snOPY snoRNA Orthological Gene Database

Family: SNORA15

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300119 ---GCATGGCCAAATACTGTGTTCTTTTTT---ATCAGTTGTTTACATAG C_familiaris300386 ---GCATGGCTGAATACTGTGTTCTTTTTA----TCAGTAGTTTACACAG C_porcellus300867 ---GCATGGCTGAATACTGTGTTCTTTAA-----TCAGTAGTTTACACAG D_novemcinctus300115 ---TCATGGCTGAATACTGTGTTCTTTT-----ATCAGTAGTTTACACAG D_novemcinctus300244 ---GCATAGCCGAATACTGTGTTCTTTT-----ATCAGTAGTTTACACAG D_melanogaster300093 TTGGCAGAACTTAATTCCGGACCTGGTACACCTTCGGGTGCTAAGTGCGG E_telfairi300002 ---GCATGGCCGAATACTGTGTT-TTTTT----ATCCGTAATCTACACAG E_telfairi300284 ---GGATGGCCGAATACTGTGTT-TTTTT----ATCTGTAATCTACACAG E_telfairi300545 ---GCATGGCCGAATACTGTGTT-TTTTT----ATCCGTAATCTACACAG E_telfairi300629 ---GCATGGCTGAATCCTGTGTT-TTT------ATCCATAATCTACACAG E_telfairi300805 ---GCATGGCCGAATACTGTGTT-TTTTT----ATCCGTAATCTACACAG E_caballus300179 ---GCATGGCTGAAT-CTGTGCTCTTTTT----ATCAGTATTTTACACAG E_caballus300379 ---GCATGGCTGAATACTGTGTTTTTTTA-----TCAGTAGTTTACACAG E_europaeus300676 ---GCATGGCTGAATACTGTGTTCTTTTG----ATCAGTAGTTTACACAG E_europaeus300677 ---GCATGGCTGAATACTGTGTTCTTTTG----ATCAGTAGTTTACACAG H_sapiens300128 ---GCATGGCTGAATACTGTGTTCTTTT-----ATCAGTAGTTTACACAG H_sapiens300422 ---GCATGGCTGAATACTGTGTTCTTTT-----ATCAGTAGTTTACACAG H_sapiens300624 ---GCATGGCCGAATACTGTGTT--TTT-----ATCAGTAGTTTACACAG H_sapiens300680 -----------GCTGATTTTGAAACTTAAA-----AAAAAAA-----TCG L_africana300467 ---GCATGGCTGAATACTGTGTTCTTTTT----ATCAGTAATTTGCACAG L_africana300508 ---GCACCGCCGAATACTGTGTTCTTTTT----ATCAATAGTTTACACAG M_mulatta300386 ---GCATGGCTGAATACTGTGTTGTTTT-----ATCAGTAGTTTACACAG M_mulatta300392 -----------GCTGATTTTGAATGTTAAA-----AAAAAAAAAAAATCA M_mulatta300705 ---GCATGGCCGAATACTGTGTTCTTTT-----ATCAGTAGTTTACACAG M_murinus300267 ---GCATGGCTGAATACTGTGTTCTTTT-----ATCAATAGTTTACACAG M_domestica300098 ---GCATGGATGAATACTGTGTTTTCTTTG----TCGGTAGTTAACACAG O_cuniculus300327 ---GCATGGCTGAATACTGTGTTCTTTTG-----TCAGTAGTTTACACAG O_cuniculus300381 ---GCATGATTGAATACTGTGTTCTTTTG-----TCAGTAGTTTACACAG O_garnettii300225 ---GCAAGGCTGAATATTGTGTTCCTTCA-----TCAGTAGTTTACACAG O_garnettii300239 ---GCATAGCTGAATACTATGTTCTTTTA-----TCAGTAGTTTACATAG O_garnettii300302 ---GCATGGCTGAATACTGTGTTCTTTCA-----TCAGTAGTTTACACAG O_garnettii300347 ---GCATGGCTGAATACTGTGTTCTTTTA-----TTGGTAGATTACACAG O_garnettii300466 ----------------------ACATTGAA-----AAGGGTGAC--CCAG O_garnettii300662 ---GCATGGCTGAATACTGTGTTCTTTTA-----TTGGTAGATTACACAG P_troglodytes300059 ---GCATGGCTGAATACTGTGTTCTTTT-----ATCAGTAGTTTACACAG P_troglodytes300390 ---GCATGGCTGAATACTGTGTTCTTTT-----ATCAGTAGTTTACACAG P_troglodytes300393 -----------GCTGATTTTGAAACTTAAA-----AAAAAAA-----TCG P_troglodytes300547 ---GCATGGCCAAATACTGTGTT--TTT-----ATCAGTAGTTTACACAG P_pygmaeus300143 -----------GCCGATTTTGAAACTTAAA-----AAAAAAAA----TCA P_pygmaeus300216 ---GCATGGCCGAATACTGTGTTCTTTT-----ATCAGTAGTTTACACAG P_pygmaeus300245 ---GCATGGCTGAATACTGTGTTCTTTT-----ATCAGTAGTTCACACAG R_norvegicus300181 ----------------------GCCTGGG-----CTACACATTTAAA--G R_norvegicus300261 ---GCATGGCTGAATACTGTGTTCTTTAG-----TCAGTAATTTACATAG R_norvegicus300276 ---GCATGGCTGAATGCTGTGTTCTTTAG-----TCAGTAATTGACACAG R_norvegicus300405 ---GGATGGCTGAATGCCATGGACTTCTG-----TCAGTAATGCACATAG R_norvegicus300492 ------GCCTGGCCTACTGTGTTCTTCAG-----TCAGTAGTTTACACAG R_norvegicus300519 ---GCATGGCTGAATACTGTGTTCTTCAG-----TCAGTAATTTACACAG R_norvegicus300632 ----GCACGCTGAATACTGTGTTCTTCAG-----TCAGTAATTTACA--G R_norvegicus300785 -------GCCTGAATACTGTGTTTTTTAG-----TCAGTAATTTACACAG R_norvegicus300920 ---GCATGGCTGAATACTGTGTTCTTTAG-----TCAATAATTTACACAG R_norvegicus300965 ---GCATGGCTGAATACTGTGTTCTTTAG-----TCCCTAATTTACACAG R_norvegicus300996 ------GCCTGGCCTACTGTGTTCTTCAG-----TCAGTAATTTACACAG R_norvegicus301023 ---GCATGGCTGAATACTGTGTTCTTTAG-----TCAGTAATTTACACAG S_araneus300234 ---GCGTGACTGAATGCTGTGTTCTTTTT----ATCAATATTTTACACAT S_araneus300293 ---GCATGGCTGAATACTGTATCCTTTTT----GCCAATATTTTTCACAG S_araneus300430 ------TGGGTGAATACTATGTTCTTTTT------CAACGTTTCACACAG S_araneus300436 ---GCATGGCTGAATACTGTGTTCTTTTTTT--ACCAATATTTTACACAG S_araneus300501 ---GTGTGGATGACTACTGTGCTCTTTGTA----TCAATATTTTACACAG S_araneus300544 ---GTTTAGCTAAATACAGTGTTGTTTTTA---ATCAATATTTTACACAG S_araneus300564 ---GTTTGGCTAAATACAGTGTTGTTTTTA---ATCAATATTTTACACAG S_araneus300674 ---GCATGGCTGAATACTGTGTTCTTTTT----ATCAATATTTTGCATGC S_araneus301052 ---GCATGGCTGAATACTGTGTTCTTTTT----ATCAATATTTTACACAG S_tridecemlineatus300201 ---GCATGGCTGAATACTGTGTACTTTAG-----TCAGTATTTTACACAG S_tridecemlineatus300300 ---GCATGGCTGAATACTGTGTACTTTAG-----TCAGTATTTTACACAG T_nigroviridis300070 ---GCATGGCTGAATTCTGTTCCAGCTGCG-----GAGTGGTGGATACAG T_belangeri300113 ---GCATGGCTGAATGCTGTCTTCTTTTA-----TCAGTAGTTTACAGAG C_familiaris300119 CCAGACATCATGCAAAAAAAATAAGAAATAAAGCATTCTTCCCTA-TAGA C_familiaris300386 CCAGACACCATGCAAAAGTAA-------------AGTGTTCCCTT-TAAA C_porcellus300867 CCAGACACCATGCAAAAGTAA-------------AAACTTCCTTT-TAAA D_novemcinctus300115 CCAAACACCATGCAAAAATA-------------TAGTCTTCTCTT-CAAA D_novemcinctus300244 CCAGACACCATGCAAAAATG-------------TAGTCTTCCCTT-TAAA D_melanogaster300093 CCAGACATTTTGCCAGAACAAATTCCAG----GCATTGTCGTCTTCAGCA E_telfairi300002 CCAGACACCAGGCCAT----AGTA---------TCATTTC-CCTT-TAAC E_telfairi300284 C-AGACACCATGCCAT----AGTA---------CCGTTTC-CCTT-TAAC E_telfairi300545 CCAGACACCATGCCAC----AGTA---------TTATTCC-CCTT-TAAC E_telfairi300629 CCAGACACCATGCCACCC--AGCA---------CCGTTTC-C-TT-TAAT E_telfairi300805 CCAGACACCATGCCAT----AGTA---------TCATTTC-CCTT-TAAC E_caballus300179 CCAGACACCACGCAGTAAAAAGAG---------CAGTCTTACCTT-TAAA E_caballus300379 CCAGACACCATGCAAAAGTAA-------------A-GTCTTC-TTTTAAA E_europaeus300676 CCAGACACCATGCAAAAGTAA-------------AGTTTTCCCTAATGCA E_europaeus300677 CCAGACACCATGCAAAAGTAA-------------AGTTTTCTCTC-TGCA H_sapiens300128 CCAGACACCATGCAAAAGCA---------------GTCTTCCCTT-TAGA H_sapiens300422 CCAGACACCATGCAAAAGCA---------------GTCTTCCCTT-TAGA H_sapiens300624 CCAGACACCATGCAAAAGCA---------------GTCTTCCCTT-TAGA H_sapiens300680 CCAGGTACCATGCAAAAGCAA---------------TCTTCCCTT-TAGA L_africana300467 CCAGACACCATGCAAA----AGTA---------TCATCTTCCCTT-TAAA L_africana300508 CCAGACACCGTGCAAAAGTA-------------CAGTCTTCTCTT-TTAG M_mulatta300386 CCAGACACCATGCAAAAGCA---------------GTCTTCCCTT-TAGA M_mulatta300392 CGAGGTGCCATGCAAAAGCAA---------------TCTTCCCTT-CAGA M_mulatta300705 CCAGACACCATGCAAAAGCA---------------GTCTTCCCTT-TGGA M_murinus300267 CCAGACACCATGCAAAAGCA---------------GTCTTCCCTT-TAAA M_domestica300098 CCAGACACCATGCAAAAGTAC-------------ATTCTCCTCCTTTGAA O_cuniculus300327 CCAGACACCATGCAAAAGTAA-------------AAGCTTCCCTT-GGAA O_cuniculus300381 CCAGACACCATGCAAAAGTAG-------------T--CTTCCCTT-GGAA O_garnettii300225 CCAGACACCATGCAAAAGCAG---------------ACTTCCCTTTAAAA O_garnettii300239 CTAGACACCATGCAAAAACAG---------------TCTTCCCTTTTAAA O_garnettii300302 CCAGACACCATGCAAAAGCAG---------------TCCTCCCTTTTAAA O_garnettii300347 CCAGACACCATGCAAAAGCAG---------------TCTTCCCTTTTAAA O_garnettii300466 CCAGACACCATGCAAAAGCAG---------------TCTTCCCTT-TTAA O_garnettii300662 CCAGACACCATGCAAAAGCAG---------------TCTTCCCTTTTAAA P_troglodytes300059 CCAGACACCATGCAAAAGCA---------------GTCTTCCCTT-TAGA P_troglodytes300390 CCAGACACCATGCAAAAGCA---------------GTCTTCCCTT-TAGA P_troglodytes300393 CCAGGTACCATGCAAAAGCAA---------------TCTTCCCTT-TAGA P_troglodytes300547 CCAGACACCATGCAAAAGCA---------------GTCTTCCCTT-TAGA P_pygmaeus300143 CCAGGTACCATGCAAAAGCAA---------------TCTTCCCTT-TAGA P_pygmaeus300216 CCAGACACCATGCAAAAGCA---------------GTCTTCCCTT-CAGA P_pygmaeus300245 CCAGACACCATGCAGAAGCA---------------GTCTTCCCTT-TAGA R_norvegicus300181 CCAGACACCATGCAAAAGTAA-------------AGTCTTCC-TT-TAAG R_norvegicus300261 CCAGACACCATGCAAGAGTAA-------------AGTCTTCC-TT-TAAG R_norvegicus300276 CCAGACACCATGCAAAAGTAA-------------AGTCTTCC-TT-TAAG R_norvegicus300405 CCAGACACCAGGCAAAAGCGG-------------AGTCTTCC-TC-TAAG R_norvegicus300492 CCAGACACCATGCAAGAGTAA-------------GGTCTTCC-TT-TAAG R_norvegicus300519 CCAAACACCATGCAAAAGTAA-------------AGTCTTCC-TT-TAAG R_norvegicus300632 CCAGACACCATGCAAAAGTAA-------------AGTCTTCC-TT-TAAG R_norvegicus300785 CCAGACACCATGCAAAAGTAA-------------AGGCTTCC-TT-TAAG R_norvegicus300920 CCAGACACCATGCAAGAGTAA-------------AGTCTTCC-TT-TAAG R_norvegicus300965 CCAGACACCATGCAATAGTAA-------------AGGCTTCC-TT-TAAG R_norvegicus300996 CCAGACACCATGCAAAAGTAA-------------GGTCTTCC-TT-TAAG R_norvegicus301023 CCAGACACCATGCAAAAGTAA-------------AGGCTTCCGTT-TTAG S_araneus300234 TCAGACACGGTGCAAAAGTAA-------------AGTTTTCCCT--TGAA S_araneus300293 CCAGACACCATTTAAAAGTA---------------GTTTTCCCT--TGAA S_araneus300430 CCAGACACCACACAAAAAGAA-------------AATTTTCCTT--TGAG S_araneus300436 CCAGACACCGTGCAAAAATAA-------------AGTTCTTCTT--TGAA S_araneus300501 CCAGATACCACGCAAAAGCAA-------------GGTTTTCCCT--TGAA S_araneus300544 CAAGACACCATGCAAAAGTAA---------------TTTTCTTT--TGAA S_araneus300564 CTAGACACCATGCAAAAGTAA---------------TTTTCTTT--TGAA S_araneus300674 -CAGAAACCATGCAAAAGTAA-------------AGTTTTCCCT--TCAA S_araneus301052 CCAGACACCATGCAAAAGTAA-------------AGTTTTCCCT--TGAA S_tridecemlineatus300201 CCAGACACCATGCAAAAGTAA-------------AAGTCTTCCTTTTATA S_tridecemlineatus300300 CCAGACACCATGCAAAAGTAA-------------A-GTCTTCCTTTTATA T_nigroviridis300070 TCAGACACCATGCCAGAGCGG--------------GGCCTCCTTTCTGCT T_belangeri300113 TCAGATAGCATGTAAAAGTAA-------------CATCTTCCCTC-TGAA * C_familiaris300119 GTGGTTACCATG--GCATGCTAAGC-TTTTC-------CATA-TCAT--T C_familiaris300386 ATGCCTCTAATG--GTGTGCTAAGC--TTTTTCATA-GCATA-TCAT--T C_porcellus300867 ATGACAATGAT-----ATGCTGT----TTTTTCATG-GTGTA-TCAT--T D_novemcinctus300115 ACTGTTATGCTG--GTATGCT--GT-TTTCTTCACA-GCATA-TTAT--T D_novemcinctus300244 ATTGTTATGATG--GTATGCTAAGT-CTTCTTCATA-GCATA-TCGT--T D_melanogaster300093 GTTGCCTCAGTG-----TGGC------CTCTGTCTGAACATG-GCAC--T E_telfairi300002 GTACTTCCGGTG-----TGCTGTGT-CTTCTTCATG-GCATA-TCAT--C E_telfairi300284 GTACTTCCGGTG-----TGCTGTGT-CTTCTTCATG-GCATA-TCAT--C E_telfairi300545 GTACTTCCAGTG-----TGCTGCGT-CTTCTTCATG-GCATA-TCAT--C E_telfairi300629 GTACTCGCGGTG-----TGCTGTGT-CTTCTTCATG-GCGTA-TCAT--C E_telfairi300805 GTACTTCCGGTG-----TGCTGTGT-CTTCTTCGTG-GCATA-TCAT--C E_caballus300179 GTGGTTATGATGG--TATGCTAAGT-TTTTTTCATA-GCATA-TCAG--T E_caballus300379 ATAACTATGAT-----GTTATGCTATGTTTTTTATA-GCATA-TCAT--T E_europaeus300676 GTGACTTT-----GGTATGCTAAG---ATTTGTGTG-GCATCCTCAAC-T E_europaeus300677 GTGACTTT-----GGTATGCTAAG---ATTTGTGTG-GCATG-TCATC-T H_sapiens300128 ATGACT--GATG--GTATGCTAAGG-TTTTT-CATA-GCATA-TCAT--T H_sapiens300422 ATGACT--GATG--GTATGCTAAGG-TTTTT-CATA-GCATA-TCAT--T H_sapiens300624 ATGACT--GATG--GTATGCTAAGG-TTTTT-CATA-GCATA-TCAT--T H_sapiens300680 ATGAC--TGATG--GTATGCTAAGG--TTTTTCGTG-GCATA-TTATT-- L_africana300467 ATGTTTATGATG---TATGCTAACT-TTTTCTCATG-GCATA-TCAT--T L_africana300508 GCAGTTATGGTG--GCATGCTGAGT-TTTTTCCATA-CCATG-TCAT--T M_mulatta300386 ATGACT--GATG--GTATGCTAAGG-TTTTT-CATA-GCGTA-TCAT--T M_mulatta300392 ATGAC--TGATG--GTATGCTCAGG--TTTTTCATA-GCATA-TCATC-- M_mulatta300705 ATGACC--AATG--GTATGCTAAGG-TTTTT-CATA-GCATA-TCAT--T M_murinus300267 ATGACT--GATG--ATATGCTAAGT-TTTTC-CATA-GCATA-TCAT--T M_domestica300098 ATGGTCTTAATG--GTATGCTAAGA--ATTGCCATCAGCATG-CTAT--T O_cuniculus300327 ATCATTTT-----GGTATGCTGAG---TTTTTCTTA-GCATA-TCAT--T O_cuniculus300381 ATCATTTT-----GGTATGCTGAG---TTTTTCTAA-GCATA-TCAT--T O_garnettii300225 -------TGATG--ATATGCTAAGA--TGTTTCCTA-GCATA-TCAT--T O_garnettii300239 ATGAC--TGATA--ATATGCTAAGT--TATTTCATG-GTATA-TCAT--T O_garnettii300302 -TGAC--TGATG--ATATGCTAAGT--TATTTCATA-GCATA-TCAC--T O_garnettii300347 -TGAC--TGAT-----ATGCTAAGT--TATTTCATA-GCATA-TCATTTT O_garnettii300466 ATGAC--TGAT-----ATGCTAAGT--TATTTCATA-GCATA-TCATTTT O_garnettii300662 -TGAC--TGAT-----ATGCTAAGT--TATTTCATA-GCATA-TCATTTT P_troglodytes300059 ATGACT--GATG--GTATGCTAAGG-TTTTT-CATA-GCATA-TCAT--T P_troglodytes300390 ATGACT--GATG--GTATGCTAAGG-TTTTT-CATA-GCATA-TCAT--T P_troglodytes300393 ATGAC--TGATG--GTATGCTAAGG--TTTTTCGTG-GCATA-TTATT-- P_troglodytes300547 ATGACT--GATG--GTATGCTAAGG-TTTTT-CATA-GCATA-TCAT--T P_pygmaeus300143 ATGAC--TGATG--GTATGCTAACG--TTTTTCATG-GCATA-TTATT-- P_pygmaeus300216 ATGACT--GATG--GTATGCTAAGG-TTTTT-CATA-GCATA-TCAT--T P_pygmaeus300245 ATGACT--GATG--GTATGCTAAGG-TTTTT-CATA-GCATA-TCAT--T R_norvegicus300181 ATGGC--TGAT-----ATGCTAT----ATTTT-ATG-GTATA-TCAT--T R_norvegicus300261 ATGGC--TGCT-----ATGCTGT----ATTTT-ATG-GTATA-T-----C R_norvegicus300276 ATGGC--TGAT-----ATTCTAT----ATTTT-ATG-GTATA-TGAT--C R_norvegicus300405 GCGAC--TGGC-----ACACTGT----TTTCT-AAG-GTATA-TCGC--T R_norvegicus300492 ATGGC--CGAT-----ATGCTGT----ATTTT-ATG-GTATG-TCAT--C R_norvegicus300519 ATGGC--TGGT-----ATGCTAT----ACTTT-ATG-GTATA-TCAT--C R_norvegicus300632 ATGGT--TGAT-----ATGCTGT----AGTTT-ATG-GTATA-TCAC--C R_norvegicus300785 ATGGC--TGATC----ACGCTAT----ATTTT-ATG-GTATA-TCAT--T R_norvegicus300920 ATGAC--CGAT-----ATGCTGT----AGTTT-ATG-GTATA-TCAC--C R_norvegicus300965 ATGGT--CGAT-----GTGCTAT----ATTTT-ATG-GTATA-TCAT--T R_norvegicus300996 ATGGC--CGAT-----ATGCTAT----ATTTT-ATG-GTATG-TCAT--C R_norvegicus301023 ATGGC--TGAT-----ATGCTAT----TTTGT-ATG-GTATA-TCAT--T S_araneus300234 ATGGCTTTTGAT-GGTATGCTGC----TTTTCTGTG-GCATA-TCAT--T S_araneus300293 ATGGCTCTCAAT-GGTATGCTGC----TTTTCTATG-GCATA-TCAT--T S_araneus300430 ATTATTTTTTAT-AGTATGCTGGGG-TTTTTTTATG-GCATG-TCAT--T S_araneus300436 ATGGCTTTTGAT-AGTATGCAGC----TTTTTCATG-GCATA-TCGT--T S_araneus300501 CTGGTTTTTGAT-GGTATGTTGC---CTTTTCTGTG-GCACA-TCAT--T S_araneus300544 ATGGCTTTTGAG-GGTATGCTGT---TTTCTC-ATG-CCATA-TCAT--T S_araneus300564 ATGGCTTTTGAG-GGTATGCTGT---TTTTTC-ATG-TCATA-TCAT--T S_araneus300674 ATGGCTTTTGAT-GGTATGCTGC----TTTT-TGTG-GCATA-TCAT--T S_araneus301052 AAGGCTTTTGAT----ATGTTGC----TTTT-TGTG-GCATA-TCAT--T S_tridecemlineatus300201 ATAACTGTGGT-----ATGCTAAAGGTTTTTTCATAAGTGTG-CCCC--T S_tridecemlineatus300300 ATAACTGTGGT-----ATGCTAAGG--TTTTTCATA-GTGTG-CCCC--T T_nigroviridis300070 CTT------------TGGACCGACGGCTTCTTTCTG-CCTCAGTCAAATG T_belangeri300113 GTGATCATGATACTGTGCATTGT----TTTTTCATA-GCATA-TCTT--T C_familiaris300119 ATTAAAGGG-AAATACAAAT- C_familiaris300386 TTTAAAAGT-GAATACAAGT- C_porcellus300867 ATTAAAAGT-GATTACAAAT- D_novemcinctus300115 ATTAAAGGC-GAATACAAAT- D_novemcinctus300244 ATTAAAGGT-GAATACAAAT- D_melanogaster300093 GTCACAATC------------ E_telfairi300002 TGTAAAGGT-GAACACAGAG- E_telfairi300284 TGTACAGGT-GAACACACAC- E_telfairi300545 TGTAAAGGT-GAACACAGAG- E_telfairi300629 TGTACAGGT-GAACATAAAG- E_telfairi300805 TGTAAAGGT-GAACACAGAG- E_caballus300179 AATAAAGGG-AAATAAGTAA- E_caballus300379 ATTAAAAGT-GGATACAAAT- E_europaeus300676 GTTAGAAGT-AGATACAA--- E_europaeus300677 GTTAGAAGT-AGATACAAAT- H_sapiens300128 ATTAAAGGT-GAATACAAAT- H_sapiens300422 ATTAAAGGT-GAATACAAAT- H_sapiens300624 ATTAAAGGT-GAATACAAAT- H_sapiens300680 ATTAAAGGT-GAATACAAAT- L_africana300467 ATTAAAGGT-GAATACAAAT- L_africana300508 ATTACAGGT-GAATACAAAT- M_mulatta300386 ATTAAAGGT-GAATACAAAT- M_mulatta300392 ATTAAAAGT-GAATA-AAATA M_mulatta300705 ATTAAAGGT-GAATACAGAT- M_murinus300267 ATTAAAGGT-GAATACAAAT- M_domestica300098 ACTCAAGGG-GATCACAAGC- O_cuniculus300327 ATTGAAAGT-GAATACAAAT- O_cuniculus300381 ATTGAAAGT-GAATACAAAT- O_garnettii300225 ATTAGAGGT-ANNNNNNNNN- O_garnettii300239 ATTAAAGGT-GATAAACGT-- O_garnettii300302 GTTAAAGGT-GAACACAAAC- O_garnettii300347 GTTAAAGGT-GAATGCAAAT- O_garnettii300466 GTTAAAGGT-GAACACAAAT- O_garnettii300662 GTTAAAGGT-GAACACAAAT- P_troglodytes300059 ATTAAAGGT-GAATACAAAT- P_troglodytes300390 ATTAAAGGT-GAATACAAAT- P_troglodytes300393 ATTAAAGGT-GAATACAAAT- P_troglodytes300547 ATTAAAGGT-GAATACAAAT- P_pygmaeus300143 ATTAAAGGT-GAATACAAAT- P_pygmaeus300216 GTTAAAGGT-GAATACAAAT- P_pygmaeus300245 ATTAAAGGT-GAATACAAAT- R_norvegicus300181 ATTAAAAGT-GAGTACAAGA- R_norvegicus300261 ATTAAAAGT-GAGTACAAGT- R_norvegicus300276 ATTAAAAGT-GAGTATAAGT- R_norvegicus300405 ACTAAAAGTTAAGTACAAAG- R_norvegicus300492 ATTAAAAGT-GAGTACAAGT- R_norvegicus300519 ATTAAAAGT-GAGTACAAGA- R_norvegicus300632 ATTAAAAGT-GAGTACAAGT- R_norvegicus300785 ATTAAAAGT-GAATATAAAG- R_norvegicus300920 ATCACAAGT-GAGTACAAGT- R_norvegicus300965 ATGAAAAGT-GAGTTTAAGT- R_norvegicus300996 GTTAAAAGT-GAGTATAAGT- R_norvegicus301023 ATCAAAAGT-GAGTACAAGT- S_araneus300234 AT---AAGA-AAAAAAAA--- S_araneus300293 ATTAAAAGT-GGCTACAAAT- S_araneus300430 ATTAAAAGT-GACTATAAAG- S_araneus300436 ATCA-AAGT-AGCTACGAAT- S_araneus300501 ATTAAAAGT-GACTATAAAT- S_araneus300544 ATTAAAAGT-GGCTGCAATT- S_araneus300564 ATTAAAAGT-GCCTGCAATT- S_araneus300674 AA---AAGT-CGTTACAGAA- S_araneus301052 ATTAAAAGT-GGCTACAAAT- S_tridecemlineatus300201 ATAAAAAGT-GGATACAGAC- S_tridecemlineatus300300 ATTAAAAGT-GAATACAGAC- T_nigroviridis300070 TTCAGAAAT-GAGTACAGGA- T_belangeri300113 ATTAGAAGT-GAATACAAAT- *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved