snOPY snoRNA Orthological Gene Database

Family: SNORA16,W08G11.6

CLUSTAL 2.0.10 multiple sequence alignment C_elegans300080 GAGCAGAT-GTCCATTACGCGAATGCCT---GTGCTTTTCGACGTTTAGTTTAGTCTGCA C_elegans300131 ATGCACCTTGCACTCTACGCCTTTCCTTTCAATGGGTTGGTATGATTTAATAAGGATGCA *** * * * ***** * * * ** ** * * ** * ** **** C_elegans300080 AGA---TAGAATTGATGTCTCGAAGACAGGTACATCAGCTTTTAGAGTTCCT---GTTCA C_elegans300131 AGAGAATAGTACGGGAAGTTCGAAGACTTGCGGATTTGCTTCCACGGCTCCGCGAGTTCA *** *** * * ******** * ** **** * * *** ***** C_elegans300080 AGATCAGCAA-ACAAAC C_elegans300131 TAACTGTCACCACAATT * ** ****

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved