta300443 ATT-C---CTGTAGCCTGCATGTCCTTAGAAA-------CGCCTCATAGA M_murinus300248 TTTTT---CTGTAGCCAT-ACATCGTTGGAAA-------CGCCTCATAGA M_murinus300261 TTTCT---CTGTAGCTAC-ACATCCTTGGAAA-------TGCCTCACAGA M_murinus300304 TTTTT---CTGTAGCCAC-ACATAGTGGGAAACACCTCATACCTCATAGG M_murinus300329 TTTTC---TTGTAGCTGC-ACATCTTTAGAAA-------CACCTCATAGA M_murinus300336 --------GAGTGTTGGATACATCGCTGGAAA-------TGTCTCATAGA M_murinus300340 --------GAGTGTTGGATACATCGCTGGAAA-------TGTCTCATAGA M_murinus300348 TTTTC---CTGTAGCTGC-AAATGGTTGGAAA-------CGTCTCATAGA M_murinus300368 TTTTT---CTGTAGCCAT-ATGTCATTGGAAA-------CGCCTCATAGA M_murinus300478 --------TTGTAGCC-CTACATCATTGGAAA-------CGCCTCGCAGA M_murinus300042 TCTTA---CTGTGGCCAA-AGATCACTAGAAA-------CTTCTCATAGC M_murinus300060 --------CCGTAGCC-ACACACCATTGGAAA-------TGCTTCATAGA M_murinus300108 TTTTT---CTGTAGCCAT-ACACCGTTGGAAA-------CCCCTCATAGA M_murinus300126 TTTCT---CTGTAGCTAC-ACATCCTTGGAAA-------TGCCTCACAGA M_murinus300154 TTTTT---CTGTAGCCAC-ACATAGTGGGAAACACCTCATACCTCATAGG M_murinus300195 TTTTT---CTGTAGCCAT-ACATCGTTGGAAA-------CGCCTCATAGA M_musculus300096 TTCCC---TAGTAGCCAG-ACGTCGTTGGAAA-------CGCCTCATACA M_musculus300958 TTCTC---CTATAGCTGC-ATATTGTTAGAAA-------CCCCTCATACA M_lucifugus300560 TTTTT---CTGTAGACTT-ACATCGTTGGAAA-------CGCCTCATA-- M_lucifugus300877 --------TTGTAGACTTA-CATCGTTGGAAA-------CGCCTCATAGA M_lucifugus300878 --------CTGATCATGTCTCATTGTTGGAAA-------CGCCTCATAGA M_lucifugus300130 TTTTT---CTGTAGACTT-ACATCGTTGGAAA-------CGCCTCATAGA M_lucifugus300201 TTTT----CTGTAGACTT-ACATCGTTGGAAA-------TGCCTCATAGA M_lucifugus300244 TTTTT---CTGTAGACTT-ACATCGTTGGAAA-------CGCCTCATAGA M_lucifugus300440 TTTTT---CTGTAGACCT-ACATCGTTGGAAA-------CACCTCAGA-- O_anatinus304403 CTC-----TCATAGGTCC-ACGTCGTTGGAAA-------CGCCTCAGAGA O_cuniculus300035 TTTTC---CTATAGCCAC-TCATTGTTGGAAA-------CGTCTCATAGA O_cuniculus300218 TTTTC---CCACAGACGC-TCGTCATTGGAAA-------CACCTCATAGA O_cuniculus300268 TTTTC---CTATGGC--C-ACACGGTGGGAGA-------TGCTTCCTATA O_cuniculus300317 TTTTA---CTGCAGCCAC-ACATCACTGGAAA-------TCCCTTACAGA O_cuniculus300399 TTTCC---CTATAGCCAT-TCATCGTTGGAAA-------CGCCTCATAGA O_garnettii300012 --------AAATAGC----ACA-CGTTGAAAA-------TGCCCCATAGA O_garnettii300157 CTTTT---CTGTAGCTAC-GCATCATTGGAAA-------TGCCTCACAGA O_garnettii300326 --------AATTACTTATTAAAACAT--ATAT-------TTATTCATAGA O_garnettii300329 --------GCATAGCC-ACACATCACTGGAAA-------TGTTTCATAGA O_garnettii300390 TTTTT---CTGTAGCCAC-ACATTGTTGGAAA-------CACCTCATAGA O_garnettii300483 TTTTC---TTGTAGCTGC-GCATCTTTAGGAA-------TACCTTAGAGA P_troglodytes300051 ------------------GAATAGATTGGAAA-------TGCCTCATAGA P_troglodytes300224 TTTTC---TTGTAGCCTGCACGTTGTTGGACA-------TGCCTCATAGA P_troglodytes300313 --------TTAA--ATGTC-CATCACAGGAAA-------CACCTT-TAGA P_troglodytes300347 TTTTC----TGTAGGCTGCACATCATTGGAAA-------CGCCTCATAGA P_troglodytes300372 ATT-C---CTGTAGCCTGCACGTCCTTAGAAA-------CACCTCATAAA P_troglodytes300384 TTTTC---CTGTAGC-TGCATGTTGTTGGAAA-------CTCCTCATAGA P_troglodytes300674 TTTTC---CTGTAGCCTGCACGTCGTTGGAAA-------CGCCTCATAGA P_troglodytes300225 TTTTT---CTGTAGCCAC-ACCAT-CTGGAAA-------CATCT---AGT P_pygmaeus300412 TTTTT---CCATAGCCAC-ACCAT-CTGGAAA-------CATCT---AGT P_pygmaeus300543 --------TTAA--ATGTC-CATCACAGGAAA-------CACCTT-TAGA P_pygmaeus300064 --------ATTAAAATATGAATAAATTGGAAA-------TGCCTCATAGA P_pygmaeus300146 ATT-C---CTGTAGCCTGCACGTCCTTAGAAA-------CACCTCATAAA P_pygmaeus300249 TTTTC---CTGTAGC-TGCATGTTGTTGGAAA-------CTCCTCATAGA P_pygmaeus300299 TTTTC---CTGTAGCCTGCACATCGTTGGAAA-------CGCCTCATAGA P_pygmaeus300365 --------TTAA--ATGTC-CATCACAGGAAA-------CACCTT-TAGA P_pygmaeus300377 TTTTC----TGTAGGCTGCACGTCATTGGAAA-------CACCTCATAGA R_norvegicus300913 TTCTC---CTATAGCTGC-ACATTGTTGGAAA-------CCCCTCATACA R_norvegicus300317 TTCGT---TAGTAGCCAC-ACATCGTTGGAAA-------CGCCTCATATA R_norvegicus300858 TTCGT---TAGTAGCCAC-ACATCGTTGGAAA-------CGCCTCATATA R_norvegicus300072 TCCTC---TGGTAGCCAC-ACATTATTGAAAA-------CACCTTGCAGA R_norvegicus301009 TTCTC---TGGTAGCCAC-ACATCGTTGGAAA-------CGCCTCGTATA S_araneus300455 -------------------AAATTATTGGCAG-------TGCCTCATAAA S_araneus300729 TTTTC---CTAAATACTC-ACGTAGCTGGAAA-------TGTCTCATAGA S_araneus300097 TTTTC---TGTGAGCCT--ATGTCGTTGGAAA-------CGCCTCATAGA S_tridecemlineatus300206 CTTTC---CTATAGCCAC-ACATTGCTGTAAA-------TACCTGATAGA S_tridecemlineatus300176 TTCTC---CTGCAGCCAC-TCATTGTTGGAAA-------CGCCTCATAGG T_belangeri300005 TTTTC---CTGTAGCTGC-ACATCATTAGAAA-------CACCTCATAGA T_belangeri300031 TTTTT---CTGTA-CTGC-ACATTGTTGGAAA-------CACCACACAGA T_belangeri300183 TTTTC---CTGTAGCTGC-ACATCGTTGGAAA-------CGCCTCATAGA T_belangeri300201 TTTTC---CTGTAGCTGC-ACATCGTTGAAAA-------CGCCTCATAGA T_belangeri300225 TCTTC---CTATAGATCT-ACATTATTGGAAA-------CACCTTTTAGA C_familiaris300028 GTAA--------ATATGTAGTTT--GCTTTGCT--CAAATAATT---ATG C_familiaris300047 ATAA--------CTATGTTGTTC--ACTTTACT--CACAGAACT---AT- C_familiaris300061 ATAA--------CTATGTTGTTC--ACTTTACT--CACAGAACT---AT- C_familiaris300160 GTAT--------ATGTGCAGTTTC--CTTTATT--CACAGAACT---ATG C_familiaris300282 ATAA--------CTATGTTGTTC--ACTTTACT--CACAGAACT---AT- C_familiaris300287 GTAT--------ACGTGTGGTTT--GCTTTATT--CACAGAACT---ATG C_familiaris300465 GTAT--------ATGTGTGGTTT--CCTTTATT--CACAGAACT---ATA C_porcellus300012 GTAA--------ACCTCTGGTCTC-TTTTTCCT--CATGAGACTA----- C_porcellus300085 GTAA--------CACTG--GTTTT-GCTCTGCT--CACAGGTCT---ACT C_porcellus300757 GTAA--------CATTG--GTTTT-GCTCTACT--CACAGGTCT---GCT D_rerio300213 TAAA--------GTCTGTAGTATC-GCTTTACC--CATGTTGCTAATTTC D_novemcinctus300340 GGAA--------TGTGGCAGCTCA-GCTTTACT--CACAGAACT---GCT D_novemcinctus300350 GGAA--------TGTTGTGGTTCT-GCTTTACT--CACAGAACT---ATT D_novemcinctus300392 AGAA--------CATTGTGCTTCA-ACTTTACT--CACAGAAAT---GTT D_novemcinctus300397 GGAA--------TGTTGTGGTTCA-GCTTTACT--CACAGAACT---ATT E_telfairi300040 GGAA--------CTGTGTGGTTT--GCTTTACT--TGCAGAACT---AGT E_telfairi300056 GTAA--------CTGCCTGGTTT--GATTTACT--TGCAGAACT---ATT E_telfairi300067 GTAA--------CTCTGTGGTTT--GCTTTACT--TGCAGAACTGCTATT E_telfairi300133 GCAC--------CTGTGTGGTTT--GCTTTACT--TGCAGAACT---ATT E_telfairi300173 GTAA--------CTCTGTGGTTT--GCTTTACT--CGCAGAGCTGCTGTT E_telfairi300237 GTAA--------CTCTGTGGTTT--GCTTTACT--CGCAGAACTGCTATT E_telfairi300242 GTAA--------CTCTGTGGTTT--GCTTTACT--CGCAGAACTGCTATT E_telfairi300382 GTAA--------CTCTGTGGTTT--GCTTTACT--CGCAGAACTGCCATT E_telfairi300420 GTAA--------CTCTGTGCTTTG--CTTTACT--CGCAGAACTGCTATT E_telfairi300463 CTGA--------CTATGTGGTTT--GCTTTACT--CACAGAACTGCTATT E_telfairi300482 GTAA--------CTATGTGGTTT--GCTTTACT--CACAGAACTGCTATT E_telfairi300514 GTAG--------CTATGTGGTTT--GCTTTACT--CTCTGAACT---ATT E_telfairi300731 GTAA--------CTATGCGGTTT--GCTTTACT--CGCAGAACTGCTGTT E_telfairi300736 GTAA--------CTGT--GGTCT--GATTGACT--CGCAGACCT---ATT E_caballus300009 GTAA--------CTATGTGGTTT--GCTTTACT--CACAGAACT---ATC E_caballus300014 GTAA--------CTATGAGGTTT--GCTTTACT--CACAGAACT---ATT E_caballus300015 GTAA--------CTATGTGGTTT--GCTTTACT--CACAGAACT---ATT E_caballus300018 GTAA--------CTATGTGGTTT--GCTTTACT--CACAGAACT---ATT E_caballus300046 GTAA--------CTATGTGGTTT--GCTTTACT--CACAGAACT---ATC E_caballus300061 GTAA--------CTATCTGGTTT--GCTTTACT--CACAGAACT---ATT E_caballus300065 GTAA--------CTATGTGCTTT--GCTTTACT--CACAGAACT---ATT E_caballus300071 GTAA--------ATATGTGGTTT--GCTTTACT--CACAGAACT---ATT E_caballus300072 GTAA--------CTATGTGGTTT--GCTTTACT--CACAGAACT---ATT E_caballus300074 GTAA--------CTATGTGGTTT--GCTTTACT--CACAGAACT---ATT E_caballus300116 GTAA--------CCTTGTGGTTTTCGCTTTACT--CAGAGAACT---ATC E_caballus300137 GTAA--------CTATGTTGTTT--GCTTTACT--CACAGAACT---ATT E_caballus300147 GTAA--------TTATGTGGTTT--CCTTTACT--CACAGAACT---GTG E_caballus300153 GTAA--------TTACGTGGTTT--CCTTTACT--CACAGAACT---ATG E_caballus300188 GTAA--------CTATGCGGTTT--GCTTTACT--CACAGAACT---ATT E_caballus300196 GTAA--------CTATGTGGTTT--GCTTTACT--CACAGAACT---TTT E_caballus300237 GTAA--------TGA---GGTTT--CCTTTACT--CACAGAACT---GGC E_europaeus300110 GTAA--------TCATGTAGTCT--GCTTTACT--CACAGAACTGCTG-- E_europaeus300604 GTAA--------TTGTGTGGTTT--GCTTTGCT--CATAGAGCTACTG-- F_catus300089 GTAT--------ATGTGTGGTTT--CCTTTATT--CACAGAACT---ATG F_catus300170 GTAC--------ATGTGTGGTTT--CCTT-ATT--CACGGAACT---ATG F_catus300183 GTGT--------ATGTGTGGTTTC--CTTTATT--CACGGAGCT---ATG F_catus300187 -TAT--------ATGTGTGGTTTT--CTTTATT--CACAGAACTA--GAT G_gallus300033 ACAA--------ACTTGTGGTTTA-GTTTTACC--CTTGGAGCTAC--CT G_aculeatus300087 GTAA--------CTCTGTAGTTTC-GCTTTACC--CACATGTTCACTGCC G_aculeatus300089 GTAA--------CTCTGTAGTATC-GCTTTACC--CACATGTTCACTGCC G_gorilla300684 GTTAA-------CTCTGTGGTTTT-ACTTTACT--CACAGGACT---CTT G_gorilla301063 GT-AA-------CTCTGTGGTTTT-ACTTTACT--CACAGGACT---ATT G_gorilla300205 GT-AA-------CTCTGTGGTTTT-ACTTTACT--CACAGGACT---ATT G_gorilla300272 CT-AA-------CTCTGTGGTTTT-GCTTTACT--CACAGGACT---ATT G_gorilla300273 GTAA--------CTCTGTGGTTTT-ATTTTACC--CACAGGACT---A-T G_gorilla300551 GTAA--------CTCTGTGGTTTT-ATTTTACC--CACAGGACT---A-T H_sapiens300751 GT-AA-------CTCTGTGGTTTT-ACTTTACT--CACAGGACT---ATT M_mulatta300176 GTAA--------CTCTGTGGTTTT-ACTTTACT--CACAGGACTA----T M_mulatta300191 CT-AA-------CTCTGTGGTTTT-GCTTTACT--CGCAGGACT---ATT M_mulatta300203 GTTAA-------CTCTGTGGTTTT-ACTTTCTT--CACAGGACT---CTT M_mulatta300269 GTAA--------CTCTGTGGTTTT-ACTTTACT--CACAGGACT---A-T M_mulatta300429 GTAA--------CTCTG--GTTTT-ATTTTACC--CACAGGACT---A-T M_mulatta300435 GTAA--------CTCTGTGATTTT-GCTTTACT--CATAGGAATA--T-- M_mulatta300454 GT-AA-------CTCTGTGGTTTT-ACTTTACT--CACAGGACT---TTT M_mulatta300478 GT-AA-------CTCTGTGGTTTT-ACTTTACT--CACAGGACT---ATT M_mulatta300664 GT-AA-------CTCTGTGGTTTT-ACTTTACT--CACAGGACT---ATT M_mulatta300443 GTAA--------CTGTG-GTTTTA--CTTTACT--CACAGGACTATT--- M_murinus300248 GTAA--------CATTGTGGTTTT-GCTTTCCT--CACAGGACT---ATT M_murinus300261 GTAAATTTTGTGCTCTGTGGTTTT-GCTCTATT--CACAGGATTA--TTT M_murinus300304 GTAA--------CACTATGGTTTT-GCTTTACTCTCACAGGACT---GTT M_murinus300329 GAAA--------TTGTG-ATTTTT-GCTTGACT--CACAGGACTG--TTT M_murinus300336 GTAA--------CATTGTGGTTTT-GCTTTCCT--CACAGGACT---ATT M_murinus300340 GTAA--------CATTGTGGTTTT-GCTTTCCT--CACAGGACT---ATT M_murinus300348 GTAA--------CTTTGTGGTTTT-GCTTTACT--CACAGGACT---GTT M_murinus300368 GTAA--------CACTGTGGTTTT-GCTTTCCT--CACAGGACT---ATT M_murinus300478 GTAA--------CATTGTGGTTTT-GCTTTCCT--CACAGGACT---ATT M_murinus300042 GTAG--------CTCTGTGATTTT-GCCTAACT--CACAAGACTG--C-- M_murinus300060 GTAA--------C--TGTGGCTTG-GCTTTACT--CACAGGACT---TTT M_murinus300108 GTGA--------CACTGTGGTTTT-GCTTTCCT--CACAGGACT---ATT M_murinus300126 GTAAATTTTGTGCTCTGTGGTTTT-GCTCTATT--CACAGGATTA--TTT M_murinus300154 GTAA--------CACTATGGTTTT-GCTTTACTCTCACAGGACT---GTT M_murinus300195 GTAA--------CATTGTGGTTTT-GCTTTCCT--CACAGGACT---ATT M_musculus300096 GTAA--------CT-TGTGGTTTT-ACTTGACT--CACAGGACT---GAC M_musculus300958 GTTA--------CT----GGTTTT-GCATCACA--CACAGGACT---ATT M_lucifugus300560 ---A--------ATATGTTGTTT--CCTTTATT--CACAGAACT---GTG M_lucifugus300877 ATAA--------ATATGTTGTTTC--CTTTATT--CACAGAACT---GTG M_lucifugus300878 ATAA--------ATATGTTGTTTC--CTTTATT--CACAGAACT---GTG M_lucifugus300130 ATAA--------ATATGTTGTTT--CCTTTATT--CACAGAACT---GTG M_lucifugus300201 ATAA--------ATATGTTGTTT--CTTTTATT--CACAGAACT---GTG M_lucifugus300244 ATAA--------ATATGTTGTTT--CCTTTATT--CACAGAACT---GCG M_lucifugus300440 ATAA--------ATAGGTAGCTT--CCTTTACT--CACAGAACT---ATG O_anatinus304403 AAAA--------AGTTGTGGTCTC-GCTTTACC--TACCGAACTGTG--T O_cuniculus300035 GTAA--------CT--GTGGTTTT-GCTTTACT--CA--GGACT---TTT O_cuniculus300218 ATAT--------TTCTGTGGTTTT-GCTTTCCT--CACAGGACTT--TGT O_cuniculus300268 GTAA--------CCG---CGGTTT-GCTTTATT--CACAGGGCT---ATT O_cuniculus300317 GGAA--------CTCTGTGGTTTT-GCTTTACT--CACAGGCTT---AGT O_cuniculus300399 GCAA--------CTCTGTGGTTTT-GCTTTGCT--CACAGGACT---TAT O_garnettii300012 GTAA--------CATTGTGGTTTT-GCTGTACT--CACAGGATT---ATT O_garnettii300157 GTAA--------CTCTGTGGTTCT-GCTTTACT--CACAGGACTA--TGT O_garnettii300326 GTAA--------TACTGCGGTTTT-GCTTTATT--TGTAGGACT---ATT O_garnettii300329 GTAA--------CTCTGTGGTTTT-GTTTTACT--CTCAAGACT---ATT O_garnettii300390 GTAA--------CACTGTGGTTCT-GCTTTACT--CGCAGGTCT---ATT O_garnettii300483 GTAA--------CTGA----TTTT-GCTTTGCT--CACAGCACTA--TTT P_troglodytes300051 GTAA--------CTCTGTGGTTTT-ATTTTACC--CACAGGACT---A-T P_troglodytes300224 GT-AA-------CTCTGTGGTTTT-ACTTTACT--TACAGGACT---ATT P_troglodytes300313 GTAA--------CTCTGTGGTTTT-GCTTTATT--CACAGAGCT---TTT P_troglodytes300347 GTTAA-------CTCTGTGGTTTT-ACTTTACT--CACAGGACT---CTT P_troglodytes300372 GTAA--------CTGTG-GTTTTA--CTTTACT--CACAGGACTATT--- P_troglodytes300384 CT-AA-------CTCTGTGGTTTT-GCTTTACT--CACAGGACT---ATT P_troglodytes300674 GT-AA-------CTCTGTGGTTTT-ACTTTACT--CACAGGACT---ATT P_troglodytes300225 GTAA--------CTCTGTGATTTT-GCTTTACT--CATAGGAGTA--T-- P_pygmaeus300412 GTAA--------CTCTGTGATTTT-GCTTTACT--CATAGGACTA--T-- P_pygmaeus300543 GTAA--------CTCTGTGCTTTT-GCTTTATT--CACAGAGCT---TTT P_pygmaeus300064 GTAA--------CTCTGTGGTTTT-ATTTTACC--TACAGGACT---A-T P_pygmaeus300146 GTAA--------CTTTG-GTTTTA--CTTTACT--CACAGGACTATT--- P_pygmaeus300249 CTTAA-------CTCTGTGGTTTT-G-TTTACT--CACAGGACT---ATT P_pygmaeus300299 GT-AA-------CTCTGTGGTTTT-ACTTTACT--CACAGGACT---ATT P_pygmaeus300365 GTAA--------CTCTGTGCTTTT-GCTTTATT--CACAGAGCT---TTT P_pygmaeus300377 GTTAA-------CTCTGTGGTTTT-ACTTTACT--CACAGGACT---CTT R_norvegicus300913 GTAA--------CT----GATTTT-GTATCACA--TACGGGACT---GCT R_norvegicus300317 GTAA--------CT-TGTGGTTTT-GCTTGACT--CGCAGGACT---GTT R_norvegicus300858 GTAA--------CT-TGTGGTTTT-GCTTGACT--CGCAGGACT---GTT R_norvegicus300072 GTAA--------CTCTGTGGTTTT-GATTTATT--TACAGGATTA--TGT R_norvegicus301009 GTAA--------CT-TGTGGTTTT-ACTTGACT----CATGACT---ATT S_araneus300455 AGTA--------TTTTG---ATTT-GCTTTACT--CGTAGGACT---ACT S_araneus300729 GT-C--------ACGTG-GCTTTG--CTTTACT--CACGGAACT---ATT S_araneus300097 GGA----------T-TGCGGTTT--GCTTGATT--CTCAGGACT---GCC S_tridecemlineatus300206 GTAA----------CTATGGTTTT-ACTTTACT--CACAGAACT---ATT S_tridecemlineatus300176 GCAA--------TTCTGTGGTTTT-GTTTTACT--CATAGGACT---GTT T_belangeri300005 GTAA--------CACTGTAGTTTG-CTTTCCTC--AAT-GGACTA--TTG T_belangeri300031 GTAA--------CACTGTGGTTTT-GGCTTACC--GATAGGACTA--CTG T_belangeri300183 GTAA--------CAGTGT-GGTTT-GCTTTACT--CACAGGACT---ATT T_belangeri300201 GTAA--------CAGTGT-GGTTT-GCTTTACT--CACAGGACT---ATT T_belangeri300225 GTAT--------CTCTGTGGTTTT-GCTTTACT--CAGAGGAATG--TTC C_familiaris300028 T-TTAAATCTGTGGGAA-AGAA-CTATAA-GGCAGGG C_familiaris300047 ---TAGATCTTTTGAAT-AGAA-CTATAA-GACAGAG C_familiaris300061 ---TAGATCTTTTGAAT-AGAA-CTATAA-GACAGAG C_familiaris300160 TGTTAGATCTGTGGGAA--AGACCTCCAG-GACATCT C_familiaris300282 ---TAGATCTTTTGAAT-AGAA-CTATAA-GACAGAG C_familiaris300287 TGTTAGATCTGTGGGAA-AGAA-CTGTAA-GACATCT C_familiaris300465 TGTTAGATCTGTGGGAA-AGAA-CTACAA-GACATCT C_porcellus300012 --TTAGCTCTGTGGGAA-GAA-ACTACAG-GACAATT C_porcellus300085 TCTTAGGCCTGTGATA--AAGCACTACAT-GACAGCA C_porcellus300757 TCTTAGGCCTGTGATA--AAGCACTACAA-GACAGCA D_rerio300213 -ATTAGCTTTGTGGGAA-AAACACTGCAG-TACATTC D_novemcinctus300340 TGTTAGATTTGTGAGAA-GGAA-CTATAA-GATCATT D_novemcinctus300350 TGTTAGATCTGTGAGAA-GGAA-CTACAA-GACAGAT D_novemcinctus300392 TGTAAGATCTGTGAGAA-GGAA-CTACAA-GACAGGT D_novemcinctus300397 TATTAGATCTGTGAGAA-GGAA-CTACAA-GACAGAT E_telfairi300040 GGTTGCCTCTGTGAGGA-CGAA-CTACAA-GACATAT E_telfairi300056 GGTTGGATCTGTGAGAA-AGAA-CTACAA-AGCTAAT E_telfairi300067 GGTTGGATCTGTGAGGA-AGAA-CTACAA-GACATAT E_telfairi300133 GGTTGGATCTGTGAGAA-AGAA-ATACAA-GACAAAC E_telfairi300173 GGTTGGATCTG-GAGGA-AGAA-CTACAA-GACAACT E_telfairi300237 GGTTGGATCTGTGTGGA-AGAA-CTACAA-GACAAAT E_telfairi300242 GGTTGGATCTGTGAGGA-AGAA-CTACAA-GACAAAT E_telfairi300382 GGTTGGATCTGTGAGGA-AGAA-CTACAA-GACAACT E_telfairi300420 GGTTGGATCTGTGAGAA--AGAGCTACAA-GACAAAG E_telfairi300463 GGTTGGATGTGTGAGGA-AGAGGCTACAA-GACAAAT E_telfairi300482 GGTTGGATCTGTGAGGA-AGAA-CTACAA-GACAAAT E_telfairi300514 GCTTGTATCTGTAGGGA-AGAA-CTACAA-GACAAAT E_telfairi300731 GGTTGGAGCTGTGAGGA-AGAA-CTACAA-GACAAAT E_telfairi300736 GGTTGGATCTGTGAGAA-AGAA-CTACAA-GACGTGT E_caballus300009 TGTTAGATCTGTGGGAA-AGAA-CTACAA-TACAGAG E_caballus300014 TGTTAGATCTGTGGGAA-AGAA-CTACAA-TACAGAG E_caballus300015 TGCTAGATCTGTGGGAA-AGAA-CTACAA-TACAGAG E_caballus300018 TGTTAGATCTGTGGGAA-AGAA-CTACAA-TACAGAG E_caballus300046 TGTTAGATCTGTGGGAA-AGAA-CTACAA-TACAGAG E_caballus300061 TGTTAGATCAGTGGGAA-AGAA-CTATAA-GACAGAC E_caballus300065 TGTTAGATCTGTGGGAA-AGAA-CTACAA-TACAGAG E_caballus300071 TGTTATATCTGTGGGAA-AGAA-CTACAA-TACGGAG E_caballus300072 TGTTAGATCTGTGGGAA-AGAA-CTACAA-TACAGAG E_caballus300074 TGTTAGATCTGTGGGAA-AGAA-CTACAA-TAGAGTT E_caballus300116 TACTAGATGTGTAGTAA-CGAA-CTACAA-GACAGAG E_caballus300137 TGTTAGATCTGTGGGAA-AGAA-CTACAA-TACAGAG E_caballus300147 TGTTAGATCTGTGGGAA-AGAA-CTACAA-GACAGCT E_caballus300153 TGTTAGATCTGTGGGAA-AGAA-GTACAA-CACAGAG E_caballus300188 TGTTAGATCTGTGGGAA-AGAA-CTACAA-TACAGAG E_caballus300196 TGTTAGATCTGTGGGAA-AGAA-CAACAA-TACAGAG E_caballus300237 TGTTAGATCGGTGGGAA-AGAA-CTACAA-GACAGAG E_europaeus300110 -GTTAGATCTGTGAGAA-AGA-ACTGCAA-GACAGCT E_europaeus300604 -GTTAGATCTGTGAGAA-AGA-ACTACAA-GACAGCT F_catus300089 TGTTAGATCTGTGGGAA-AGAA-CTACAA-GACATCT F_catus300170 TGTTAGATCTGTGGGAA-AGAA-CTACAA-GACATCT F_catus300183 TGTTAGATCTGTGGGAA--AGAACTACAA-GACATTT F_catus300187 -TTCTGAAGTATGTCCG-TATT-CAAGTG-------- G_gallus300033 -GTTAGCTCTGTGGGAT-AGA-ACTACAA-GACAAAT G_aculeatus300087 -ATGAGCATAGTGCGAT-ATA-ACTGCAG-AACACCG G_aculeatus300089 -ATGAGCATAGTGAGAT-ATA-ACTGCAG-AACACGA G_gorilla300684 -GTTAGATCTGTGGGAA------CTACAA-GACAGTT G_gorilla301063 -GTTAGATCTGTGGGAA--GGAATTACAA-GACAGTT G_gorilla300205 -GTTACATCTGTGGGAA--GGAACCACAA-GACAGTT G_gorilla300272 AGTTAGGTCTGTGGGAA--GGAACTACAA-GACAGTT G_gorilla300273 GGTTAAATATGTGGGAA--AGAACTAGAA-GACAGTT G_gorilla300551 GGTTAAATATGTGGGAA--AGAACTAGAA-GACAGTT H_sapiens300751 -GTTAGATCTGTGGGAA--GGAATTACAA-GACAGTT M_mulatta300176 TGTTAGATCTGTGGGAA--GGAACTACAA-GACAGTT M_mulatta300191 TGTTAGATCTGCGGGAA--GGAACTACAA-GACAGTT M_mulatta300203 -GTTAGATCTGTGGGAA--GGAACTACAA-GACAGTT M_mulatta300269 TGTTAGGTCTGTGGGAA--GGAACTACAA-GACAGCT M_mulatta300429 GGTTAAATATGTGGGAA--AGAACTACAA-GACAGTT M_mulatta300435 ---TAGAGCTGTGGGGA-GGAA-GTATAA-TACCAGA M_mulatta300454 -GTTAGACCTGTGGGAA--GGGACCACAA-GGCAGTT M_mulatta300478 -GTTAGATCTGTGGGAA--GGAACTACAA-GACAGTT M_mulatta300664 -GTTAGGTCTGTGGGAA--GGAACTACAA-GACAGTT M_mulatta300443 -GCTAGATCTGTGGGAA--AGAACTACAA-GACAGTT M_murinus300248 TGTTAGATCTGTGGGA--AGAAACTACCA-GACAGTT M_murinus300261 -GTCAGATCCGTGGGGA-GGAA-CTATGA-GACAGAT M_murinus300304 TGTTAGATCTGTGTTCCCAGGAACTACAA-GACAGTT M_murinus300329 TGTTAGATCTGTGGGAA-GGAA-CTATAA-GACAGAG M_murinus300336 TGTTAGATCTGTGGGAA--GAAACTACCA-GATAGTT M_murinus300340 TGTTAGATCTGTGGGAA--GAAACTACCA-GATAGTT M_murinus300348 TGTTAGATCTGTAGGAA-GGAA-CTACAA-GACAGTT M_murinus300368 TGTTAACTCTGTGGGA--AGAAACTACCA-GACAGTT M_murinus300478 TGTTAGATCTGTGGGAA--GGAACTACCA-GACAGTT M_murinus300042 ---TAAATCTGTGGGAA-GAAA-CTATAA-GACAGTT M_murinus300060 TGTTAGATCTGTGTGAA--GGAACTACAA-GACAGTC M_murinus300108 TGTTAGATCTGTGAGA--AGAAACTACCA-GACAGTT M_murinus300126 -GTCAGATCCGTGGGGA-GGAA-CTATGA-GACAGAT M_murinus300154 TGTTAGATCTGTGTTCCCAGGAACTACAA-GACAGTT M_murinus300195 TGTTAGATCTGTGGGA--AGAAACTACCA-GACAGTT M_musculus300096 TGTTAGGTCTGTGGGAA--GGAACTACAA-GACAGCT M_musculus300958 TCTCAGGTCTATGGGAA-GGGA-CAAGAT-GGCCAAC M_lucifugus300560 TGTTAGATCTGTGGGAA-GGAA-TTACAA-GACAGCT M_lucifugus300877 TGTTAGATCTGTGGGAA--GGAATTACAA-GACAGCT M_lucifugus300878 TGTTAGATCTGTGGGAA--GGAATTACAA-GACAGCT M_lucifugus300130 TGTTAGATCTGTGGAAA-GGAA-TTACAA-GACAGCT M_lucifugus300201 TGTTAGATCTGTGGGAA-GGAA-TTACAA-GACAGCT M_lucifugus300244 TGTTAGATCTGTGGGAA-GGAA-TTACAA-GACAGCT M_lucifugus300440 TGTTAAATCTGTGGGAA-GCAA-CTACAA-GACAGCT O_anatinus304403 -GTTGGATCGGTGGGGG-AAAAGCCACAA-GACAGTT O_cuniculus300035 TCTTAGGTCTATTGGAA-GGAA-CTACAA-GACAATT O_cuniculus300218 -TTTAGGTCTGTGTGAA-GGAA-TTATAA-GATAATT O_cuniculus300268 TGTCAGGTCTGCCAGAA-GGAA-CTATAA-GACAGTT O_cuniculus300317 GGTTAA-TCTGTAGGA---GGAACTACAA-GACAGTC O_cuniculus300399 TCTTGGGTCTGTGGGAA-GGAA-CTACAA-GACAGTT O_garnettii300012 TGTTAGATCTGTGGGA---GGAACTACGA-GAAAATT O_garnettii300157 -ATTAGGTAGGTATTGG-CATA-TCCTT--------- O_garnettii300326 TGTTAGGTCTGTGGGAC--AGAACTACCA-GACAATC O_garnettii300329 TGTTAGATCTATGGGAA--GGAACTACAA-GATGGTC O_garnettii300390 TGTTAGGTCTGTGGGA--AAGAACTACAA-GACAATT O_garnettii300483 -GTTAGATCTGTGTAAA-GGAA-CTATA--GACAGAG P_troglodytes300051 GGTTAAATATGTGGGAA--AGAACTACAA-GACAGTT P_troglodytes300224 -GTTACATCTGTGGGAA--GGAACCACAA-GACAGTT P_troglodytes300313 TGTTAGAACTGTGGAAA--GGAATTACAA-CATAGAG P_troglodytes300347 -GTTAGATCTGTGGGAA------CTACAA-GACAGTT P_troglodytes300372 -GCTAGATCTGTGGGAA--AGAACTATAA-GACAGTT P_troglodytes300384 AGTTAGGTCTGTGGGAA--GGAACTACAA-GACAGTT P_troglodytes300674 -GTTAGATCTGTGGGAA--GGAATTACAA-GACAGTT P_troglodytes300225 ---TAGAGCTGTGGGGA-GGAA-CTATAA-TATAAGG P_pygmaeus300412 ---TAGAGCTGTGGGGA-AGAA-CTATAA-TACAAGA P_pygmaeus300543 TGTTAGAACTATGGAAA--GGAATTACAA-CATAGAG P_pygmaeus300064 GGTTAAATATGTGGGAA--AGAACTACAA-GACAGTT P_pygmaeus300146 -GCTAGATCTGTGGGAA--AGAACTATAA-GACAGTT P_pygmaeus300249 AGTTAGGTCTGTGGGAA--GGAACTACAA-GACAGTT P_pygmaeus300299 -GTTAGATCTGTGGGAA--GGAACTACAA-GACAGTT P_pygmaeus300365 TGTTAGAACTATGGAAA--GGAATTACAA-CATAGAG P_pygmaeus300377 -GTTAGATCTGTGGGAA------CTACAA-GACAGTT R_norvegicus300913 TCCCAGGTCTGTGGGAA-GGGA-CTGCAT-GACGGCA R_norvegicus300317 TGTTAGGTCTGTGGGAA--GGAACTACAA-GACAGCT R_norvegicus300858 TGTTAGGTCTGTGGGAA--GGAACTACAA-GACAGCT R_norvegicus300072 -CT-AGGTTTGTCAGAA-GGAA-CTACAA-GACAGTT R_norvegicus301009 CGTTAGGTCTGTGGGAA--GGAACTACAA-GACAGCA S_araneus300455 TGTTAGATCTGTGGGGA--AGAACTAACA-TACAGCT S_araneus300729 TGTTAGATCTGTGG-AA--AGAACTGCAG-GACAGTA S_araneus300097 TGTTAGACCTGAGAGAA--AG--CTACCCCGACAGCT S_tridecemlineatus300206 TGTTAGATCTATGAGA--AAGAACTAAAG-GATAGTT S_tridecemlineatus300176 TGTTAGGCCTATGGGAA--GGAACTACAA-GACAATT T_belangeri300005 -GTCAGGTCTGTGAGAA-GGAA-CTATTA-TAGTCTA T_belangeri300031 -GTTAGATCTGTGAGAA-C-AA-CTAAAA-GCATGAA T_belangeri300183 TGTTAATTCTGTGAGA--AAGAACTACAT-TACAGAA T_belangeri300201 TGTTAATTCTGTGAGA--AAGAACTACAT-TACAGAA T_belangeri300225 -GTTAGATCTGTGGGAA-GGCA-CCATGA-GATGGAA

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved