snOPY snoRNA Orthological Gene Database

Family: SNORA14

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300345 -----------------CCGCATTCTTAAACCCTCTTGGTAGCTTCCCT- C_porcellus300895 -----------------CTGCATTCTTAAACCCTCTTGGCAGCTTCGCT- D_rerio300240 ---------------CCGCACTGTTTTAAA-CCCCCCACGAGCTGCCTG- D_rerio300241 ---------------CCGCACTGTTTTAAA-CCCCCCACGAGCTGCCTG- D_novemcinctus300518 -----------------CAGCATTCTTAAACCCTCTTGGTGGCTTCGCT- D_melanogaster300077 CGCAGCTCGCTTGCACAGCACAGCACCAAA-TTGGTAAATAACCTATCGT E_telfairi300369 -----------------CAGCATTCTTAAACCCTCTTGGTAGCTTCCTTT E_telfairi300620 --------------------AGGCCTTGGAACAATACGCTAATTTATCT- E_telfairi300708 -----------------CAGCATTCTTAAACCCTCTTGGTAGCTTCCTTT E_caballus300359 -----------------TCGCATTCTTAAACCCTCTTGGTAGCTTCGCT- E_europaeus300680 -----------------GTGCATTCTTCATTTCTCTTGGTAGCTATACT- E_europaeus300705 -----------------GTGCATTCTTAAACCCTCTTGGCAGTTTCGTT- F_catus300330 -----------------CTGCATTCTTAAACCCTCTTGGTAGCTTTCCT- H_sapiens300625 -----------------TTGCATTCTTAAACCCTCTTGGTGGCTTCCCT- H_sapiens300679 -----------------CTGCATTCTTAAACCCTCTTGGTAGCTTCGTT- M_mulatta300592 -----------------CTGCATTCTTAAACCCTCTTGGTAGCTTCGTT- M_mulatta300704 -----------------TTGCATTCTTAAACCCTCTTGGTGGCTTTCCT- M_murinus300058 --------------------------TTGCATGCATTAG-AGCTTTGTT- M_murinus300508 -----------------TTGCATTCTTAAACCCTCTTGGTTGCTTCGCT- M_domestica300079 -----------------CCGCATTCTTAAACCCTCTTGGTAGCCTTGCT- M_musculus300817 -----------------TTGCATTCTTAAACCCTCTTGGCAGCTTTGCT- O_anatinus303370 -----------------CCGCGGGCTTCGACCCTCTCGGTAGCGTCGCC- O_anatinus304533 -----------------CTGCATTCTTAAACCCTCTTGGTAGCGTCGCC- O_cuniculus300428 -----------------TTGCATTCCTAAACCTTCTTGGTAGCTTCGCT- O_garnettii300129 -----------------ATGCATTCTTAAATTTCCTTGGTAGCTTTACT- P_troglodytes300156 -----------------TTGCATTCTTAAACCCTCTTGGTGGCTTCCCT- P_troglodytes300537 -----------------CTGCATTCTTAAACCCTCTTGGTAGCTTCGTT- P_pygmaeus300075 -----------------TTGCATTCTTAAACCCTCTTGGTGGCTTCCCT- P_pygmaeus300582 -----------------CTGCATTCTTAAACCCTCTTGGTAGCTTCGTT- R_norvegicus300984 -----------------TTGCATTCTTAAACCCTCTTGGCGGCTTTGCT- S_araneus301074 -----------------GCGCATTCTTAAACCCTCTTGGCGGC---GCT- S_tridecemlineatus300174 -----------------TTGCATTCTTAAACCCTCTTGGCGGCTTCGC-- T_nigroviridis300106 ---------------CAGCATCCTTACAAAACCCCCCAGCTGCTGCTCG- C_familiaris300345 AAAAAGGCTTCCAAGATA-TGAGTGAATGCTATAGAAATTG-CAGGGGAG C_porcellus300895 CTGAGTGCTTCCAAGATA-TGAGTGAATGCTAGAGAAATTG-CGGGGGAG D_rerio300240 ----TCGCTTTTGGGACA-AGGAAAAGTGCAAGAGAAAAATCAAAAATTA D_rerio300241 ----TCGCTTTTGGGACA-AGAAAAAGTGCAAGAGAAAAATCAAGAATTA D_novemcinctus300518 GTAAGTGCTTCCAAGATA-TGAGCGAATGCTACAGAAATTG-TAGGGGAG D_melanogaster300077 CGTGCTGTTTACTGTTTG-CAATCGGCTGCCAGAAAAAC-----GACGGA E_telfairi300369 GTACTTACTTCCAAGATAATGAATGAATGCTACAGAAATGG-CAGGAGAG E_telfairi300620 TAAGAAATTCCCAAGATC-TGGGTGAATGCTACAGAGATTG--CAGGCAA E_telfairi300708 GTAC----TTCCAAGATAATGAATGAATGCTACAGAAATGG-CAGGAGAG E_caballus300359 CTAAACGCTTCCAAGATA-TGAGTGAATGCTATAGAATTTG-CAGGGGAG E_europaeus300680 CTAAATGCTTCCAAGATA-TGAATGAATGCTATATAAACTG-TAGGGACA E_europaeus300705 CTCAACGCTTCCAAGATA-TGAGTGAATGCTATAGAAATTGGCAGGGGAG F_catus300330 GAAAATGCTTCCAAGATA-TGAGTGAATGCTATAGAAATTG-CAGGGGAG H_sapiens300625 GTAAATGCTTCCAAGATA-TGAGCGAATGCTATAGAAATTG-CAGGAAAG H_sapiens300679 CTAAGTGCTTCCAAGATA-TGAGTGAATGCTATAGAAATTG-CAGGGGAG M_mulatta300592 CTAAGTGCTCCCAAGATA-TGAGTGAATGCTATAGAAATTG-CAGGGGAG M_mulatta300704 CTAAATGCTTCCAAGATA-TGAGCGAATGCTATAGAAATTG-CAGGGAAG M_murinus300058 CTAAATGCTTCCAAGAAA-TGAGTGAATGCTATAGAAATTG-CAGAGGAG M_murinus300508 CTAAACGCTTCCAAGATA-CGAGTGAATGCTATAGAAATTG-CAGGGGAG M_domestica300079 CTAA--GCTTCCAAGATA-TGAGTGAATGCCACAGAAAATTGCAGATGAA M_musculus300817 CTG-GTGCTTCCAAGATA-TGAGTGAATGCTAGACAAAGTG-CGGGGGAG O_anatinus303370 --GGGAGCTTCGGAGATG-CGAGCGAACGCGGCGGGAGACTGCGGGGCGA O_anatinus304533 --AGAAGCTGCCAAGATA-CGAGTGAATGCGACAGGAAACTGCAGATCAA O_cuniculus300428 GAAAACGCTTCCAAGATA-TCAGTGAATGCTATAGAAATCG-CAGGGGAG O_garnettii300129 CTG--TGCTTCCATGATA-TGAGTGAATGC-ATAGAAATTG-CAGAGGAA P_troglodytes300156 GTAAATGCTTCCAAGATA-TGAGCGAATGCTATAGAAATTG-CAGGAAAG P_troglodytes300537 CTAAGTGCTTCCAAGATA-TGAGTGAATGCTATAGAAATTG-CAAGGGAG P_pygmaeus300075 CTAAATGCTTCCAAGATA-TGAGCGAATGCTATAGAAATTG-CAGGGAAG P_pygmaeus300582 CTAAGTGCTTCCAAGATA-TGAGTGAATGCTATAGAAATTG-CAGGGGAG R_norvegicus300984 CTG-GTGCTTCCAAGATA-TGAGTGAATGCTAGACAAAGTG-CGGGGGAG S_araneus301074 CCGATCGCCCCCAGGATA-TGAGTGAATGCGATAGAAACCG-CAGGGGAG S_tridecemlineatus300174 CTA-GTGCTTCCAAGATA-TGAGTGAATGCTAGAGAAATTG-CGGGGGAG T_nigroviridis300106 ----TGGCTGCTGGGACA-AGAAAGGATGCGAGATGAACGTTA-GAACCA ** C_familiaris300345 TCCAAAGGGCTGCGCTTCC--CATGTGG-TTCAGTCTTATTTCAT---AC C_porcellus300895 TCCAAAGGGCTGCGCTTGT--CTTGTGG-CTCAGTCTTATTTCAT---AC D_rerio300240 TCTAAAGCTGAACGTC-TGTG-CAGTGA-CCTTCAGCTATTTCAC---CT D_rerio300241 TCCAAAGCTGAACGTC-TGTG-CAGTGA-CCTTCAGCTATTTCAC---CT D_novemcinctus300518 TCCAAAGGGCTGCGCCTCT--TCTGTGG-TTCAGTCTTATTTCAT---AC D_melanogaster300077 TTCCAAGAACTTTGCGACTGATTATTGTCGCTGCGTTCATTTCAC---CC E_telfairi300369 TCCAAAGGGCTCATCCTC----CTGTGG-CTCAGCCTTATTTCTT---AC E_telfairi300620 TCCAAAAGGCTGTGCAACC---CAGTGG-CCCGGCCTTATTTCAC---AC E_telfairi300708 TCCAAAAGGCTGAGCCTCA--CCTGTGG-CTCACTCTTATTTCAT---AC E_caballus300359 TCCAAAGGGCTGCGCTCCT--CATGTGG-CTCAGTCTTATTTCAT---AC E_europaeus300680 TCCAAAGGGCTGTGATTCT--CCTATGT-CTCAGTCTTATTTCAT---AC E_europaeus300705 TCCAAAGGGCTGTGCTTCCT-CCTGTGG-CTCAGTCTTATTTCAG---AC F_catus300330 TCCAAAGGGCTGCGCTTCT--CCTGTGG-CTCAGTCTTATTTCAT---AC H_sapiens300625 TCCAAAGGGCTGCGCGTCT--CCTGTGG-CTCAGTCTTATTTCAT---AC H_sapiens300679 TCCAAAGGGCTGCGCTTCT--CCCGTGG-CTCAGTCTTATTTCAT---AC M_mulatta300592 TCCAAAGGGCTGCGCTTCT--CCCGTGG-CTCAGTCTTATTTCAT---AC M_mulatta300704 TCCAAAGGGCTGCGCTTCT--CCTGTGG-CTCAGTCTTATTTCAT---AC M_murinus300058 TCCAAAGGGCTGCGCTTCC--CCTGTGG-CTCAGTCTTATTTCAT---AC M_murinus300508 TCCAAAGGGCTGCGCTTCT--TCTGTGG-CTCAGTCTTATTTCAT---AC M_domestica300079 TCCAAAATGCTAGGTATTTT-CCTCTGA-CTTGGCATTATTTCAG---AT M_musculus300817 TCCAAAGGGCTGCGCTCCT--CACGTGG-CTCAGTCTTATTTCAT---AC O_anatinus303370 TCCGGGGCGCCGGGCCCATCTCCTGGGG-CCCGGCGTTCTTTCACTAAAA O_anatinus304533 TCCAGAATGCCGGGCTTGGCTTCTGTGG-CCTGGCATTCTTTCACTAAT- O_cuniculus300428 TCCAAAAGGCTGCCCTTCT--CCTGTGG-ATCAGTCTTATTTCAT---AC O_garnettii300129 TCCAAAGGACTGTGCTTCA--CCTATGG-CTCAGTGTTATTTTAT---AC P_troglodytes300156 TCCAAAGGGCTGCGTGTCT--CCTGTGG-CTCAGTCTTATTTCAT---AC P_troglodytes300537 TCCAAAGGGCTGCGCTTCT--CCCGTGG-CTCAGTCTTATTTCAT---AC P_pygmaeus300075 TCCAAAGGGCTGCACGTCT--CCTGTGGACTCAGTCTTATTTCAT---AC P_pygmaeus300582 TCCAAAGGGCTGCGCTTCT--CCCGTGG-CTGAGTCTTATTTCAT---AC R_norvegicus300984 TCCAAAGGGCTGTGCTCCT--CACGTGG-CTCAGTCTTATTTCAT---AC S_araneus301074 TCCAAAGGGCTGCGCCCCCTCCCCGTGG-CGCGGCCTTATTTCAT---AC S_tridecemlineatus300174 TCCAAAGGGCTGCGCCTCT--CTCGTGG-CTCAGCCTCATTTCAT---AC T_nigroviridis300106 TCCAAAACTGAGGGCTGTGTGTCCGTAG-CTCTGAGTTATTTCAC---CT * *** C_familiaris300345 CTGCGACATCT- C_porcellus300895 CTGCGACATCT- D_rerio300240 CTTGAACATTA- D_rerio300241 CTTGAACATTA- D_novemcinctus300518 CTGCGACATACT D_melanogaster300077 CGACGACATTG- E_telfairi300369 CTGTGACATTT- E_telfairi300620 CTGCAACATCT- E_telfairi300708 CTGCGACATTT- E_caballus300359 CTGCGACATCT- E_europaeus300680 CTGCAACATGT- E_europaeus300705 CTGCGACACCT- F_catus300330 CTGCGACATCT- H_sapiens300625 CTGCAACATCT- H_sapiens300679 CTGCGACATCT- M_mulatta300592 CTGCGACATCT- M_mulatta300704 CTGCGACATCT- M_murinus300058 CTGTGACATCT- M_murinus300508 CTGCGACATCT- M_domestica300079 CTGTGACAACT- M_musculus300817 CTGCGACATCT- O_anatinus303370 CTGAAACGGCTC O_anatinus304533 CTGAAACAGCT- O_cuniculus300428 CTGCGACATAT- O_garnettii300129 CTGTGACATCA- P_troglodytes300156 CTGCAACATCT- P_troglodytes300537 CTGCGACATCT- P_pygmaeus300075 CTGCGACATCT- P_pygmaeus300582 CTGCGACATCT- R_norvegicus300984 CTGCGACATCT- S_araneus301074 CTGCGACATCA- S_tridecemlineatus300174 CTGCGACATCT- T_nigroviridis300106 CTAAGACAGAA- * **

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved