snOPY snoRNA Orthological Gene Database

Family: SNORA16

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300071 --CCTGGCCCTTATCGAAGCTGCAGCTGCTTC---CACATA-GCTGCTGT C_familiaris300296 ------ATTAGAATCAAAGATGCAGTTGCTTT---CACATA-GAAGCAGC C_porcellus300146 --GGTGGCCCTTATCGAAGCTGCAGCTGCTTG---TACATA-GTTGCTGC C_porcellus300395 --AGTGGCCCTTATCGAAGCTGCAGCTGCTTG---TATGTA-GTTGCTGC C_porcellus300728 --AGTGGCCCTTATCGAAGCTGCAGCTGCTTG---TATGTA-GTTGCTGC C_porcellus300782 --TGTGGCCCTTATCGAAGCCGCAGCTGCCTG---TACGTA-GTTGCTGC C_porcellus300865 ------------------AGTAGAATATATTG---CTGC----------- D_rerio300264 --CATGGCCCTGATTGAAGCTGTCCAGTTTGT----CTGTA-ACTGGTGC D_rerio300265 --CAAGGCCCTGATCGAAGCTGTCCTGTTCAT----CTATA-GCAGGTAC D_novemcinctus300058 --ATTAGTCAGCATTAAATCTGCAGATGGCTT---CCACTA-AGTACTAC D_novemcinctus300326 --CGTGTTTCTACTCAAAGCTGCACCTGTTTT---CACATA-GTTACTAT D_novemcinctus300328 --TGTGGCTCTCATCAAAGCTGCAGCTGCTTC---CACATA-GCTACTGG D_novemcinctus300367 --AGTTGCTCTCATCAAAGCTGCAGCTGCTTC---CACATA-GCTACTGT D_novemcinctus300391 --CACGGCCCTTATCGAAGCGGCAGCTGCTTT---CACATA-GCTCCTGT D_novemcinctus300468 ---------AAGACCCCAAATAAACACCTTTG---TTGCCT-TGCAAAAA D_novemcinctus300469 --GTTGGCTCTCATCGAAGCTGCAGCTGCTTC---CCCATA-GCTACTGT D_novemcinctus300489 --GGTGGCTCTCATCAAGGCTGCAGCTGCTTC---CACATA-GCTACTGA D_novemcinctus300505 --GGTGGCTCTCGTCGAAGCTGCAGATGCTTC---CACAAA-GCTACTCT D_melanogaster300107 ---AGGGCTTTGTCGAAGACCGTTTTGCGTGTAGAATAGTGCGCCGATTG D_melanogaster300108 ---TGGGCTACGTCGAAGACCGATTTCCGCTTGTTGCCATGTGTCTATTG D_melanogaster300109 ---TTGGCTGGTTCGAAGACCACAAAACGCTCCTCGAAA---GTTGCGTG E_telfairi300054 --AGGGGCCCTTATCGAAGCTGCAGTTGCTTC---CACGTA-GCTGATGT E_telfairi300108 --TGGGACCCTTATCGAAGCTGAAGTTGCTTC---CACGTA-GCTGCTGT E_telfairi300394 --AGGGGCCCTTATCGAAGCTGCAGTTTCTTC---CACGTA-GCTGCTGT E_telfairi300617 ------AAGAAAATGTTTTGAAAATGATGATG---GCCGTA-GCTGCTGT E_telfairi300643 --TGTGGCTCTTATTGAAGCTGCAGTTGCTTC---CACATA-GCTGCTGT E_telfairi300711 --AGTGGCTCTTATCAAAGCTGCAGTTGCTTC---CACATA-GCTGCTGT E_telfairi300713 --AGTGGCCCTTATCGAAGCTGCAGTTGCTTC---CACCGATGCTGCGGT E_caballus300001 --TGTGGCCCTTATCGAAGCTGCAGCTGCTTC---CACATA-GCTGCTGT E_caballus300139 -----AAAAGGGATTAAAGGTGCAGCTGCTTT---CCCATT-TAAGCAGC E_europaeus300287 --TGTGGTCCTTATCGAAGCTGCAGCTGTTTC---CATTTA-GCTGCTGT E_europaeus300344 --AGTGGCCCTTATCAAAGCTGCAGCTGCTTC---CATTTA-CCTGCTGT E_europaeus300423 --TGTGACCCTTATCGAAGCTGCAGCTGCTTC---CATTTA-GCTTCTGT H_sapiens300654 --CTTGGCCCTTATCGAAGCTGCAGCTGCTTC---CGCATA-GCTGCTGT H_sapiens300677 --TATGGCCTTTATCAAAGCTGCAGCTGCTTC---CATGTA-GCTGCTGT L_africana300204 --AAAAGTTAGTATCAAAGATGCAGCTGCTTT---TGCGTT-TCTACAGC M_mulatta300128 --GGCGGCTCTCATCGCAGCTGCAGCTGCTTC---CACATA-GCTGCTGT M_mulatta300217 --CTTGGCCCTTATCGAAGCTGCAGCTGCTTC---CGCATA-GCTGCTGT M_mulatta300565 --AGTGGCCCTTATCAAAGCTGCAGTGGTTTC---TACATA-GCTGCTGT M_mulatta300590 --TATGGCCTTTATCAAAGCTGCAGCTGCTTC---CATGTA-GCTGCTGT M_mulatta300738 --AAAAATTGGGACCAAAGATTCAGCTGTCTT---CCCATT-TAAGCAGC M_murinus300083 --AGGGACCCTTATCAGGGCTGTGGTGGCCTC---CACACA-GCTGCTGT M_murinus300124 --CATTACCCTTATCAAAGTTGCA---GCTTC---CACATA-GCTGCTGT M_murinus300238 --TGTGGACATTATGGAAGCTGCAGCTGCTTC---CACCCA-GCTGCTGT M_murinus300383 --CGTGGCCCTTATCGAAGCTGCAGCTGCTTC---CACATA-GCTGCTGT M_murinus300404 -------TTAGGATCAAAGATGCAGCTGCTTT---CCCATT-TAAGCAGC M_murinus300461 --AGTGGCCCTTATTGAAGCTGCAGCTGCT------------------GT M_murinus300514 --CATAGTACATATGAAATGTACTATTTAATA---TAAAAA-AGAAATGT M_domestica300064 --CCAGGCCCTTATCGAAGCTGCACCAGCTCT---TCTATA-GCTGTTGC M_musculus300015 --GGCAGCCCTTATCAAAGCTGCAGCTGTTTC---CACATA-GCTGATGT M_musculus300610 --TGTGGCCCTTATCGAAGCTGCAGCAGCTTC---TACATA-GCTGCTGT M_lucifugus300169 --TGTGGCCCTTATTGAAGCTGCAGCTGCTTC---CACATA-GCTGCTGC M_lucifugus300196 --CATGGCCCTTTTGGAAGCTGCAGCTGCGTC---CATATA-GCTACTGC M_lucifugus300270 --AGTGGCCCTTATCGAAGCTGCAGCTGCTTC---CACGTA-GCTGCTGC M_lucifugus300340 --GATGGCCCTTATCAAAGCTGCAGTTGCCTC---CCTGTG-CCTGCTGC M_lucifugus300538 --TGTGGCCCTTATCGAAGCTGCAGCTGCTTC---CACGTA-GCTGCTGC M_lucifugus300913 --TGTGGCCCTTATCCAGGCTGCAGCTGGGGGGA-TACAGG-GTGAGGGG M_lucifugus300940 --AGTGGCCCTTATCAAAGCTGCAGCTGCTTC---CACGTA-GCTGCTGC O_cuniculus300329 --GGTAGCCCTTATCAAAGCTGCAGCCGCTTC---CACATA-GCAGCTCT O_cuniculus300388 --CGCGGCCCTTATCGAAGCTGCAGCTGCTTC---CACATA-GCAGTTGT O_cuniculus300489 --------------------------TGTTGT---CCCAGG-TAAGCAGT O_garnettii300045 --TTTGGTCCTTAGTGAAGCTGCAGCTGCTTC---CACATG-GGTGCTGT O_garnettii300198 ----------------------GGTGACATTC---CACATA-TCTGCTGT O_garnettii300348 ---GGCTGGTTTATGGAAAGCA----TAAGAG---TGCACG-GCTGCTGT O_garnettii300375 --AGTGGCCCTTATCGAAGCTGCAGCTGCTTC---CATATA-GCTGCTGT O_garnettii300469 -------GACTTTCCTAGTTTAA-ACTTAATA---TTATAA-CTGC-TGT O_garnettii300518 --TGTGGCCCTTATCGAAGCTGCAGCTGCTTC---CATATA-GCTGCTGT O_garnettii300589 --TGTGGACATTACGAAAGCCGCAGCTCCTTC---ACCTCA-GCTGCTAT O_garnettii300663 --AATGGCCCTCACCAAAGCTGCAGCTGCTTC---CCCATG-GTTGCTGA O_garnettii300747 --CGTGGCCCTTATTGAAGCTGCAGGTGCTTC---CACATC-TCTGCTGT P_troglodytes300043 --GGCGGCCCTTATCACAGCTGCAGCTGCTTC---CACATA-GCTGCTGC P_troglodytes300514 --CTTGGCCCTTATCGAAGCTGCAGCTGCTTC---CGCATA-GCTGCTGT P_troglodytes300536 --TATGGCCTTTATCAAAGCTGCAGCTGCTTC---CATGTA-GCTGCTGT P_troglodytes300739 --AAAAATTGGGATCAAAGATGCAGCCGCCTT---CCCATT-TAAGCAGC P_pygmaeus300027 --AGCGGCCCTTATCACAGCTGCAGCTGCTTC---CACATA-GCTGCTGC P_pygmaeus300583 --TATGGCCTTTATCAAAGCTGCAGCTGCTTC---CACGTA-GCTGCTGT P_pygmaeus300604 --CTTGGCCCTTATCGAAGCTGCAGCTGCTTC---CGCATA-GCTGCTGT P_pygmaeus300714 --AAAAATTGGGATCAAAGATGCAGCTGCCTT---CCCATT-TAAGCAGC R_norvegicus300057 --GGCAGCCCTTATTAAAGCTGTAGCTGCTTC---CACATA-GCTGGTGT S_cerevisiae300062 ---ATGGCCTCT-TCGAAGATCCGTAGATTTTGCATTTTTGCGGTGGTTT S_araneus300120 -----------GGTGACACTTAC---TGACGC---CGTGTG-ACCGCTGT S_araneus300399 -----------AGTGGCCCTTAT---TGA-----------A-GCTGCTGT S_araneus300461 --TGTGGCCCTTATCGAAGCTGCAGCAACTTC---CACATA-GCTGCTGT S_araneus300518 --ATGTGGCCAGATTGAAGCTTCGGCAGCTTT---GCCACA-GCTGCTGT S_tridecemlineatus300186 --CCTGGCCCTTATCGAAGCTGCAGCTGCTTC---CACATA-GCTTCTGT T_nigroviridis300177 CGACAGGCTCCGATCGAAGCCGTTCGTGCTCC----CTGTA-GCAGCGAA T_belangeri300006 --TGCAGGCCTTATCAAAGCTGCAGCTGCTTTTC---TGTA-GCCGCTGT T_belangeri300015 --AGCGGCCCTTATCGAAGCTGCAGTTGCTTCCG---CGTA-GCCACTGT T_belangeri300038 --CGCGGCCCTTATCGAAGCTGCAGCTGCTTCCG---CGTA-GCCGCTGT T_belangeri300071 --CACGGCCCTTATCGAAGCTGCAGCTGCTTCCG---CGTA-GCCGCTGT T_belangeri300135 --CGCCGCCCTTATCGAAGCTGCAGCTGCTTCCG---TGTG-GCCGCTGT T_belangeri300232 --CCTGGCCTTTTCTGAAGCTGCAGCTACTTCAA----GTA-GCTGCTGG T_belangeri300277 --CGCGGCCCTTATCGAAGCTGCAGCTGCTTCCGAAGCGTA-GAGGCTGT T_belangeri300411 --TTAGGCTATTATCGAAGCTGCAGCTGCTTCCG---CGTA-GCTGCTGT C_familiaris300071 GG------------TCAA-AAAGG--------AGCCCA---GAGTGACAG C_familiaris300296 AG------------TCAGAAAAGA----------GCCT---AAATGACAG C_porcellus300146 AG------------TCAA-AAAGG--------AGCCCA---GAGTAAGAA C_porcellus300395 AG------------TCAA-AAAGG--------AGCCCA---GAGTAAGAA C_porcellus300728 AG------------TCAA-AAAGG--------AGCCTA---GAGTAAGAA C_porcellus300782 AG------------TCAA-AAAGG--------AGCCCA---GAGTAAGAA C_porcellus300865 AG------------TCAA--AAAGG-------AGCCCA---GAGTAAGAA D_rerio300264 AGA-----------TCAAACAGGAG---------CCGA---TAGCAACAC D_rerio300265 TGG-----------TCAAACAGGAG---------CCAA---TAGCAACAC D_novemcinctus300058 AG------------TCAA--AAAGG-------AGCCTG---GAATGACAC D_novemcinctus300326 GG------------TCAAAAAGA----------GCCCG---GAATGACAG D_novemcinctus300328 GG------------TCAAAAAGAA---------GCCCA---GAGTG--AG D_novemcinctus300367 AG------------TCAAAAAGGA---------GCCCA---AAGTGACAG D_novemcinctus300391 GG------------CCGAAAAGGAG---------CCCA---GAGTGATGG D_novemcinctus300468 AA------------AAAA--AAAGG-------AGCCCA---GAGTGACAG D_novemcinctus300469 GG------------TCAAAAAGGAG---------CCCA---GAGAGAGAG D_novemcinctus300489 GG------------ACAAAAAGGA---------GCCCA---GAGTGA-AG D_novemcinctus300505 GG------------CCAAAAAGGA---------GCCCA---GAGTGACAA D_melanogaster300107 GT------------TCAAAACGAA---------GCCCA---AAGCAAT-- D_melanogaster300108 GT------------TCAAATCGAA---------GCCCA---AAGCAAT-- D_melanogaster300109 GT------------TCAAAAACAATA------AGCCAA---AAGCAAT-- E_telfairi300054 AG------------TCAA-AAAAG--------AGCCCA---CAGTGAGTT E_telfairi300108 AG------------TCAA-AAAAG--------AGCCCA---CATTGAGTT E_telfairi300394 AG------------TCAA-AAAAG--------AGCCCA---CAGTGAGTT E_telfairi300617 AG------------TCAA--AAAAG-------AGCCCA---CAGTGA-GT E_telfairi300643 AG------------TCAA-AAAGG--------AACCCA---GAGTGAATT E_telfairi300711 GG------------CCAA-AAAAG--------AGCCCA---GAGTAACT- E_telfairi300713 AG------------TCAA-AAAAG--------AGCCCA---GGGTGAGTT E_caballus300001 GG------------TCAA-AAAGG--------AGCCCA---AAGTGACAG E_caballus300139 TG------------TCAAAAAGAG----------CCCA---ACGTGACAG E_europaeus300287 GG------------TCAA-AAAGG--------AGCCCA---AAGTGACAT E_europaeus300344 GG------------TCAA-ATAGG--------AGCCCA---AAGTGTCAT E_europaeus300423 GG------------TCAA-AAAGG--------AGCCCA---AAGTGACAT H_sapiens300654 GG------------TCAA-AAAGG--------AGCCCA---GAGTGACAG H_sapiens300677 GG------------TCAAAAAGAAG---------CCAA---GAGTGACAG L_africana300204 AG------------TCAAAAAAAAAAAAAAAGACCCCA---AAGTGGCAG M_mulatta300128 GG------------TCAAAAAGAAG---------CCCA---GAGTCAGTT M_mulatta300217 GG------------TCAA-AAAGG--------AGCCCA---GAGTGACAG M_mulatta300565 GG------------TCAA-AGAGG--------AGCCCA---GAGTGACAG M_mulatta300590 GG------------TCAAAAAGAAG---------CCGA---GAGTGACAG M_mulatta300738 AC-----------------AGACAG---------CCCA---AAGTGACAG M_murinus300083 GG------------TCAAAACGGAG---------CCCA---GAGTGACAG M_murinus300124 GG------------TCAAAAAGGA---------GCCCA---GAGTGACAG M_murinus300238 GG------------TCAAAAAGGAG---------CCCA---GAGTGACAG M_murinus300383 GG------------TCAA-AAAGG--------AGCCCA---GAGTGACAG M_murinus300404 AG------------TCAAGAGAGTG---------CCCA---AAGTGACAG M_murinus300461 GG------------TCAA-AAGGG--------GGCCCA---GAGTGACAG M_murinus300514 TA------------TCAA--AAAGA-------AGCCCA---GAGTGACAG M_domestica300064 AG------------TCAAAAAGGAG---------CCCA---GAGTGACAG M_musculus300015 GG------------TCAAAAATAAG---------CCTC---AAGTAACAG M_musculus300610 GG------------TCAA-AAAGGT-------GGCCCA---GAGAAAGAA M_lucifugus300169 GG------------TCAA-AAAGG--------AGCCCA---GAGTGACAG M_lucifugus300196 GG------------TCAAAAGGA----------GTACA---GAGGGA--G M_lucifugus300270 GG------------TCAA-AAAGG--------AGCCCA---GAGTGACAG M_lucifugus300340 AG------------GCAAAAAAAAA--------GCCCA---GAGGGACAG M_lucifugus300538 GG------------TCAA-AAAGG--------AGCTCA---GAGTGACAG M_lucifugus300913 AAAGAAATTATTTTTTAA-AAAGG--------AGTCCT---TAGTGACAG M_lucifugus300940 GG------------TCAA-AAAGG--------AGCCCA---GAGTGACAG O_cuniculus300329 GG------------TCAA--AAGGG-------AGCCGA---GAGTGACAA O_cuniculus300388 GG------------TCAA-AAAGG--------AACCCA---GAGCGACAG O_cuniculus300489 AG------------TCAGAAGACAG---------CCCA---AAGTGACTT O_garnettii300045 GG------------TCACAAAGAAG---------CCCA---GAGTGACAG O_garnettii300198 GA------------TCAA--AAAGG-------AGCCTA---GAGTGACAG O_garnettii300348 GG------------TCAC--AAGGC-------AGCCCATCGAGGTGACAG O_garnettii300375 GG------------TCAA-AGAGG--------AGCCGA---GAGTGACAG O_garnettii300469 GG------------TCAA--AAAGG-------AGCCTC---ACGTGACAG O_garnettii300518 GG------------TCAA-AGAGG--------AGCCTA---GAGTGACAG O_garnettii300589 AG------------CCAAAAAGGAG---------CTCA---GAGTGACAG O_garnettii300663 GG------------TCAAAAATGGA---------CCCC---AAGTGACAG O_garnettii300747 GG------------TCAA-AGAGG--------AGCC-A---GAGTCACAG P_troglodytes300043 GG------------TCAAAAAGGAG---------CCCA---GAGTCAGTT P_troglodytes300514 GG------------TCAA-AAAGG--------AGCCCA---GAGTGACAG P_troglodytes300536 GG------------TCAAAAAGAAG---------CCGA---GAGTGACAG P_troglodytes300739 AC-----------------AGACAG---------CCCA---AAGTGACAG P_pygmaeus300027 GG------------TCAAAAAGGAG---------CCCA---GAGTCAGTT P_pygmaeus300583 GG------------TCAAAAAGAAG---------CCGA---GAGTGACAG P_pygmaeus300604 GG------------TCAA-AAAGG--------AGCCCA---GAGTGACAG P_pygmaeus300714 AC-----------------AGACAG---------CCCA---AAGTGACAG R_norvegicus300057 GG------------TCAAACACAAG---------TCCC---AAGTAACAG S_cerevisiae300062 ATGGAT--------TCAAAGCGAGG---------CCTAAATTAACGATCA S_araneus300120 GC------------TGGAGAAAAGA-------AGCCCA---GAGTGACAG S_araneus300399 GG------------TCAA--AAAGG-------AACCCA---GAGTGACAA S_araneus300461 GG------------TCAA-AAAGG--------AGCCCA---GAGTGACAG S_araneus300518 GG------------TCAA--CAGAG-------AGCCCA---GAGTGACAG S_tridecemlineatus300186 GG------------TCAA-AAAGG--------AGCCCA---GAGCAGCAG T_nigroviridis300177 CGG-----------TCAAACGGAAG---------CCGA---GACCAACAC T_belangeri300006 GG------------TCAAAGAGGAG---------CTCA---GAGTGACAG T_belangeri300015 GG------------TCAAAGAGGAG---------CCCA---GAGTGA--G T_belangeri300038 GG------------TCAAAGAGGAG---------CCCA---GAGTGA--G T_belangeri300071 GG------------TCAAAGAGGAC---------CCCA---GAGTGA--A T_belangeri300135 GG------------TCAAAGAGGAA---------CCCA---GAGT----- T_belangeri300232 GG------------TCAAAGAGGAG---------C------GAGTGTCAC T_belangeri300277 CG------------TCA--GAGGAG---------CCCG---GAGTGA--G T_belangeri300411 GG------------TCAAAGAGGAG---------CCCA---GAGTGA--G C_familiaris300071 TTTT-CCTTGACGGTCGCCG----------TTCTGTTTG-----ATGTAA C_familiaris300296 TTTT-CCTATTCAACCA----------CTGTTCTGTTGT-----CTGTAA C_porcellus300146 TTTT-CCTTGATGGTTGCCG----------TTCTGTTTG-----CTGTAA C_porcellus300395 TTTT-CCTTGACGGTCGCCG----------TTCTGTTTG-----CTGTAA C_porcellus300728 TTTT-CCTTGACGGTCACCG----------TTCTGTTTG-----CTGTAA C_porcellus300782 TTTT-CCTTGACGGTCGCCG----------TTCTGTTTG-----CTGTAA C_porcellus300865 TTTT-CCTTGACGGTCGCCG----------TTCTGTTTG-----CTGTAA D_rerio300264 TTTT--ACTGACGGTCGCTG----------TGCAGTT-AC----CTGTAG D_rerio300265 TTTT--ACCGACGGTCGCTG----------TACAGTTTGC----TTGTAG D_novemcinctus300058 TTTT-CCATGATGGTCTCCA----------TTCTATTTG-----TTCTAA D_novemcinctus300326 TTTT-CCTTGAGGGTTG----------CTGTTATGTATA-----CTCTAA D_novemcinctus300328 TTTT-CCTTGACGGTCA----------CTATTCTGTTTG-----CTGTAA D_novemcinctus300367 TTTT-CCTTGACCGTCG----------CCAACCCGTTCG-----CTCTAA D_novemcinctus300391 CTTT-CCTTGATGGTCACTG----------TTTCGTTTG-----CTGTCA D_novemcinctus300468 TTTT-CCTTGACGGTCGCTG----------TTCTGTTTG-----CTGTAA D_novemcinctus300469 CCAT---GAAATAAGAA-----------------GCTGG-----GAGCAA D_novemcinctus300489 TTTT-CCTTGGTGGTCG----------CCGTTCTGTTTG-----CTGTAA D_novemcinctus300505 TTTT-CCTTGATGGTGG----------CCATTCTGTTTG-----CTGTAA D_melanogaster300107 TTTTGATACGACGGTCTCTG---------ATTCGACAAA-----TCCCAG D_melanogaster300108 TTTTGATACGACGGTCTCTG---------ATTCGGCATT-----CCACAG D_melanogaster300109 TTTTGTCACGACGGTCTCTG---------ATGCGGCATT-----CCAAAG E_telfairi300054 TTTC-CCTTGATGGTCGCCG----------TTCGGTTTG-----CTGTAA E_telfairi300108 TTTC-C-TTGACAGTCGCCA----------TTCGGTTTG-----CTATAA E_telfairi300394 TTTC-CCTTGACGGTCGCCG----------TTCGGTTAG-----CTGTAA E_telfairi300617 TTTC-CCTTGACGGTCACCG----------TTCAGTTTG-----CTATAA E_telfairi300643 TCTC-C-TTGACGGTTGCCG----------TTCGGTTTG-----CTGTAA E_telfairi300711 TTTT-CCTTTATGGTCACTG----------TTCAGTTTG-----CTGTAA E_telfairi300713 TTCC-C-TTGACGGTCGCCG----------TTCAGTGTG-----CTATAA E_caballus300001 TTTT-CCTCGACGGTCGCCG----------TTCTGTTTG-----CTGTAA E_caballus300139 TTTT-CCTGTACGCCCA----------CTGTTCTGTTGT-----CTGTAA E_europaeus300287 TTTTTCCTTGACAGTCACCA----------TTCTGTTTG-----TTGTAA E_europaeus300344 TTTT-CCTTGATGGTCGCTG----------TTCTGTTTG-----TTATAA E_europaeus300423 TTTT-CCTTGACAGTCGCTA----------TTCTGTTTG-----TTGTAA H_sapiens300654 TTTT-CCTTGACGGTCGCCG----------TTCTGTTTG-----TTGTAA H_sapiens300677 TTTT-CCTTGATGGTCA----------TAGTTCTGTTTG-----CTGTAA L_africana300204 TTGT-CGC-CTTGGCCA----------CTGTTCTGTGAT-----CTGTAA M_mulatta300128 CC----CTTGACCATCA----------CCATTCTGTTTG-----CTATAA M_mulatta300217 TTTT-CCTTGACGGTCGCCG----------TTCTGTTTG-----TTGTAA M_mulatta300565 TTTT-CCTTGATAGTTGTCA----------TTCTGTTTC-----TTGTAA M_mulatta300590 TTTT-CCGTGATGGTCA----------CAGTTCTGTTTG-----CTGTAA M_mulatta300738 TTTT-CCTGTACAGTTA----------CTCTTCTGTTAT-----CTGTAA M_murinus300083 CT----CTTGGCGGTCA----------CCATTCTGTTTG-----CTATAA M_murinus300124 TTTT-CCTTGAGGGTTG----------CCATTTTGTTCG-----CTGTAA M_murinus300238 TTTT-CCCTGATGGTCA----------ACATTCTGGTTT-----TTGTAA M_murinus300383 TTTT-CCTTGACGGTCGCCG----------TTCTGTTTG-----TTGTAA M_murinus300404 TTTT-CCTGTACGGCTATAGC------CTCTTCTGTTAT-----CTGTAA M_murinus300461 TTTT-CCTTGACAGTTGGTG----------TGCCGTTTA-----CAGTAA M_murinus300514 TTTT-CCTCGATGTTTGCCA----------ATCTGTTTG-----CTGTAA M_domestica300064 TTTT--CTCGACGGTCGCTG----------TTCTATTTAATT--CTGTAA M_musculus300015 TTTT-CCTTAACTGCCA----------TGGTTCCGTTTA-----CTGTAA M_musculus300610 TTTT-CCTTGACGGTCGCAG----------TTCTGTTTC-----CTGTAA M_lucifugus300169 TTTT-CATTGACGGTCGCCA----------TTCTGTTTG-----CTGTAA M_lucifugus300196 TTTT-CCTTGGTCGCTG-------------TTCTGTCCA--------TAA M_lucifugus300270 TTTT-CCTTGACGGTCGCCG----------TTCTGTTTG-----CTGTAA M_lucifugus300340 TTTT-CCGTGATGACCA----------ACACTCTGTCTG-----CTGTAA M_lucifugus300538 TTTT-CCTTGACGGTCGCCG----------TTCTGTTTG-----CTGTAA M_lucifugus300913 TTTT-CCTTGATGGTCACCA----------TTCCGATAC-----CTGTAA M_lucifugus300940 TTTT-CCTTGATGGTCGCCG----------TTCTCTTTG-----CTGTAA O_cuniculus300329 TTGT-CCTTGATGGCTGCCT---------------TTCT-----CTATAA O_cuniculus300388 TTTT-CCTTGACGGTCACCG----------TTCTGTTTG-----CTGTAA O_cuniculus300489 TTTC-CCTTTGTGGCTA----------CTCTTCTGTTAT-----CTGTAA O_garnettii300045 TTTT-CCTTGATGGTCA----------CTGTTCTTTTTG-----CTGTAA O_garnettii300198 TTTC-CCTTGACAGTCCCGG----------TTCTGTTTG-----CTATAA O_garnettii300348 TTTC-CCTTGATGGCTGCCG----------TTCTGTTTG-----TGGCTA O_garnettii300375 TTTT-CCTTGACAGTTGCCG----------TTCTGTTTA-----CTGTAA O_garnettii300469 TTTT-CCTTGATGGTCGCCA----------TTCTGTTTG-----CTGTCA O_garnettii300518 TTTT-CCTTGACGGTCGCCG----------TTCTGTTTG-----CTGTAA O_garnettii300589 CCGT-CCCTGGCAGG-A----------ACTCTCTGCTTG-----CCATAA O_garnettii300663 TTGT-CCTTGACAGGCA----------TTGTTCTGTTAG-----CTGT-- O_garnettii300747 TTTT-CCTTGATGGTTGCCG----------TTGTGTTTG-----CTGTGA P_troglodytes300043 TC----CTTGACCATCA----------CCATTCTGTTTG-----CTATAA P_troglodytes300514 TTTT-CCTTGACGGTCGCCG----------TTCTGTTTG-----TTGTAA P_troglodytes300536 TTTT-CCTTGATGGTCG----------TAGTTCTGTTTG-----CTGTAA P_troglodytes300739 TTTT-CCTGTACAGTTA----------CTCTTCTGTTAT-----CTGTAA P_pygmaeus300027 TC----CTTGACCATCA----------CCATTCTGTTTG-----CTATAA P_pygmaeus300583 TTTT-CCTTGATGGTCA----------TAGTTCTGTTTG-----CTGTAA P_pygmaeus300604 TTTT-CCTTGACGGTCGCCG----------TTCTGTTTG-----TTGTAA P_pygmaeus300714 TTTT-CCTGTACAGTTA----------CTCTTCTGTTAT-----CTATAA R_norvegicus300057 TTTT-CCTTAACTGTCA----------TGGTTCCATTTG-----CAGTAA S_cerevisiae300062 TGTCTTTGCTATTATATCAGAGGGCATATCATTGAATTTCCGATTTCCAA S_araneus300120 ATTT-TTTTAATGGTTGTTG----------TTCTGTTTA-----GAGTAG S_araneus300399 CTTT-CCTTGATGGTCACTGATGGCTTTCGTTCAGTTTC-----TAGTAA S_araneus300461 TTTT-CCTTGACGGTCGCCG----------TTCTGTTTG-----TAGTAA S_araneus300518 TTTT-CCTTGA-GGTCCCTG----------GACTATTTC-----TTGTAA S_tridecemlineatus300186 TTTT-CCTTGACGGTCGCCG----------TTCTGTTTG-----CTGTAA T_nigroviridis300177 TTTC--ACCGACGGTCGCTG----------TTCAGTTTTA----AAGTAA T_belangeri300006 GTTT-TCCTCACGGTCGCCT----------TTCGGGTTTG----CTGTAG T_belangeri300015 -TTT-CCCCGACAGTCGCCG----------TCCCACCTG-----CCGTGG T_belangeri300038 -TTT-CCCCGACAGTCGCCG----------TCCGGCCTG-----CCGTGG T_belangeri300071 -TTT-CTCGGAGGGTCGCCG----------TCAGGCCTG-----CCTTGG T_belangeri300135 -TTT-CCCTGGTGGTCGCTG----------TTCTGCTTG-------GTGG T_belangeri300232 TTTC-CTCTGAAGGTCACTG----------TTTGGTTTG-----CGATAG T_belangeri300277 TTTT-CCCCAACTGCCGCCA----------TTGGGCTTG-----CTATGG T_belangeri300411 -TTT-CCCCGACCGTCACCG----------TCCGGCCTGGCCTGCCGTGG C_familiaris300071 CTGATC---TGCAACA----TTTCAGGAAAAGACAGTT------------ C_familiaris300296 CTGACT---TATGACA----TGTTGG-AAAACACAGCT------------ C_porcellus300146 CTGATC---TGCAACA----TTTTGGGGAAAGACAGTT------------ C_porcellus300395 CCGATC---TGCAGCA----TTTTGGGGAAAGACAGTT------------ C_porcellus300728 CTGATC---TGCAACA----TTTTGGAGAAAAGACAGTT----------- C_porcellus300782 CCGATC---TGCAACA----TTTTGGGGAGAGAGCCAC------------ C_porcellus300865 CCGATC---TGCAAC----ATTCTGGGGAAAGACAGTT------------ D_rerio300264 CTGTTTC--AGCAACA----TTTAGGAAAAGGACAATT------------ D_rerio300265 CTGTCCC--AGCAACA----TTAAGGAAAAGGACAACT------------ D_novemcinctus300058 CTGATC---TGCAGTA----TTTCAAGAAAAGACAACT------------ D_novemcinctus300326 CTGATC---TGCAACA----TTTCGGAAAAAGACAGTT------------ D_novemcinctus300328 CTGATC---TGCAACAA---TTTCAGGAAAAGAAGTTT------------ D_novemcinctus300367 CTGATC---TGCAACA----TTTTGGGAAAAGACAGTT------------ D_novemcinctus300391 CTGATC---TGCAAAG----TTTCGGAAAAGGAGAGTT------------ D_novemcinctus300468 CTTATC---TGCAACG---ATTTCGGGAAAAGACAGTT------------ D_novemcinctus300469 TGAAACC--CAGAAGA-----GAAGGGAGAAACCAGCA------------ D_novemcinctus300489 CTGATC---T--AACA----TTTCAGGAAAAGCCAGTT------------ D_novemcinctus300505 CTGGTC---TGCAACA----TTTAGGGAAAAGACAGTT------------ D_melanogaster300107 TTGATTC--AGTAACT---TTTACGTGCAATTACAAAA------------ D_melanogaster300108 TCGTCTG--AGTAACT---TTTACGTGCAATTACAATG------------ D_melanogaster300109 TCGCTTC--AGTAACT---TTTACGTGCAATGACAGTC------------ E_telfairi300054 CCGATC---TGCAACA----TTTCGGGAAAAGACATTG------------ E_telfairi300108 CCGATC---TGCTACA----TTTCAGGAAAAGAAATTC------------ E_telfairi300394 CCGATC---TGCAGCA----TTTCAGGAAAAGACATTG------------ E_telfairi300617 CTGATC---AGGAAAAGACATTTCAGGAAAAGACATTC------------ E_telfairi300643 CCGAGC---TGCAACA----TTTCAGGAAAAGACATTT------------ E_telfairi300711 CCGATC---TGCAACA----TTTCAGGAAA-GACTATT------------ E_telfairi300713 CCAACC---TGCAACA----TTTCAGGAAAAGACATTT------------ E_caballus300001 CTGATC---TGCAACA----TTTCAGGAAAAGACAATT------------ E_caballus300139 TTGATT---TATGACA----TTTTGGGAAAACACAGCG------------ E_europaeus300287 CAGTTC---TGAAACA----TTTCAGGAAAAGACAGTT------------ E_europaeus300344 CAGTTT---TGCAACA----TTTTAGGAAAAGACAATT------------ E_europaeus300423 CAGTTG---TGCAACA----TTTCAGGAAAAGACAGTT------------ H_sapiens300654 CTGATC---TGCAACA----TTTTGGGAAAATACAGTT------------ H_sapiens300677 CTGATC---TGCAAGA----TTTTGGGAAAATACCATT------------ L_africana300204 CTGATT---TGTGACA----TTTTGGGAAAAGACAGCT------------ M_mulatta300128 CTGATC---TGTAACA----TTTTGGGAAAATACAGTT------------ M_mulatta300217 CTGATC---TGCAACA----TTTTGGGAAAATACAGTT------------ M_mulatta300565 CTCATC---TGCAACA----TTTTGGGAAGATACAGTT------------ M_mulatta300590 CTGATC---TGCAACA----TTTTGGGAAAATATAGTT------------ M_mulatta300738 CTGATC---TATGACA----TTTTGGGAAAAGACAGCC------------ M_murinus300083 CCGATC---TATGATG----TTTTGGGAAAATACAGTT------------ M_murinus300124 CTGATC---TGCAACA----TTTCGGGAAAATACAGTT------------ M_murinus300238 CTGATT---TGCAACA----TTTTGGGAAAGTACAGTT------------ M_murinus300383 CTGATC---TGCAACA----TTTTGGGAAAATACAGTT------------ M_murinus300404 CTAATC---TACAACA----TTTTGGGAAAAGATAGCT------------ M_murinus300461 CTGATCCGCTGCAACA----TTTTGGGAAAATACAGTT------------ M_murinus300514 AAGATC---TGTAACA---TTTTAGGAATATATCAAA------------- M_domestica300064 TAGAAC---CGCAACA----TTGTGGGAAAAGACAAGC------------ M_musculus300015 CACATC---T--AAGA----TTCTAGGGAAAGACAGGT------------ M_musculus300610 CTGATC---TGCAACA----TTGTGGAAAATGACAGCT------------ M_lucifugus300169 CCGATC---TGCAACA----TTTCAGGAAAAGACAATT------------ M_lucifugus300196 CTGATC---TGCAACA----TTTCAGGAAAA--CAGTT------------ M_lucifugus300270 CCGATC---TGCAACA----TTTCAGGAAAAGACAATT------------ M_lucifugus300340 CTGATC---TGCAACA----TTTCAGGAAAATACAGTT------------ M_lucifugus300538 CTGATC---TGCAACA----TTTCAGGAAAAGACAATT------------ M_lucifugus300913 CAGATC---TGCCACA----TTTTGGGAAAAGACAGTT------------ M_lucifugus300940 CCGATC---TGCAACA----TTTCAGGAAAAGACAATT------------ O_cuniculus300329 CTGATC---TGCAACA----TGTCAGGAAAAGACAGTC------------ O_cuniculus300388 CCGATC---TGCAACA----TTTCAGGAAAAGACAGTC------------ O_cuniculus300489 CCAATC---TGTGACA----TTCTGGGGAAAGAGAGCT------------ O_garnettii300045 CTGATA---TGCAGCA----TTTTAGGGAAACACAGTT------------ O_garnettii300198 CCGATC---TCCAACA----TTTTAGGAAAATGCAGTT------------ O_garnettii300348 CTGATC---TGCAACA---TTTTGGGGAAAATACAGT------------- O_garnettii300375 CTGATC---TGCAACA----TTTTGGGAAAATACAGTT------------ O_garnettii300469 CTGATC---TGCAACA---TTTTGGGAAAACACAGTG------------- O_garnettii300518 CTGATC---TGCAACA----TTTTGGGAAAATACAGTT------------ O_garnettii300589 TGGATC---TGCAGTA----TTTTGAGGAAACACTGTT------------ O_garnettii300663 ---------TATAACA----TTTTGGGAAAATACAGTT------------ O_garnettii300747 CTGATC---TGCAGCA----TTTTGGGAAAATACAGTT------------ P_troglodytes300043 GTGATC---TGTAACA----TTTTGCGAAAATACAGTT------------ P_troglodytes300514 CTGATC---TGCAACA----TTTTGGGAAAATACAGTT------------ P_troglodytes300536 CTGATC---TGCAAGA----TTTTGGGAAAATATCGTT------------ P_troglodytes300739 CTGATC---TATGACA----TTTTGGGAAAAGACAGCC------------ P_pygmaeus300027 CTGATC---TGTAACA----TTTTGCAAAAATACAGTT------------ P_pygmaeus300583 CTGATC---TGCAACA----TTTTGGGAAAATATCGTT------------ P_pygmaeus300604 CTGATC---TGCAACA----TTTTGGGAAAATACAGTT------------ P_pygmaeus300714 CTGATC---TATGACA----TTTTGGGAAAAGACAGCC------------ R_norvegicus300057 CACATC---TGTAAGA----TTTTGAGAAAAGACAGTT------------ S_cerevisiae300062 AGGGAAGAAAATAAATAAAGTTGTGCTATTTCCATGCATCCTTTTTTCTT S_araneus300120 TTGATC---TGCAGCA---TTTTGGGAAAAG-ACGGTC------------ S_araneus300399 CTGAT----TGCAGCA---TTTCAGGAGAAG-ACAGGT------------ S_araneus300461 CTGATC---TGCAACA----TTTCGGGAAAAGACAGTT------------ S_araneus300518 GTAACC---TGAGACA----CCTCAGGAAAAGACAGCA------------ S_tridecemlineatus300186 CTGATC---TGCAACA----TTTTGGGAAAAGACAACT------------ T_nigroviridis300177 CTGCTTC--AGCAACA----TCTAGGGGAAGGACACCT------------ T_belangeri300006 CAGGTC---TGCAACA----TTGCAGGGAAAGACAGCC------------ T_belangeri300015 CCGGTC---TGCAACA----TTGTGGGGAAAGACAGCC------------ T_belangeri300038 CCGGTC---TGCAACA----TTGTGGGGAAAGACAGCC------------ T_belangeri300071 CAGGTC---TGCAACA----TTGTGGGGAAAGACAGCT------------ T_belangeri300135 CCGGTC---TACAGCA----TTGTGGGGAAAGACAGGC------------ T_belangeri300232 CTGATC---TGTAACA----TTGAGGGTAAAGACAGAA------------ T_belangeri300277 CCGGTC---TGCAACA----TTGTGGGGAAAGTGCCAT------------ T_belangeri300411 CTGGTC---TGCAACA----TTGTGGGGAAAGACAGCC------------ C_familiaris300071 ------------------ C_familiaris300296 ------------------ C_porcellus300146 ------------------ C_porcellus300395 ------------------ C_porcellus300728 ------------------ C_porcellus300782 ------------------ C_porcellus300865 ------------------ D_rerio300264 ------------------ D_rerio300265 ------------------ D_novemcinctus300058 ------------------ D_novemcinctus300326 ------------------ D_novemcinctus300328 ------------------ D_novemcinctus300367 ------------------ D_novemcinctus300391 ------------------ D_novemcinctus300468 ------------------ D_novemcinctus300469 ------------------ D_novemcinctus300489 ------------------ D_novemcinctus300505 ------------------ D_melanogaster300107 ------------------ D_melanogaster300108 ------------------ D_melanogaster300109 ------------------ E_telfairi300054 ------------------ E_telfairi300108 ------------------ E_telfairi300394 ------------------ E_telfairi300617 ------------------ E_telfairi300643 ------------------ E_telfairi300711 ------------------ E_telfairi300713 ------------------ E_caballus300001 ------------------ E_caballus300139 ------------------ E_europaeus300287 ------------------ E_europaeus300344 ------------------ E_europaeus300423 ------------------ H_sapiens300654 ------------------ H_sapiens300677 ------------------ L_africana300204 ------------------ M_mulatta300128 ------------------ M_mulatta300217 ------------------ M_mulatta300565 ------------------ M_mulatta300590 ------------------ M_mulatta300738 ------------------ M_murinus300083 ------------------ M_murinus300124 ------------------ M_murinus300238 ------------------ M_murinus300383 ------------------ M_murinus300404 ------------------ M_murinus300461 ------------------ M_murinus300514 ------------------ M_domestica300064 ------------------ M_musculus300015 ------------------ M_musculus300610 ------------------ M_lucifugus300169 ------------------ M_lucifugus300196 ------------------ M_lucifugus300270 ------------------ M_lucifugus300340 ------------------ M_lucifugus300538 ------------------ M_lucifugus300913 ------------------ M_lucifugus300940 ------------------ O_cuniculus300329 ------------------ O_cuniculus300388 ------------------ O_cuniculus300489 ------------------ O_garnettii300045 ------------------ O_garnettii300198 ------------------ O_garnettii300348 ------------------ O_garnettii300375 ------------------ O_garnettii300469 ------------------ O_garnettii300518 ------------------ O_garnettii300589 ------------------ O_garnettii300663 ------------------ O_garnettii300747 ------------------ P_troglodytes300043 ------------------ P_troglodytes300514 ------------------ P_troglodytes300536 ------------------ P_troglodytes300739 ------------------ P_pygmaeus300027 ------------------ P_pygmaeus300583 ------------------ P_pygmaeus300604 ------------------ P_pygmaeus300714 ------------------ R_norvegicus300057 ------------------ S_cerevisiae300062 TCATTCAATGACACATAC S_araneus300120 ------------------ S_araneus300399 ------------------ S_araneus300461 ------------------ S_araneus300518 ------------------ S_tridecemlineatus300186 ------------------ T_nigroviridis300177 ------------------ T_belangeri300006 ------------------ T_belangeri300015 ------------------ T_belangeri300038 ------------------ T_belangeri300071 ------------------ T_belangeri300135 ------------------ T_belangeri300232 ------------------ T_belangeri300277 ------------------ T_belangeri300411 ------------------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved