snOPY snoRNA Orthological Gene Database

Family: SNORA14

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300345 -----------------CCGCATTCTTAAACCCTCTTGGTAGCTTCCCT- C_porcellus300895 -----------------CTGCATTCTTAAACCCTCTTGGCAGCTTCGCT- D_rerio300240 ---------------CCGCACTGTTTTAAA-CCCCCCACGAGCTGCCTG- D_rerio300241 ---------------CCGCACTGTTTTAAA-CCCCCCACGAGCTGCCTG- D_novemcinctus300518 -----------------CAGCATTCTTAAACCCTCTTGGTGGCTTCGCT- D_melanogaster300077 CGCAGCTCGCTTGCACAGCACAGCACCAAA-TTGGTAAATAACCTATCGT E_telfairi300369 -----------------CAGCATTCTTAAACCCTCTTGGTAGCTTCCTTT E_telfairi300620 --------------------AGGCCTTGGAACAATACGCTAATTTATCT- E_telfairi300708 -----------------CAGCATTCTTAAACCCTCTTGGTAGCTTCCTTT E_caballus300359 -----------------TCGCATTCTTAAACCCTCTTGGTAGCTTCGCT- E_europaeus300680 -----------------GTGCATTCTTCATTTCTCTTGGTAGCTATACT- E_europaeus300705 -----------------GTGCATTCTTAAACCCTCTTGGCAGTTTCGTT- F_catus300330 -----------------CTGCATTCTTAAACCCTCTTGGTAGCTTTCCT- H_sapiens300625 -----------------TTGCATTCTTAAACCCTCTTGGTGGCTTCCCT- H_sapiens300679 -----------------CTGCATTCTTAAACCCTCTTGGTAGCTTCGTT- M_mulatta300592 -----------------CTGCATTCTTAAACCCTCTTGGTAGCTTCGTT- M_mulatta300704 -----------------TTGCATTCTTAAACCCTCTTGGTGGCTTTCCT- M_murinus300058 --------------------------TTGCATGCATTAG-AGCTTTGTT- M_murinus300508 -----------------TTGCATTCTTAAACCCTCTTGGTTGCTTCGCT- M_domestica300079 -----------------CCGCATTCTTAAACCCTCTTGGTAGCCTTGCT- M_musculus300817 -----------------TTGCATTCTTAAACCCTCTTGGCAGCTTTGCT- M_lucifugus300740 -----------------TTGCATTCTTAAACCCTCTTGGTGGCT--GCT- O_anatinus303370 -----------------CCGCGGGCTTCGACCCTCTCGGTAGCGTCGCC- O_anatinus304533 -----------------CTGCATTCTTAAACCCTCTTGGTAGCGTCGCC- O_cuniculus300428 -----------------TTGCATTCCTAAACCTTCTTGGTAGCTTCGCT- O_garnettii300129 -----------------ATGCATTCTTAAATTTCCTTGGTAGCTTTACT- P_troglodytes300156 -----------------TTGCATTCTTAAACCCTCTTGGTGGCTTCCCT- P_troglodytes300537 -----------------CTGCATTCTTAAACCCTCTTGGTAGCTTCGTT- P_pygmaeus300075 -----------------TTGCATTCTTAAACCCTCTTGGTGGCTTCCCT- P_pygmaeus300582 -----------------CTGCATTCTTAAACCCTCTTGGTAGCTTCGTT- R_norvegicus300984 -----------------TTGCATTCTTAAACCCTCTTGGCGGCTTTGCT- S_araneus301074 -----------------GCGCATTCTTAAACCCTCTTGGCGGC---GCT- S_tridecemlineatus300174 -----------------TTGCATTCTTAAACCCTCTTGGCGGCTTCGC-- T_nigroviridis300106 ---------------CAGCATCCTTACAAAACCCCCCAGCTGCTGCTCG- C_familiaris300345 AAAAAGGCTTCCAAGATA-TGAGTGAATGCTATAGAAATTG-CAGGGGAG C_porcellus300895 CTGAGTGCTTCCAAGATA-TGAGTGAATGCTAGAGAAATTG-CGGGGGAG D_rerio300240 ----TCGCTTTTGGGACA-AGGAAAAGTGCAAGAGAAAAATCAAAAATTA D_rerio300241 ----TCGCTTTTGGGACA-AGAAAAAGTGCAAGAGAAAAATCAAGAATTA D_novemcinctus300518 GTAAGTGCTTCCAAGATA-TGAGCGAATGCTACAGAAATTG-TAGGGGAG D_melanogaster300077 CGTGCTGTTTACTGTTTG-CAATCGGCTGCCAGAAAAAC-----GACGGA E_telfairi300369 GTACTTACTTCCAAGATAATGAATGAATGCTACAGAAATGG-CAGGAGAG E_telfairi300620 TAAGAAATTCCCAAGATC-TGGGTGAATGCTACAGAGATTG-CAGG-CAA E_telfairi300708 GTAC----TTCCAAGATAATGAATGAATGCTACAGAAATGG-CAGGAGAG E_caballus300359 CTAAACGCTTCCAAGATA-TGAGTGAATGCTATAGAATTTG-CAGGGGAG E_europaeus300680 CTAAATGCTTCCAAGATA-TGAATGAATGCTATATAAACTG-TAGGGACA E_europaeus300705 CTCAACGCTTCCAAGATA-TGAGTGAATGCTATAGAAATTGGCAGGGGAG F_catus300330 GAAAATGCTTCCAAGATA-TGAGTGAATGCTATAGAAATTG-CAGGGGAG H_sapiens300625 GTAAATGCTTCCAAGATA-TGAGCGAATGCTATAGAAATTG-CAGGAAAG H_sapiens300679 CTAAGTGCTTCCAAGATA-TGAGTGAATGCTATAGAAATTG-CAGGGGAG M_mulatta300592 CTAAGTGCTCCCAAGATA-TGAGTGAATGCTATAGAAATTG-CAGGGGAG M_mulatta300704 CTAAATGCTTCCAAGATA-TGAGCGAATGCTATAGAAATTG-CAGGGAAG M_murinus300058 CTAAATGCTTCCAAGAAA-TGAGTGAATGCTATAGAAATTG-CAGAGGAG M_murinus300508 CTAAACGCTTCCAAGATA-CGAGTGAATGCTATAGAAATTG-CAGGGGAG M_domestica300079 CTAA--GCTTCCAAGATA-TGAGTGAATGCCACAGAAAATTGCAGATGAA M_musculus300817 CTG-GTGCTTCCAAGATA-TGAGTGAATGCTAGACAAAGTG-CGGGGGAG M_lucifugus300740 CTCGGTGCCTCCAGGATA-TGAGTGGATGCGACAGGAACCG-CAGG--AG O_anatinus303370 --GGGAGCTTCGGAGATG-CGAGCGAACGCGGCGGGAGACTGCGGGGCGA O_anatinus304533 --AGAAGCTGCCAAGATA-CGAGTGAATGCGACAGGAAACTGCAGATCAA O_cuniculus300428 GAAAACGCTTCCAAGATA-TCAGTGAATGCTATAGAAATCG-CAGGGGAG O_garnettii300129 CTG--TGCTTCCATGATA-TGAGTGAATGC-ATAGAAATTG-CAGAGGAA P_troglodytes300156 GTAAATGCTTCCAAGATA-TGAGCGAATGCTATAGAAATTG-CAGGAAAG P_troglodytes300537 CTAAGTGCTTCCAAGATA-TGAGTGAATGCTATAGAAATTG-CAAGGGAG P_pygmaeus300075 CTAAATGCTTCCAAGATA-TGAGCGAATGCTATAGAAATTG-CAGGGAAG P_pygmaeus300582 CTAAGTGCTTCCAAGATA-TGAGTGAATGCTATAGAAATTG-CAGGGGAG R_norvegicus300984 CTG-GTGCTTCCAAGATA-TGAGTGAATGCTAGACAAAGTG-CGGGGGAG S_araneus301074 CCGATCGCCCCCAGGATA-TGAGTGAATGCGATAGAAACCG-CAGGGGAG S_tridecemlineatus300174 CTA-GTGCTTCCAAGATA-TGAGTGAATGCTAGAGAAATTG-CGGGGGAG T_nigroviridis300106 ----TGGCTGCTGGGACA-AGAAAGGATGCGAGATGAACGTTA-GAACCA ** C_familiaris300345 TCCAAAGGGCTGCGCTTC-C-CATGTGG-TTCAGTCTT-ATTTCAT---A C_porcellus300895 TCCAAAGGGCTGCGCTTG-T-CTTGTGG-CTCAGTCTT-ATTTCAT---A D_rerio300240 TCTAAAGCTGAACGTC-TGTG-CAGTGA-CCTTCAGCT-ATTTCAC---C D_rerio300241 TCCAAAGCTGAACGTC-TGTG-CAGTGA-CCTTCAGCT-ATTTCAC---C D_novemcinctus300518 TCCAAAGGGCTGCGCCTC-T-TCTGTGG-TTCAGTCTT-ATTTCAT---A D_melanogaster300077 TTCCAAGAACTTTGCGAC-TGATTATTGTCGCTGCGTTCATTTCAC---C E_telfairi300369 TCCAAAGGGCTCATCCTC----CTGTGG-CTCAGCCTT-ATTTCTT---A E_telfairi300620 TCCAAAAGGCTGTGCAAC---CCAGTGG-CCCGGCCTT-ATTTCAC---A E_telfairi300708 TCCAAAAGGCTGAGCCTC-A-CCTGTGG-CTCACTCTT-ATTTCAT---A E_caballus300359 TCCAAAGGGCTGCGCTCC-T-CATGTGG-CTCAGTCTT-ATTTCAT---A E_europaeus300680 TCCAAAGGGCTGTGATTC-T-CCTATGT-CTCAGTCTT-ATTTCAT---A E_europaeus300705 TCCAAAGGGCTGTGCTTC-CTCCTGTGG-CTCAGTCTT-ATTTCAG---A F_catus300330 TCCAAAGGGCTGCGCTTC-T-CCTGTGG-CTCAGTCTT-ATTTCAT---A H_sapiens300625 TCCAAAGGGCTGCGCGTC-T-CCTGTGG-CTCAGTCTT-ATTTCAT---A H_sapiens300679 TCCAAAGGGCTGCGCTTC-T-CCCGTGG-CTCAGTCTT-ATTTCAT---A M_mulatta300592 TCCAAAGGGCTGCGCTTC-T-CCCGTGG-CTCAGTCTT-ATTTCAT---A M_mulatta300704 TCCAAAGGGCTGCGCTTC-T-CCTGTGG-CTCAGTCTT-ATTTCAT---A M_murinus300058 TCCAAAGGGCTGCGCTTC-C-CCTGTGG-CTCAGTCTT-ATTTCAT---A M_murinus300508 TCCAAAGGGCTGCGCTTC-T-TCTGTGG-CTCAGTCTT-ATTTCAT---A M_domestica300079 TCCAAAATGCTAGGTATT-TTCCTCTGA-CTTGGCATT-ATTTCAG---A M_musculus300817 TCCAAAGGGCTGCGCTCC-T-CACGTGG-CTCAGTCTT-ATTTCAT---A M_lucifugus300740 TCCAAAGGGCTGCGCC---TCCCGGTGG-CTCAGCCTT-ATTTCAG---A O_anatinus303370 TCCGGGGCGCCGGGCCCATCTCCTGGGG-CCCGGCGTT-CTTTCACTAAA O_anatinus304533 TCCAGAATGCCGGGCTTGGCTTCTGTGG-CCTGGCATT-CTTTCACTAAT O_cuniculus300428 TCCAAAAGGCTGCCCTTC-T-CCTGTGG-ATCAGTCTT-ATTTCAT---A O_garnettii300129 TCCAAAGGACTGTGCTTC-A-CCTATGG-CTCAGTGTT-ATTTTAT---A P_troglodytes300156 TCCAAAGGGCTGCGTGTC-T-CCTGTGG-CTCAGTCTT-ATTTCAT---A P_troglodytes300537 TCCAAAGGGCTGCGCTTC-T-CCCGTGG-CTCAGTCTT-ATTTCAT---A P_pygmaeus300075 TCCAAAGGGCTGCACGTC-T-CCTGTGGACTCAGTCTT-ATTTCAT---A P_pygmaeus300582 TCCAAAGGGCTGCGCTTC-T-CCCGTGG-CTGAGTCTT-ATTTCAT---A R_norvegicus300984 TCCAAAGGGCTGTGCTCC-T-CACGTGG-CTCAGTCTT-ATTTCAT---A S_araneus301074 TCCAAAGGGCTGCGCCCCCTCCCCGTGG-CGCGGCCTT-ATTTCAT---A S_tridecemlineatus300174 TCCAAAGGGCTGCGCCTC-T-CTCGTGG-CTCAGCCTC-ATTTCAT---A T_nigroviridis300106 TCCAAAACTGAGGGCTGTGTGTCCGTAG-CTCTGAGTT-ATTTCAC---C * *** C_familiaris300345 CCTGCGACATCT- C_porcellus300895 CCTGCGACATCT- D_rerio300240 TCTTGAACATTA- D_rerio300241 TCTTGAACATTA- D_novemcinctus300518 CCTGCGACATACT D_melanogaster300077 CCGACGACATTG- E_telfairi300369 CCTGTGACATTT- E_telfairi300620 CCTGCAACATCT- E_telfairi300708 CCTGCGACATTT- E_caballus300359 CCTGCGACATCT- E_europaeus300680 CCTGCAACATGT- E_europaeus300705 CCTGCGACACCT- F_catus300330 CCTGCGACATCT- H_sapiens300625 CCTGCAACATCT- H_sapiens300679 CCTGCGACATCT- M_mulatta300592 CCTGCGACATCT- M_mulatta300704 CCTGCGACATCT- M_murinus300058 CCTGTGACATCT- M_murinus300508 CCTGCGACATCT- M_domestica300079 TCTGTGACAACT- M_musculus300817 CCTGCGACATCT- M_lucifugus300740 CCTGCGACATCT- O_anatinus303370 ACTGAAACGGCTC O_anatinus304533 -CTGAAACAGCT- O_cuniculus300428 CCTGCGACATAT- O_garnettii300129 CCTGTGACATCA- P_troglodytes300156 CCTGCAACATCT- P_troglodytes300537 CCTGCGACATCT- P_pygmaeus300075 CCTGCGACATCT- P_pygmaeus300582 CCTGCGACATCT- R_norvegicus300984 CCTGCGACATCT- S_araneus301074 CCTGCGACATCA- S_tridecemlineatus300174 CCTGCGACATCT- T_nigroviridis300106 TCTAAGACAGAA- * **

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved