snOPY snoRNA Orthological Gene Database

Family: SNORA15

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300119 ---GCATGGCCAAATACTGTGTTCTTTTTT---ATCAGTTGTTTACATAG C_familiaris300386 ---GCATGGCTGAATACTGTGTTC-TTTTT---ATCAGTAGTTTACACAG C_porcellus300867 ---GCATGGCTGAATACTGTGTTCTTTAA-----TCAGTAGTTTACACAG D_novemcinctus300115 ---TCATGGCTGAATACTGTGTTC-TTTT----ATCAGTAGTTTACACAG D_novemcinctus300244 ---GCATAGCCGAATACTGTGTTC-TTTT----ATCAGTAGTTTACACAG D_melanogaster300093 TTGGCAGAACTTAATTCCGGACCTGGTACACCTTCGGGTGCTAAGTGCGG E_telfairi300002 ---GCATGGCCGAATACTGTGTT--TTTTT---ATCCGTAATCTACACAG E_telfairi300284 ---GGATGGCCGAATACTGTGTT--TTTTT---ATCTGTAATCTACACAG E_telfairi300545 ---GCATGGCCGAATACTGTGTT--TTTTT---ATCCGTAATCTACACAG E_telfairi300629 ---GCATGGCTGAATCCTGTGTT--TTT-----ATCCATAATCTACACAG E_telfairi300805 ---GCATGGCCGAATACTGTGTT--TTTTT---ATCCGTAATCTACACAG E_caballus300179 ---GCATGGCTGAAT-CTGTGCTC-TTTTT---ATCAGTATTTTACACAG E_caballus300379 ---GCATGGCTGAATACTGTGTT--TTTTT---ATCAGTAGTTTACACAG E_europaeus300676 ---GCATGGCTGAATACTGTGTTCTTTTGA----TCAGTAGTTTACACAG E_europaeus300677 ---GCATGGCTGAATACTGTGTTCTTTTGA----TCAGTAGTTTACACAG G_gallus300123 ---GCATGGACGAATTCTGCTATAGCTTTC---TTCAGTAGCTATTGCAG G_gorilla300375 ------TCAAAGCTGATTTTGAA--ACTGA---AAAAAAAAA-----TCG H_sapiens300422 ---GCATGGCTGAATACTGTGTT--CTTTT---ATCAGTAGTTTACACAG H_sapiens300624 ---GCATGGCCGAATACTGTGTT----TTT---ATCAGTAGTTTACACAG H_sapiens300680 -----------GCTGATTTTGAA--ACTTA---AAAAAAAAA-----TCG H_sapiens300128 ---GCATGGCTGAATACTGTGTT--CTTTT---ATCAGTAGTTTACACAG L_africana300467 ---GCATGGCTGAATACTGTGTTC-TTTTT---ATCAGTAATTTGCACAG L_africana300508 ---GCACCGCCGAATACTGTGTTC-TTTTT---ATCAATAGTTTACACAG M_mulatta300386 ---GCATGGCTGAATACTGTGTT--GTTTT---ATCAGTAGTTTACACAG M_mulatta300392 -----------GCTGATTTTGAA--TGTTA---AAAAAAAAAAAAAATCA M_mulatta300705 ---GCATGGCCGAATACTGTGTT--CTTTT---ATCAGTAGTTTACACAG M_murinus300267 ---GCATGGCTGAATACTGTGTT--CTTTT---ATCAATAGTTTACACAG M_domestica300098 ---GCATGGATGAATACTGTGTT-TTCTTT---GTCGGTAGTTAACACAG M_lucifugus300367 ---GCATGGCTGAATACTGTGTTC-TTTTT---GTCAGTAGCTTACACAG M_lucifugus300665 ---GCATGGCTGAATACTGTGTTC-TTTTT---GTCAGTAGCTTACACAG M_lucifugus300949 ---GCATGGCTGAATACTGTGTTC-TTTTT---GTCAGTAGCTTACACAG O_cuniculus300327 ---GCATGGCTGAATACTGTGTTCTTTTG-----TCAGTAGTTTACACAG O_cuniculus300381 ---GCATGATTGAATACTGTGTTCTTTTG-----TCAGTAGTTTACACAG O_garnettii300239 ---GCATAGCTGAATACTATGTT--CTTTT---ATCAGTAGTTTACATAG O_garnettii300302 ---GCATGGCTGAATACTGTGTT--CTTTC---ATCAGTAGTTTACACAG O_garnettii300347 ---GCATGGCTGAATACTGTGTT--CTTTT---ATTGGTAGATTACACAG O_garnettii300466 ----------------------A--CATTG---AAAAGGGTGAC--CCAG O_garnettii300662 ---GCATGGCTGAATACTGTGTT--CTTTT---ATTGGTAGATTACACAG O_garnettii300225 ---GCAAGGCTGAATATTGTGTT--CCTTC---ATCAGTAGTTTACACAG P_troglodytes300390 ---GCATGGCTGAATACTGTGTT--CTTTT---ATCAGTAGTTTACACAG P_troglodytes300393 -----------GCTGATTTTGAA--ACTTA---AAAAAAAAA-----TCG P_troglodytes300547 ---GCATGGCCAAATACTGTGTT----TTT---ATCAGTAGTTTACACAG P_troglodytes300059 ---GCATGGCTGAATACTGTGTT--CTTTT---ATCAGTAGTTTACACAG P_pygmaeus300143 -----------GCCGATTTTGAA--ACTTA---AAAAAAAAAA----TCA P_pygmaeus300216 ---GCATGGCCGAATACTGTGTT--CTTTT---ATCAGTAGTTTACACAG P_pygmaeus300245 ---GCATGGCTGAATACTGTGTT--CTTTT---ATCAGTAGTTCACACAG R_norvegicus300181 ----------------------GCCTGGG-----CTACACATTTAAA--G R_norvegicus300261 ---GCATGGCTGAATACTGTGTTCTTTAG-----TCAGTAATTTACATAG R_norvegicus300276 ---GCATGGCTGAATGCTGTGTTCTTTAG-----TCAGTAATTGACACAG R_norvegicus300405 ---GGATGGCTGAATGCCATGGACTTCTG-----TCAGTAATGCACATAG R_norvegicus300492 ------GCCTGGCCTACTGTGTTCTTCAG-----TCAGTAGTTTACACAG R_norvegicus300519 ---GCATGGCTGAATACTGTGTTCTTCAG-----TCAGTAATTTACACAG R_norvegicus300632 ----GCACGCTGAATACTGTGTTCTTCAG-----TCAGTAATTTACA--G R_norvegicus300785 -------GCCTGAATACTGTGTTTTTTAG-----TCAGTAATTTACACAG R_norvegicus300920 ---GCATGGCTGAATACTGTGTTCTTTAG-----TCAATAATTTACACAG R_norvegicus300996 ------GCCTGGCCTACTGTGTTCTTCAG-----TCAGTAATTTACACAG R_norvegicus301023 ---GCATGGCTGAATACTGTGTTCTTTAG-----TCAGTAATTTACACAG R_norvegicus300965 ---GCATGGCTGAATACTGTGTTCTTTAG-----TCCCTAATTTACACAG S_araneus300234 ---GCGTGACTGAATGCTGTGTTCTTTTT----ATCAATATTTTACACAT S_araneus300293 ---GCATGGCTGAATACTGTATCCTTTTTG----CCAATATTTTTCACAG S_araneus300430 ------TGGGTGAATACTATGTTCTTTTT------CAACGTTTCACACAG S_araneus300436 ---GCATGGCTGAATACTGTGTTCTTTTTTT--ACCAATATTTTACACAG S_araneus300501 ---GTGTGGATGACTACTGTGCTCTTTGTA----TCAATATTTTACACAG S_araneus300564 ---GTTTGGCTAAATACAGTGTTGTTTTTA---ATCAATATTTTACACAG S_araneus300674 ---GCATGGCTGAATACTGTGTTCTTTTT----ATCAATATTTTGCATGC S_araneus301052 ---GCATGGCTGAATACTGTGTTCTTTTT----ATCAATATTTTACACAG S_araneus300544 ---GTTTAGCTAAATACAGTGTTGTTTTTA---ATCAATATTTTACACAG S_tridecemlineatus300201 ---GCATGGCTGAATACTGTGTACTTTAG-----TCAGTATTTTACACAG S_tridecemlineatus300300 ---GCATGGCTGAATACTGTGTACTTTAG-----TCAGTATTTTACACAG T_nigroviridis300070 ---GCATGGCTGAATTCTGTTCCAGCTGCG-----GAGTGGTGGATACAG T_belangeri300113 ---GCATGGCTGAATGCTGTCTTCTTTTA-----TCAGTAGTTTACAGAG C_familiaris300119 CCAGACATCATGCAAAAAAAATAAGAAATAAAGCATTCTTC-CCTATAGA C_familiaris300386 CCAGACACCATGCAAAAG-------------TAAAGTGTTC-CCTTTAAA C_porcellus300867 CCAGACACCATGCAAAAG-------------TAAAAACTTCCTTTTAAAA D_novemcinctus300115 CCAAACACCATGCAAA-------------AATATAGTCTTC-TCTTCAAA D_novemcinctus300244 CCAGACACCATGCAAA-------------AATGTAGTCTTC-CCTTTAAA D_melanogaster300093 CCAGACATTTTGCCAGAA-------------CAAATTCCAGGCATTGTCG E_telfairi300002 CCAGACACCAGGCCAT-------------AGTATCATTTC--CCTTTAAC E_telfairi300284 C-AGACACCATGCCAT-------------AGTACCGTTTC--CCTTTAAC E_telfairi300545 CCAGACACCATGCCAC-------------AGTATTATTCC--CCTTTAAC E_telfairi300629 CCAGACACCATGCCACCC-----------AGCACCGTTTC--C-TTTAAT E_telfairi300805 CCAGACACCATGCCAT-------------AGTATCATTTC--CCTTTAAC E_caballus300179 CCAGACACCACGCAGTAAAA---------AGAGCAGTCTTA-CCTTTAAA E_caballus300379 CCAGACACCATGCAAAAG---------------TAAAGTCTTCTTTTAAA E_europaeus300676 CCAGACACCATGCAAAAG-------------TAAAGTTTTCCCTAATGCA E_europaeus300677 CCAGACACCATGCAAAAG-------------TAAAGTTTTCTCTCTGCAG G_gallus300123 TCAGACACTATGCCAGATT--------------CAATTCCCGTTTTACAC G_gorilla300375 CCAGGTACCATGCAAAAG---------------CAATCTTCCCTTTAGAA H_sapiens300422 CCAGACACCATGCAAAAG---------------CAGTCTTC-CCTTTAGA H_sapiens300624 CCAGACACCATGCAAAAG---------------CAGTCTTC-CCTTTAGA H_sapiens300680 CCAGGTACCATGCAAAAG---------------CAATCTTCCCTTTAGAA H_sapiens300128 CCAGACACCATGCAAAAG---------------CAGTCTTC-CCTTTAGA L_africana300467 CCAGACACCATGCAAA-------------AGTATCATCTTC-CCTTTAAA L_africana300508 CCAGACACCGTGCAAA-------------AGTACAGTCTTC-TCTTTTAG M_mulatta300386 CCAGACACCATGCAAAAG---------------CAGTCTTC-CCTTTAGA M_mulatta300392 CGAGGTGCCATGCAAAAG---------------CAATCTTCCCTTCAGAA M_mulatta300705 CCAGACACCATGCAAAAG---------------CAGTCTTC-CCTTTGGA M_murinus300267 CCAGACACCATGCAAAAG---------------CAGTCTTCCCTTTAAAA M_domestica300098 CCAGACACCATGCAAAAGTA-------------CATTCTCCTCCTTTGAA M_lucifugus300367 CCAGACACCATGCAAAAG---------------TAGTCT-TCCCTTTAAA M_lucifugus300665 CCAGACACCATGCAAAAG---------------TAGTCT-TCCCTTTAAA M_lucifugus300949 CCAGACACCATGCAAAAG---------------TAGTCT-TCCCTTTAAA O_cuniculus300327 CCAGACACCATGCAAAAG-------------TAAAAGCTTCCCTTGGAAA O_cuniculus300381 CCAGACACCATGCAAAAG-------------TAGT--CTTCCCTTGGAAA O_garnettii300239 CTAGACACCATGCAAAAA---------------CAGTCTTCCCTTTTAAA O_garnettii300302 CCAGACACCATGCAAAAG---------------CAGTCCTCCCTTTTAAA O_garnettii300347 CCAGACACCATGCAAAAG---------------CAGTCTTCCCTTTTAAA O_garnettii300466 CCAGACACCATGCAAAAG---------------CAGTCTTCCCTTTTAAA O_garnettii300662 CCAGACACCATGCAAAAG---------------CAGTCTTCCCTTTTAAA O_garnettii300225 CCAGACACCATGCAAAAG---------------CAGACTTCCCTTTAAAA P_troglodytes300390 CCAGACACCATGCAAAAG---------------CAGTCTTC-CCTTTAGA P_troglodytes300393 CCAGGTACCATGCAAAAG---------------CAATCTTCCCTTTAGAA P_troglodytes300547 CCAGACACCATGCAAAAG---------------CAGTCTTC-CCTTTAGA P_troglodytes300059 CCAGACACCATGCAAAAG---------------CAGTCTTC-CCTTTAGA P_pygmaeus300143 CCAGGTACCATGCAAAAG---------------CAATCTTCCCTTTAGAA P_pygmaeus300216 CCAGACACCATGCAAAAG---------------CAGTCTTC-CCTTCAGA P_pygmaeus300245 CCAGACACCATGCAGAAG---------------CAGTCTTC-CCTTTAGA R_norvegicus300181 CCAGACACCATGCAAAAG-------------TAAAGTCTTCC-TTTAAGA R_norvegicus300261 CCAGACACCATGCAAGAG-------------TAAAGTCTTCC-TTTAAGA R_norvegicus300276 CCAGACACCATGCAAAAG-------------TAAAGTCTTCC-TTTAAGA R_norvegicus300405 CCAGACACCAGGCAAAAG-------------CGGAGTCTTCC-TCTAAGG R_norvegicus300492 CCAGACACCATGCAAGAG-------------TAAGGTCTTCC-TTTAAGA R_norvegicus300519 CCAAACACCATGCAAAAG-------------TAAAGTCTTCC-TTTAAGA R_norvegicus300632 CCAGACACCATGCAAAAG-------------TAAAGTCTTCC-TTTAAGA R_norvegicus300785 CCAGACACCATGCAAAAG-------------TAAAGGCTTCC-TTTAAGA R_norvegicus300920 CCAGACACCATGCAAGAG-------------TAAAGTCTTCC-TTTAAGA R_norvegicus300996 CCAGACACCATGCAAAAG-------------TAAGGTCTTCC-TTTAAGA R_norvegicus301023 CCAGACACCATGCAAAAG-------------TAAAGGCTTCCGTTTTAGA R_norvegicus300965 CCAGACACCATGCAATAG-------------TAAAGGCTTCC-TTTAAGA S_araneus300234 TCAGACACGGTGCAAAAG-------------TAAAGTTTTCC-CTTGAAA S_araneus300293 CCAGACACCATTTAAAAG-------------TAG--TTTTCC-CTTGAAA S_araneus300430 CCAGACACCACACAAAAA-------------GAAAATTTTCC-TTTGAGA S_araneus300436 CCAGACACCGTGCAAAAA-------------TAAAGTTCTTC-TTTGAAA S_araneus300501 CCAGATACCACGCAAAAG-------------CAAGGTTTTCC-CTTGAAC S_araneus300564 CTAGACACCATGCAAAAG-------------TAA--TTTTCT-TTTGAAA S_araneus300674 -CAGAAACCATGCAAAAG-------------TAAAGTTTTCC-CTTCAAA S_araneus301052 CCAGACACCATGCAAAAG-------------TAAAGTTTTCC-CTTGAAA S_araneus300544 CAAGACACCATGCAAAAG-------------TAA--TTTTCT-TTTGAAA S_tridecemlineatus300201 CCAGACACCATGCAAAAGT------------AAAAGTCTTCCTTTTATAA S_tridecemlineatus300300 CCAGACACCATGCAAAAGT------------AAA-GTCTTCCTTTTATAA T_nigroviridis300070 TCAGACACCATGCCAGAG-------------CGGGGCCTCCTTTCTGCTC T_belangeri300113 TCAGATAGCATGTAAAAG-------------TAACATCTTCCCTCTGAAG * C_familiaris300119 GTGGTTACCATG-GCATGCTAAGC--TTTTCCAT------ATCATT--AT C_familiaris300386 ATGCCTCTAATG-GTGTGCTAAGC--TTTTTCAT-AGCATATCATT--TT C_porcellus300867 TGACAATGATAT-----GCTGT-----TTTTTCATGGTGTATCATT--AT D_novemcinctus300115 ACTGTTATGCTG-GTATGCT--GT--TTTCTTCACAGCATATTATT--AT D_novemcinctus300244 ATTGTTATGATG-GTATGCTAAGT--CTTCTTCATAGCATATCGTT--AT D_melanogaster300093 TCTTCAGCAGTTGCCTCAGTGTGG-CCTCTGTCTGAACATGGCACT--GT E_telfairi300002 GTACTTCCGGTG----TGCTGTGT--CTTCTTCATGGCATATCATC--TG E_telfairi300284 GTACTTCCGGTG----TGCTGTGT--CTTCTTCATGGCATATCATC--TG E_telfairi300545 GTACTTCCAGTG----TGCTGCGT--CTTCTTCATGGCATATCATC--TG E_telfairi300629 GTACTCGCGGTG----TGCTGTGT--CTTCTTCATGGCGTATCATC--TG E_telfairi300805 GTACTTCCGGTG----TGCTGTGT--CTTCTTCGTGGCATATCATC--TG E_caballus300179 GTGGTTATGATG-GTATGCTAAGT--TTTTTTCATAGCATATCAGT--AA E_caballus300379 ATAACTATGATG-TTATGCTATGT--TTTTT-AT-AGCATATCATT--AT E_europaeus300676 GTGACTTTGGT----ATGCTAAGA----TTTGTGTGGCATCCTCAACTGT E_europaeus300677 TGACTTTGG-----TATGCTAAGA----TTTGTGTGGCATGTCATC-TGT G_gallus300123 TCTGGC---------ATGCTTTTTATATGTGAGTGGGCATGCCCTT---- G_gorilla300375 -TGACT--GATG-GTATGCTAAGG--TTTTTCAT-GGCATATTATT--AT H_sapiens300422 ATGACT--GATG-GTATGCTAAGG--TTTTTCAT-AGCATATCATT--AT H_sapiens300624 ATGACT--GATG-GTATGCTAAGG--TTTTTCAT-AGCATATCATT--AT H_sapiens300680 -TGACT--GATG-GTATGCTAAGG--TTTTTCGT-GGCATATTATT--AT H_sapiens300128 ATGACT--GATG-GTATGCTAAGG--TTTTTCAT-AGCATATCATT--AT L_africana300467 ATGTTTATGATG--TATGCTAACT--TTTTCTCATGGCATATCATT--AT L_africana300508 GCAGTTATGGTG-GCATGCTGAGT--TTTTTCCATACCATGTCATT--AT M_mulatta300386 ATGACT--GATG-GTATGCTAAGG--TTTTTCAT-AGCGTATCATT--AT M_mulatta300392 -TGACT--GATG-GTATGCTCAGG--TTTTTCAT-AGCATATCATC--AT M_mulatta300705 ATGACC--AATG-GTATGCTAAGG--TTTTTCAT-AGCATATCATT--AT M_murinus300267 -TGACT--GATG-ATATGCTAAGT--TTTTCCAT-AGCATATCATT--AT M_domestica300098 ATGGTCTTAATG-GTATGCTAAGA--ATTGCCATCAGCATGCTATT--AC M_lucifugus300367 ATGGCTATGATG-GTATGCCACGT--TTTTTCAT-AGCATATCATT--AC M_lucifugus300665 ATGGCTATGATG-GTATGCCAAGT--TTTTTCAT-AGCATATCATT--AC M_lucifugus300949 ATGGCTATGATG-GTATGCCAAGT--TTTTTCAT-AGCATATCATT--AC O_cuniculus300327 TCATTTTGG-----TATGCTGAG----TTTTTCTTAGCATATCATT--AT O_cuniculus300381 TCATTTTGG-----TATGCTGAG----TTTTTCTAAGCATATCATT--AT O_garnettii300239 ATGACT--GATA-ATATGCTAAGT--TATTTCAT-GGTATATCAT--TAT O_garnettii300302 -TGACT--GATG-ATATGCTAAGT--TATTTCAT-AGCATATCAC--TGT O_garnettii300347 -TGACT--GAT----ATGCTAAGT--TATTTCAT-AGCATATCATTTTGT O_garnettii300466 -TGACT--GAT----ATGCTAAGT--TATTTCAT-AGCATATCATTTTGT O_garnettii300662 -TGACT--GAT----ATGCTAAGT--TATTTCAT-AGCATATCATTTTGT O_garnettii300225 -----T--GATG-ATATGCTAAGA--TGTTTCCT-AGCATATCAT--TAT P_troglodytes300390 ATGACT--GATG-GTATGCTAAGG--TTTTTCAT-AGCATATCATT--AT P_troglodytes300393 -TGACT--GATG-GTATGCTAAGG--TTTTTCGT-GGCATATTATT--AT P_troglodytes300547 ATGACT--GATG-GTATGCTAAGG--TTTTTCAT-AGCATATCATT--AT P_troglodytes300059 ATGACT--GATG-GTATGCTAAGG--TTTTTCAT-AGCATATCATT--AT P_pygmaeus300143 -TGACT--GATG-GTATGCTAACG--TTTTTCAT-GGCATATTATT--AT P_pygmaeus300216 ATGACT--GATG-GTATGCTAAGG--TTTTTCAT-AGCATATCATT--GT P_pygmaeus300245 ATGACT--GATG-GTATGCTAAGG--TTTTTCAT-AGCATATCATT--AT R_norvegicus300181 TGGCTGAT-------ATGCTAT------ATTTTATGGTATATCATT--AT R_norvegicus300261 TGGCTGCT-------ATGCTGT------ATTTTATGGTATATCATT--A- R_norvegicus300276 TGGCTGAT-------ATTCTAT------ATTTTATGGTATATGATC--AT R_norvegicus300405 CGACTGGC-------ACACTGT------TTTCTAAGGTATATCGCT--AC R_norvegicus300492 TGGCCGAT-------ATGCTGT------ATTTTATGGTATGTCATC--AT R_norvegicus300519 TGGCTGGT-------ATGCTAT------ACTTTATGGTATATCATC--AT R_norvegicus300632 TGGTTGAT-------ATGCTGT------AGTTTATGGTATATCACC--AT R_norvegicus300785 TGGCTGATC------ACGCTAT------ATTTTATGGTATATCATT--AT R_norvegicus300920 TGACCGAT-------ATGCTGT------AGTTTATGGTATATCACC--AT R_norvegicus300996 TGGCCGAT-------ATGCTAT------ATTTTATGGTATGTCATC--GT R_norvegicus301023 TGGCTGAT-------ATGCTAT------TTTGTATGGTATATCATT--AT R_norvegicus300965 TGGTCGAT-------GTGCTAT------ATTTTATGGTATATCATT--AT S_araneus300234 TGGCTTTTGATG-GTATGCTGC----TTTTCT-GTGGCATATCATT--AT S_araneus300293 TGGCTCTCAATG-GTATGCTGC----TTTTCT-ATGGCATATCATT--AT S_araneus300430 TTATTTTTTATA-GTATGCTGGGG--TTTTTTTATGGCATGTCATT--AT S_araneus300436 TGGCTTTTGATA-GTATGCAGC----TTTTTC-ATGGCATATCGTT--AT S_araneus300501 TGGTTTTTGATG-GTATGTTGC----CTTTTCTGTGGCACATCATT--AT S_araneus300564 TGGCTTTTGAGG-GTATGCTGT----TTTTTC-ATGTCATATCATT--AT S_araneus300674 TGGCTTTTGATG-GTATGCTGC----TTTT-T-GTGGCATATCATT--AA S_araneus301052 AGGCTTTTGAT----ATGTTGC----TTTT-T-GTGGCATATCATT--AT S_araneus300544 TGGCTTTTGAGG-GTATGCTGT----TTTCTC-ATGCCATATCATT--AT S_tridecemlineatus300201 TAACTGTGG-----TATGCTAAAGGTTTTTTCATAAGTGTGCCCCT--AT S_tridecemlineatus300300 TAACTGTGG-----TATGCTAAGG--TTTTTCATA-GTGTGCCCCT--AT T_nigroviridis300070 TTTGGACCGACG-----GCTTCTT---TCTGCCTCAGTCAAATGTT---- T_belangeri300113 TGATCATGATACTGTGCATTGT-----TTTTTCATAGCATATCTTT--AT C_familiaris300119 TAAAGGG-AAATACAAAT- C_familiaris300386 TAAAAGT-GAATACAAGT- C_porcellus300867 TAAAAGT-GATTACAAAT- D_novemcinctus300115 TAAAGGC-GAATACAAAT- D_novemcinctus300244 TAAAGGT-GAATACAAAT- D_melanogaster300093 CACAATC------------ E_telfairi300002 TAAAGGT-GAACACAGAG- E_telfairi300284 TACAGGT-GAACACACAC- E_telfairi300545 TAAAGGT-GAACACAGAG- E_telfairi300629 TACAGGT-GAACATAAAG- E_telfairi300805 TAAAGGT-GAACACAGAG- E_caballus300179 TAAAGGG-AAATAAGTAA- E_caballus300379 TAAAAGT-GGATACAAAT- E_europaeus300676 TAGAAGT-AGATACAA--- E_europaeus300677 TAGAAGT-AGATACAAAT- G_gallus300123 -GGAAGTGGGATACAA--- G_gorilla300375 TAAAGGT-GAATACAAAT- H_sapiens300422 TAAAGGT-GAATACAAAT- H_sapiens300624 TAAAGGT-GAATACAAAT- H_sapiens300680 TAAAGGT-GAATACAAAT- H_sapiens300128 TAAAGGT-GAATACAAAT- L_africana300467 TAAAGGT-GAATACAAAT- L_africana300508 TACAGGT-GAATACAAAT- M_mulatta300386 TAAAGGT-GAATACAAAT- M_mulatta300392 TAAAAGT-GAATA-AAATA M_mulatta300705 TAAAGGT-GAATACAGAT- M_murinus300267 TAAAGGT-GAATACAAAT- M_domestica300098 TCAAGGG-GATCACAAGC- M_lucifugus300367 TAAAAGT-GGATACAAAT- M_lucifugus300665 TAAAAGT-GGATACAAAT- M_lucifugus300949 TAAAAGT-GGATACAAAT- O_cuniculus300327 TGAAAGT-GAATACAAAT- O_cuniculus300381 TGAAAGT-GAATACAAAT- O_garnettii300239 TAAAGGT-GATAAACGT-- O_garnettii300302 TAAAGGT-GAACACAAAC- O_garnettii300347 TAAAGGT-GAATGCAAAT- O_garnettii300466 TAAAGGT-GAACACAAAT- O_garnettii300662 TAAAGGT-GAACACAAAT- O_garnettii300225 TAGAGGT-ANNNNNNNNN- P_troglodytes300390 TAAAGGT-GAATACAAAT- P_troglodytes300393 TAAAGGT-GAATACAAAT- P_troglodytes300547 TAAAGGT-GAATACAAAT- P_troglodytes300059 TAAAGGT-GAATACAAAT- P_pygmaeus300143 TAAAGGT-GAATACAAAT- P_pygmaeus300216 TAAAGGT-GAATACAAAT- P_pygmaeus300245 TAAAGGT-GAATACAAAT- R_norvegicus300181 TAAAAGT-GAGTACAAGA- R_norvegicus300261 --AAAGT-GAGTACAAGT- R_norvegicus300276 TAAAAGT-GAGTATAAGT- R_norvegicus300405 TAAAAGTTAAGTACAAAG- R_norvegicus300492 TAAAAGT-GAGTACAAGT- R_norvegicus300519 TAAAAGT-GAGTACAAGA- R_norvegicus300632 TAAAAGT-GAGTACAAGT- R_norvegicus300785 TAAAAGT-GAATATAAAG- R_norvegicus300920 CACAAGT-GAGTACAAGT- R_norvegicus300996 TAAAAGT-GAGTATAAGT- R_norvegicus301023 CAAAAGT-GAGTACAAGT- R_norvegicus300965 GAAAAGT-GAGTTTAAGT- S_araneus300234 ---AAGA-AAAAAAAA--- S_araneus300293 TAAAAGT-GGCTACAAAT- S_araneus300430 TAAAAGT-GACTATAAAG- S_araneus300436 CA-AAGT-AGCTACGAAT- S_araneus300501 TAAAAGT-GACTATAAAT- S_araneus300564 TAAAAGT-GCCTGCAATT- S_araneus300674 ---AAGT-CGTTACAGAA- S_araneus301052 TAAAAGT-GGCTACAAAT- S_araneus300544 TAAAAGT-GGCTGCAATT- S_tridecemlineatus300201 AAAAAGT-GGATACAGAC- S_tridecemlineatus300300 TAAAAGT-GAATACAGAC- T_nigroviridis300070 CAGAAAT-GAGTACAGGA- T_belangeri300113 TAGAAGT-GAATACAAAT- *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved