snOPY snoRNA Orthological Gene Database

Family: SNORA13

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300000 ----TGCCTTTGTGTTGCCCATTCTTTTTTGGAAAC-TTGCGAATGTGGT C_familiaris300208 ----GGCCTTTGTGTTGCCCGTTCACCTTCCGAAAC-TGGTGAACGCGGT C_porcellus300084 ----AGCCTTTGTGGTGCCCATTCACTTTTGAAAGC-TAGTGAATGTGGT C_porcellus300095 ----AGTCTTTGTATTGCCCATTTACTTTTAAAAAC-TAGTAAATACGGT C_porcellus300335 ----AGCCTTTGTGTTGCCCCTTCACCTTGGAAAGC-TAGTGAATGTGGT C_porcellus300402 ----AGCCTTTGTGTTGCCCATTCACCTTGGAAAGC-TAGTGAATGTGGT C_porcellus300410 ----AGCCTTTGTGTTGCTCATTCACTTTTGAAAGC-TAGTGAATGTGGT D_rerio300200 --TGCCTTTTAGTGTTGCCTGTTCATCATTGCTTGTCAGATGAATGTGGT D_rerio300201 --TGCCTT--TGTGTTGCCCATTCATTTCCTATTA---GATGAATGTGGT D_rerio300239 --AGCCTTTATGTGTTGCCTGTTCATTTCCTTTTCA-GAATGAACATGGT D_rerio300276 --TGCCTTT-TGTGTTACCCATTCTTTTCACATTCCCTGAAGAATGTGGT D_novemcinctus300181 GGCCTTTGTGTTTTCCATCCGAGTTGGGGGGAAACT-A-GTGAATGTGGT E_telfairi300003 ----GGCCTTTGTGTTGCCC-TTCGCTTTTGGAAAC-TAGTGAACGTGGT E_telfairi300008 ----AGTCTTTATACTGACCATCCACTTTCGGAAAC-TAGTGTATGTGGT E_telfairi300039 ----GGCCTTTGTGTTGCCCGTTCGCTTTCGGAAAC-TAGTGAACGTGGT E_telfairi300225 ----GACCTTTGTGTTGCCCGTTCA-TTTCAGAAAC-TCGTGAGTGGGGT E_telfairi300227 ----AGCCTTTGTGTTGCCCGTTCACTTTCAGAAAC-TAGTGAATGTGGT E_telfairi300267 ----GGCCTTTGTGTTGCCCATTCACGTACGGAAAC-TAGTGAGCGTGGT E_telfairi300313 ----GGCCTTTGTGTTGCCCATTCACTTTCGGAAAC-TTGGGAAAGTGGT E_telfairi300438 ---------ATGGCTTGTCAAGAATACGCATAAGTT-GTGTGAATGTGGT E_telfairi300613 ----GGCTTTTGTGTTGCCCCTTCGCTTTCAGAAAC-TAGTGAACGTGGT E_telfairi300641 ----AGCCTGTGTGTTGCCCGTTCGCTTTCGGAAAC-TAGTGAACGTG-T E_telfairi300799 ----GGCCTTTGTGTTGCCCATTCACTTTCGGAAAC-TTGTGAATGTGGT E_telfairi300824 ----GGCCTTTATGTTGCCCCTTCACTTCTGGAAAG-TAGTGAATGTGGT E_telfairi300839 ----GGCCTTTGTGTTGCCCATTTACTTTCGGAAAC-TTGTGAATGTGGT E_caballus300119 ----AGCCTTTGTGTTGCCCATTCACTTTTG-AAAC-TAGTGAATGTGGT E_europaeus300394 ----AGCCTTTGTGTTGCCCATTCACTTT-GGAAAC-TAGTGGATGTGGT E_europaeus300699 ----AGCCTTTGTGTTGCCCATTCACTTTCGGAAAC-TAGTGAATGTGGT F_catus300058 ----AGCCTTTGTGTTGCCAATTCACTTTTGGAAAC-TAGTGAATGTGGT H_sapiens300438 ----AGCCTTTGTGTTGCCCATTCACTTT-GGAAAC-TAGTGAATGTGGT L_africana300057 ----AGCCTTTGTGCTGTCCATTCACTTTTGCAAGC-TTGCCGATGTGGT L_africana300199 ----AGCCTTTGTGTTGCCCGTTCACTTTCGGAAAC-TAGTGAATGTGGT L_africana300511 ----GACCTGTGGGTTGCCCATTCGCTTGCAGAAAC-CAGTGAATGTGGT M_mulatta300431 ----AGCCTTTGTGTTGCCCATTCACTTT-GGAAAC-TAGTGAATGTGGT M_murinus300040 ----TAGCTTTCTGTTGCCTGTTTACTTTCAAAA-C-TAGTGAATGTGGT M_murinus300229 -------------------AGAAAAAAAAAAGAAAT-A-AAGAAAGAAAG M_murinus300414 ----AGCCTTTGTGTTGCCCATTCACTTTCGAAA-C-TAGTGGATGTGGT M_domestica300052 ----GCCTTTTGTGTTGCCCGTTCACTTTGGCCA-C-TGGTGCACGAGGT M_musculus300451 ----AGCCTTTGTGTTGCCCGTTCACTTT-GGTCGC-TAGTGAATGTGGT M_musculus300609 -----ATAAAGAAAATATCCAATTTAAAAAATGGAA-A-GGGAATGTGGT M_musculus300763 ----AGCCTTTGTGTTGCCCATTCACTTTTGGTCAC-TAGTGAATGTGGT M_lucifugus300633 ----AGCCTTTGTGTTGCCCATTCACTTTTGGAAAC-TAGTGAATGTGGT O_anatinus302353 ---------------------------TGCTACGG--TAATGACTGGGGT O_anatinus303868 ----TGCCTTGGTGTTGCCCATTCATTTGTGACGG--TGATGATTTGGGT O_anatinus304463 ---TGCCTTTTGTGTTGCCCGTTCATTTTTGGTTAC-TGATGAATGTGGT O_anatinus304539 ----TGCCTTTGTGTTGCCCATTCATTTGTTACGG--TAATGACTGGGGT O_anatinus304540 ---TGCCTTTTGTGTTGCCCGTTCACTTTTGGCTGC-TAGTGAATGTGGT O_cuniculus300000 ----AGCCTTCGTGTTGCCCGTTCGCTCTTGCAAAC-TGGCGAATGTGGT O_cuniculus300438 ----GGCCTTTGTGTTGCCCCTTCGCTCATGGAAAC-TAGTGAATGTGGG O_cuniculus300499 ----AGCATTTGTATTGCCTGTTCGCTTTTGGAAAT-GAGTGAATGTGGT O_garnettii300118 --------------------GACAAGAGGATTGCTT-G-ATCACAAGAGT O_garnettii300354 ----CCCCTTTGTGTT-CCCATTCACTTT-GGAAAC-TAGTGGATATGGT O_garnettii300415 ----AGCCTTTGTGTTGCCCATTCACTTTGGAAA-C-TAGTGGATGTGGT O_garnettii300650 GGCATTTCTTCCTCTTTGCCAAGAGAAAAGGGAGGT-G-ATGGATGTGGT P_troglodytes300333 ----AGCCTTTGTGTTGCCCATTCACTTT-GGAAAC-TAGTGAATGTGGT P_pygmaeus300555 ----AGCCTTTGTGTTGCCCATTCACTTT-GGAAAC-TAGTGAATGTGGT R_norvegicus300163 ----AGCCTTTGTGTTGCCTGTTCACTTTTGGTCAC-TAGAGAATATGGT R_norvegicus300214 ----AGCCTTTGTGTTGCCCGTTCACTTTTGGTCAC-TAGTGAATGTGGT R_norvegicus300458 ---------AAGCTCTGAGTGCCTGCAAAAAGAAAC-A-GGAGATGTGGT S_cerevisiae300063 ATACAAAATTAATCGTGCGGATTAATAATCCAGGACTATAAAACCGTGTT S_araneus300994 ----CGCCTTTGTGTTGCCCATTTAC-TTTGGAAGC-TAGTGAATGTGGT S_tridecemlineatus300044 ----AGCCTTTGTGTTGCCCGTTCACTTTTGTAAAC-TAGTGAATGTGGT T_nigroviridis300063 --TGCCTTTATGTGTTGCTCTGTCATTGTTGA---CGTAATGACCAGGGT T_nigroviridis300120 --TGCCTTCTCGTGTTGCCCGTTTGCTGTCTCCTAC--AGCGAATGCGGT T_nigroviridis300137 --TGCCTTCTCGTGTTGCCCGTTTGCTGTCTCCTAC--AGCGAATGCGGT C_familiaris300000 GTCAA--AAAAAGCAGAATCTAAA--CACTTTG---CAGCC-TTTTCCTG C_familiaris300208 GTCAG--AAAAGGCGGA-AAGCAA--GGCCCTGG--CGGCG--CTTCCTG C_porcellus300084 GTC-AA-AAAAGGCATAAATAAAA---GCTTTG---TAGCT-TTTTCCTG C_porcellus300095 GTCAA--AACAGGCATAAATAAAT--GTCTTA-----ATTATTTT-CCTG C_porcellus300335 GTC-AA-AAAAGGCATAAATAAAA----CTTTG---CAGCT-TTTTCCTG C_porcellus300402 GTC-AA-AAAAGGCATAAATAAAA---GCTTTG---CAGCT-TTTTCCTG C_porcellus300410 GTCCAA-AAAAAGCATTGATAAAA---GCTTTG---CAGCT-TTTCCCTG D_rerio300200 GTCAA--ATAGGGCATACATTAAT---ACAT-GACATGGCCACTGAAAGG D_rerio300201 GTCAA--CTAAGGCACACATTAA----ACCTTGAAATAGCCAAAGAGAGG D_rerio300239 GTCAG--AAAAGGCGCACATTAAC----TCTTATTGTGATC-TTAAATGG D_rerio300276 GTCAA--AAAAGGCATACAGTAAT---ACTCTTGGTTAGGCATTTACAAA D_novemcinctus300181 GTCAA--AAAAAGGTCCCTTGAAAATTCTTTTG---CAGCC-TATTCCTG E_telfairi300003 GTCAG--AAAAGGTACAAATTAAACACCCTGTC----AGCCATGTT-CTG E_telfairi300008 GTCAA--AAAAGGCACAAATTAAACACTCTCGC----GGCCACACT-CTG E_telfairi300039 GTCAA--AAAAGGCGCAAATGAAACACCCTGGC----AGCCACGTC-CTG E_telfairi300225 GTCAAC-AAAAGGCAGATGTTCACCTCTCTGTG----GGTG--GTTTCTG E_telfairi300227 ATCAA--AAAAGGCGCAAATTAACA------------AGCGGCCATCCAG E_telfairi300267 GTCAA--GAAAGGTGCAAGTTAAACACCCTCACTCACAGCCACGTT-ATG E_telfairi300313 GTCAA--AAAAG-CATAAATTACATGCTTTTGC----AGCC--ATTTTTG E_telfairi300438 GTCAA--AAAAGGCATAAATTAAA--TTCTTTT---GCAGC-CATTATTG E_telfairi300613 GTCAA--AAAAGGCCCAAATTAACCACCGTGGC----AGCCACGTT-CTG E_telfairi300641 GTCAA--A---GGCGCAAAGTAAACACCCTGGC----AGCCACGTTTCTG E_telfairi300799 GTCAA--AAAAGGCATAAATCAAATTCTTTTGC----AGCC--ATTACTG E_telfairi300824 GTCCAA-AAAAAGTGTGAATTAAA--CTTTTTG---CAATC-ATTTCTTG E_telfairi300839 GTCAA--AAAAGGCATAAATTAAAT-TCTTTTG---CAGCC--CCTCCCC E_caballus300119 GTCAA--AAAAGGCGCAAACTAAA--CACTTGG---CAGCT-TTTTCCTG E_europaeus300394 GTCAA--AAAAGGCTCAAATCGAA--CACTTAT---CAGGCTTTT-CCTG E_europaeus300699 GTCAA--AAAAGGCATACATT-AA--CACTTAG---CAGGCTTTTTCCTG F_catus300058 GTCAA--AAACGGTGGAA---------GCTTTG---CAGCC-TTTTCCTG H_sapiens300438 GTCAA--AAAAGGCGTAAATTAAA--CGCTTTG---CAGCC-TTTTCCTG L_africana300057 GTCAA--AAAAGCTGCAAATTAAACTCTTTGCT-----GCCATTTT-CTG L_africana300199 GTCAA--AAAAGGCGTAAATTAAA--CCCTTTG---CAGCCATTTT-CTG L_africana300511 GTCAA--AA--GGCATCAATTAAA--TTCTTTG---CAGCC-ATTTCCGG M_mulatta300431 GTCAA--AAAAGGCGTAAATTAAA--CGCTTTG---CAGCC-TTTTCCTG M_murinus300040 GTCAA--AA-ATGTGTAAATTAAA--CACTTAT---CAGCATTTT-CCTG M_murinus300229 GCTAG--GT--CCT-TAAATTAAA--TGCTTTG---CAGCC-TTTTCCTG M_murinus300414 GTC-AA-AAAAGGCATAAATTAAAT--ACTTTG---CAGCC-TTTTCCTG M_domestica300052 GTCAA--AAAAGGCGCAAAG-GAA--GACTTTG---CAGCC-TCCTCTCG M_musculus300451 GTCAG--AAAAGGCATAAATAAAT---GCTTTG---CGGCC-TTTGCTTG M_musculus300609 GTCAA--AAAAGGCATAAATAAA---TGCTTTT---CGGCC-TTTCCTGT M_musculus300763 GTCAA--AAAAGGCATAAATAAAT---GCTTTG---CGGCC-TTTCCTGT M_lucifugus300633 GTCAA--AAAAGGCATAAACTACA--CACTTTG---CAACC-CTTTCCTG O_anatinus302353 GTCAA--AAGAGGCACAAATTATA--TGCTCTG---CAGCA-TGTTTGAT O_anatinus303868 GTCAA--GAGAGGCATAAATTAGG--TGCTCTG---CAGCG-TGTTTGAT O_anatinus304463 GTCAA--AAAAGGCGCAAATGAAA--CTCTTGG---CAGCTCTGTTTCAC O_anatinus304539 GTCAA--AAGAGGCATAAATTATA--CACTCTG---CAGCA-TGTTGGGT O_anatinus304540 GTCAA--AAAAGGCGCAAATCAAA--TCCGTGG---CAGCCCTATTT--T O_cuniculus300000 GTCAA--AGAAGGCGCACAGTGAA--TGCTTGC---CAGCC-TTTTCCTG O_cuniculus300438 GTCAA--AAAAGGCATACAGGGAA--TGCTTTGC--AACCT--TTTCCTG O_cuniculus300499 GTCAA--GAAAGGCAAACAGGGAA--TACTTTG---CAGCC-TTTTCTGG O_garnettii300118 TTGAG--AA--GGTGTAAATTAAA--C-CTTTG---CAGCC-TTTTCCTG O_garnettii300354 TTCAA--AAAAGGCATAAATTAAA--CACTTTG---CAGCCTTTT-CCTG O_garnettii300415 GTC-AA-AAAAGGCGTACATTAAAT--GCTTTG---CGGCC-TTTTCCTG O_garnettii300650 GTCAA--AAAAGGCGTAAATTAAA--TACCTTG---CAGTC-TTTCCCTG P_troglodytes300333 GTCAA--AAAAGGCGTAAATTAAA--CGCTTTG---CAGCC-TTTTCCTG P_pygmaeus300555 GTCAA--AAAAGGCGTAAATTAAA--CGCTTTG---CAGCC-TTTTCCGG R_norvegicus300163 GTCAAAGAAAAGGCATAAATTAAT---GCTTTG---TAGCC-TTTCCTTT R_norvegicus300214 GTCAA--AAAAGGCATAAATTAAT---GCTTTG---CGGCC-TTTCCTCT R_norvegicus300458 GTCAA--AAAAGGCATAAGTTAA---TGCTTTG---CGGCT-TTTCCTTT S_cerevisiae300063 GTTTATATCGAGTCTCTTTTGGTATAAGCGTCAAGTCCATCGGAGAGATC S_araneus300994 GTCAA--GAAAGGCGTA-AAGTAA--GCCCTTGG--CAGGG--TTTTCCT S_tridecemlineatus300044 GTCAA--AAAAGGCACA-AATAAA--TACTTTG---CAGCC-TTTTCCTG T_nigroviridis300063 GTCAA--GCGAGGCATACAGAAAC---ACATGTGGCTGCCTGTGGAAAGA T_nigroviridis300120 GTCGA--TAAAGGCAAACATCAAT---GTTTTGGATTGGCCTAAGCAAGG T_nigroviridis300137 GTCGA--TAAAGGCAAACATCAAT---GTTTTGGATCGGCCTAAGCAAGG C_familiaris300000 TCCTTGAATTTT--------------TGGTGT-AGGAGCTGTATA-A-GT C_familiaris300208 CCC--GGACCGT-------GGGTCT---GGGGCGCGCGCCGC-CG-GGTC C_porcellus300084 CCCTTATATTT-------GGTATATTTGGTGT-AGGAGCTACACA-AGTA C_porcellus300095 ACCTTATATTGG-------ATATATTTGGTGC-AGGAACAGCATA--GTA C_porcellus300335 CCCTTATATTT-------GGTATATTTGGTGT-AGGAGCTGCACA-AGTA C_porcellus300402 CCCTTGTATTT-------GGTATATTTGGTGT-AGGAGCTGCACA-AGTA C_porcellus300410 CCCATGTATTT-------GGTATAGTTGGTGT-AGGAGCTGCACA-AGCA D_rerio300200 TATCTCCATCC---------TTGCCTT-TCAG-AGGCTTCATGTAATGGA D_rerio300201 ACCGGCCACTCG--------TTCTCTTGCTT----GTGCTGTAACAAGAA D_rerio300239 TTGTCAAAGTA------------CTTCCGTTAAATAAGCTCAACAATAAG D_rerio300276 GTG------ATT--------TCTCTGTATCAC-GCTGTCTAAAGCTCAAA D_novemcinctus300181 TCCTTGAA-TTT------ATTGTGTTTGGTGT-AAGAGCTGCATA-GGTA E_telfairi300003 CTTTTGAA-TTC------GGTTTCTTTGGCGT-CGGAGCTGCATA-AGGA E_telfairi300008 CTTTTGAA-TTT------GGTGTCTTTGGCAT-AAGAGCTGCATA-AGGA E_telfairi300039 CCTTTGAA-TTC------GGTTTCTTTGGCGT-CGGAGCTGCGTA-AGGA E_telfairi300225 CCCTTGAA-TTT------GGTGTCTTTGGTAC-AAGAACTGCTTA-CGTA E_telfairi300227 CTGAGAAGCACACC----AGACTGTCTGACTA--CGAGGTGCAGA-AGGG E_telfairi300267 CTTTTGAA-TTT------GGTTTCTTTGGCAT-AGGAGCTGCCTA-AGGA E_telfairi300313 CCCTTGAATTTT------GGTTTCTTTGGCGG-AGGCACTGCATA-AGAA E_telfairi300438 CCCTTGAA-TTT------GGTTTCTTTGGCAT-AGGTGCTGCATA-AGGA E_telfairi300613 CCTTTGAA-TTC------GGTTTCTTTGGCGT-GGGAACTGCATA-AGGA E_telfairi300641 CTTTTGAAATTC------AGTTTCTTTGGCAT-CTGAGCTGCATA-AGGA E_telfairi300799 CCCTTGAATTT-------GGTTTCTTTGGCGT-AGGCGTTGCATA-AGGA E_telfairi300824 CCCTTGAA-TTT------TGTGTCTTTGGTGT-AGAAGCTGCGTA-AGTA E_telfairi300839 CCCCCCAATTTAAATA--CACATCTTTCATTT----CTCAGCATA--AGC E_caballus300119 CCCTTGAATTTG-------ATATCTTTGGTGT-AGAAGCTGCATA-A-GT E_europaeus300394 CCTTTGATTTTG-------ATGTCTTAGGCAT-AGGAACTGCATA-AGTA E_europaeus300699 CCTTTGAACTTG-------ATGTCATGGGCTT-AGGAACTGCCTA-AGTA F_catus300058 CCCTTGAATTTTAATTTGAATATTGTTGGTGT-AGGAGCTGGATA-AAGT H_sapiens300438 CCCTTAAA-TTT------GATACCTTTGGTGT-AGGAGCTGCATA-AGTA L_africana300057 CCCTTGAA-TTT------GGTGTCTTTGGTGT-TGGGGCTGCATC-AGAT L_africana300199 CCCTTGAA-TTT------GATTTCTTTGGTGT-AGGAGCTGCGTA-AGTT L_africana300511 CCCTTGAA-CTT------GATATCTTTGATGT-AGGAACTGCATG-AGTT M_mulatta300431 CCCTTGAA-TTT------GGTATCTTTGGTGT-AGGAGCTGCATA-AGTA M_murinus300040 TTCT----------------TAAATTTGGTGT-AGGAGCTGCGTA-AGTA M_murinus300229 CCCTTAAA-TTT------GGTATCTTTGGTGT-AGGAGCTGCATA-AGAA M_murinus300414 CCCTTAAATTT-------GATATCTTTGGTGT-AGGAGCTGCATA-AGTA M_domestica300052 GCAGGCATCTGC-------GTGCCTTGGCCGA-GTGTGCTGGCAA-AGTG M_musculus300451 CCCTGGAGTTC-------GGTATCTCGGGTGT-AGGAGCTGCATA-AGTT M_musculus300609 CTCTGGAG-TTT------GGTATCTTGGGTGT-AGGAGCTGCATA-AGTA M_musculus300763 CCCTGGAGTTT-------GGTATCTTGGGTGT-ACGAGCTGCATA-AGTA M_lucifugus300633 CCCTTGAATTTG-------ATGTCTTTGGTGG-AGGAGCTGTGTA-A-GT O_anatinus302353 TTT-AGGAGTTA--------CTTCCTTTATTC-TTTTGCTGCTTTTGAGG O_anatinus303868 TTT-AGGAGTTA--------CTTCCTTTCTTC-TTTCGCTGCTCT-GAGG O_anatinus304463 CCTAGGTTTCCG--------TTCCTTTGGTGC-TTTTGCTGC----GAGG O_anatinus304539 TTTTAGGAGTTA--------CTTCCTTTCTTC-TTTTGCTGCTTTTGAGG O_anatinus304540 CACTGGATTCTA--------TTCCTGTGGTGT-ACTTGCTGCAC---AGG O_cuniculus300000 CTCCTGATGTG--------GTGCCTTGGCTGC-G---GCAGGGGA-AGTG O_cuniculus300438 CCCTTAGACTGT-------GTATCTTCCGGGCAGGACTCCCA-CA-AGTA O_cuniculus300499 CCCTTAGGTTTG-------GTATCTTCCGTGC-AGGAACTGTACA-A-GT O_garnettii300118 CCCTTAAA-TTT------GATATCTTTGGCGT-AGGGACTGCATA-AGTA O_garnettii300354 ATTTTAAACGTG-------GTCTCTTTGGAGT-AAAGGCTGCATA-AGTA O_garnettii300415 CCCTTAAATCT-------GGTATTTTTGGTGT-AGGAGCTGCATA-AGTA O_garnettii300650 CCCTTAAA-TTT------GGTATCTTTGGTGT-AGGGACTACATA-AGGG P_troglodytes300333 CCCTTGAA-TTT------GATATCTTTGGTGT-AGGAGCTGCGTA-AGTA P_pygmaeus300555 CCCTTAAA-TTT------GGTATCTTTGGTGT-AGGAGCTGCATA-AGTA R_norvegicus300163 CCCTGGAGTTT-------GGTATCTTGGGTGT-AGGAGCTGCATA-AGTA R_norvegicus300214 CCCTGGAGTTT-------GGTATCTTGGGTTTCAGGAGCTGCATA-AGTA R_norvegicus300458 CCCTGGAG-TTT------GGTATCTTGGGTTTCAGGAGCTGCATA-AGTA S_cerevisiae300063 ATCATTTTGTTCATCTTAATGCCCTTTTGTGTAGGAAATTGAGGGAAGTT S_araneus300994 GCTTGTGACCCT-------GCTGTCTCAGGCACAGGAACTGCACA-AGGA S_tridecemlineatus300044 CCCTTAAATTTT-------ATATTTTTGGTGT-AGGAACTGCATA-A-GT T_nigroviridis300063 GTTT----CAGT--------TAACTCCCTAAA-GCAGCCAGCTGCACGAA T_nigroviridis300120 TTCTACC-CCAG--------TAGCCTTGTCTT-AAGTTCTATACCAAGAA T_nigroviridis300137 TTCTACC-CCAG--------TAGCCTTGTCTT-AAGTTCTATACCAAGAA C_familiaris300000 AACAGTT------------------------------------------- C_familiaris300208 -ACAGTT------------------------------------------- C_porcellus300084 -ACAGTT------------------------------------------- C_porcellus300095 -ACAACT------------------------------------------- C_porcellus300335 -ACAGTT------------------------------------------- C_porcellus300402 -ACAGTT------------------------------------------- C_porcellus300410 -ACAGTT------------------------------------------- D_rerio300200 CACTT--------------------------------------------- D_rerio300201 CAACA--------------------------------------------- D_rerio300239 AACATGA------------------------------------------- D_rerio300276 CCAAGTACAACA-------------------------------------- D_novemcinctus300181 -ACAGTT------------------------------------------- E_telfairi300003 -ACAGTT------------------------------------------- E_telfairi300008 -ACGGTT------------------------------------------- E_telfairi300039 -ACAGTT------------------------------------------- E_telfairi300225 -ACAGTT------------------------------------------- E_telfairi300227 ACCAGT-------------------------------------------- E_telfairi300267 -ACAGTT------------------------------------------- E_telfairi300313 -ACAGTT------------------------------------------- E_telfairi300438 -ACAGTT------------------------------------------- E_telfairi300613 CACAGTT------------------------------------------- E_telfairi300641 -ACAGTT------------------------------------------- E_telfairi300799 -ACAGTT------------------------------------------- E_telfairi300824 -ACTGTT------------------------------------------- E_telfairi300839 TCCAACA------------------------------------------- E_caballus300119 AACAGTT------------------------------------------- E_europaeus300394 -ACAGCA------------------------------------------- E_europaeus300699 -ACAATA------------------------------------------- F_catus300058 AAGAGTT------------------------------------------- H_sapiens300438 -ACAGTT------------------------------------------- L_africana300057 -ACAGCT------------------------------------------- L_africana300199 -ACAGTT------------------------------------------- L_africana300511 -ACAGTT------------------------------------------- M_mulatta300431 -ACAGTT------------------------------------------- M_murinus300040 -ACAGTT------------------------------------------- M_murinus300229 -ATAGTT------------------------------------------- M_murinus300414 -ACAGTT------------------------------------------- M_domestica300052 -ACAGTC------------------------------------------- M_musculus300451 -ACAGAA------------------------------------------- M_musculus300609 -ACAGTA------------------------------------------- M_musculus300763 -ACAGTA------------------------------------------- M_lucifugus300633 AACAGTT------------------------------------------- O_anatinus302353 GACATTG------------------------------------------- O_anatinus303868 GACATTG------------------------------------------- O_anatinus304463 AACATAT------------------------------------------- O_anatinus304539 GACATCC------------------------------------------- O_anatinus304540 AACATGG------------------------------------------- O_cuniculus300000 -CGTCCC------------------------------------------- O_cuniculus300438 -ACTGTT------------------------------------------- O_cuniculus300499 AACAGTT------------------------------------------- O_garnettii300118 -ACAGTC------------------------------------------- O_garnettii300354 -ATAAGT------------------------------------------- O_garnettii300415 -ACAGTT------------------------------------------- O_garnettii300650 -GCAGTC------------------------------------------- P_troglodytes300333 -ACAGTT------------------------------------------- P_pygmaeus300555 -ACAGTT------------------------------------------- R_norvegicus300163 -ACAAAG------------------------------------------- R_norvegicus300214 -ACAGAA------------------------------------------- R_norvegicus300458 -ACAGAA------------------------------------------- S_cerevisiae300063 TAGGCTTCTCAACATTTTAAGACGCCTATGCAAGGGCTGGTAGGACAGAC S_araneus300994 -ATAGGA------------------------------------------- S_tridecemlineatus300044 GACAGTT------------------------------------------- T_nigroviridis300063 CACAC--------------------------------------------- T_nigroviridis300120 CACTT--------------------------------------------- T_nigroviridis300137 CACTT--------------------------------------------- C_familiaris300000 ---- C_familiaris300208 ---- C_porcellus300084 ---- C_porcellus300095 ---- C_porcellus300335 ---- C_porcellus300402 ---- C_porcellus300410 ---- D_rerio300200 ---- D_rerio300201 ---- D_rerio300239 ---- D_rerio300276 ---- D_novemcinctus300181 ---- E_telfairi300003 ---- E_telfairi300008 ---- E_telfairi300039 ---- E_telfairi300225 ---- E_telfairi300227 ---- E_telfairi300267 ---- E_telfairi300313 ---- E_telfairi300438 ---- E_telfairi300613 ---- E_telfairi300641 ---- E_telfairi300799 ---- E_telfairi300824 ---- E_telfairi300839 ---- E_caballus300119 ---- E_europaeus300394 ---- E_europaeus300699 ---- F_catus300058 ---- H_sapiens300438 ---- L_africana300057 ---- L_africana300199 ---- L_africana300511 ---- M_mulatta300431 ---- M_murinus300040 ---- M_murinus300229 ---- M_murinus300414 ---- M_domestica300052 ---- M_musculus300451 ---- M_musculus300609 ---- M_musculus300763 ---- M_lucifugus300633 ---- O_anatinus302353 ---- O_anatinus303868 ---- O_anatinus304463 ---- O_anatinus304539 ---- O_anatinus304540 ---- O_cuniculus300000 ---- O_cuniculus300438 ---- O_cuniculus300499 ---- O_garnettii300118 ---- O_garnettii300354 ---- O_garnettii300415 ---- O_garnettii300650 ---- P_troglodytes300333 ---- P_pygmaeus300555 ---- R_norvegicus300163 ---- R_norvegicus300214 ---- R_norvegicus300458 ---- S_cerevisiae300063 ATGC S_araneus300994 ---- S_tridecemlineatus300044 ---- T_nigroviridis300063 ---- T_nigroviridis300120 ---- T_nigroviridis300137 ----

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved