snOPY snoRNA Orthological Gene Database

Family: SNORA13

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300000 -----TGCCTT--TGTGTTGCCCATTCTTTTTTGGAAAC-TTGCGAATGT C_familiaris300208 -----GGCCTT--TGTGTTGCCCGTTCACCTTCCGAAAC-TGGTGAACGC C_porcellus300084 -----AGCCTT--TGTGGTGCCCATTCACTTTTGAAAGC-TAGTGAATGT C_porcellus300095 -----AGTCTT--TGTATTGCCCATTTACTTTTAAAAAC-TAGTAAATAC C_porcellus300335 -----AGCCTT--TGTGTTGCCCCTTCACCTTGGAAAGC-TAGTGAATGT C_porcellus300402 -----AGCCTT--TGTGTTGCCCATTCACCTTGGAAAGC-TAGTGAATGT C_porcellus300410 -----AGCCTT--TGTGTTGCTCATTCACTTTTGAAAGC-TAGTGAATGT D_rerio300200 -----TGCCTTTTAGTGTTGCCTGTTCATCATTGCTTGTCAGATGAATGT D_rerio300201 -----TGCCTT--TGTGTTGCCCATTCATTTCCTATTA---GATGAATGT D_rerio300239 -----AGCCTTTATGTGTTGCCTGTTCATTTCCTTTTCA-GAATGAACAT D_rerio300276 -----TGCCTTT-TGTGTTACCCATTCTTTTCACATTCCCTGAAGAATGT D_novemcinctus300181 --GGCCTTTGT--GTTTTCCATCCGAGTTGGGGGGAAAC-TAGTGAATGT E_telfairi300003 -----GGCCTT--TGTGTTGCCC-TTCGCTTTTGGAAAC-TAGTGAACGT E_telfairi300008 -----AGTCTT--TATACTGACCATCCACTTTCGGAAAC-TAGTGTATGT E_telfairi300039 -----GGCCTT--TGTGTTGCCCGTTCGCTTTCGGAAAC-TAGTGAACGT E_telfairi300225 -----GACCTT--TGTGTTGCCCGTTCA-TTTCAGAAAC-TCGTGAGTGG E_telfairi300227 -----AGCCTT--TGTGTTGCCCGTTCACTTTCAGAAAC-TAGTGAATGT E_telfairi300267 -----GGCCTT--TGTGTTGCCCATTCACGTACGGAAAC-TAGTGAGCGT E_telfairi300313 -----GGCCTT--TGTGTTGCCCATTCACTTTCGGAAAC-TTGGGAAAGT E_telfairi300438 ---------AT--GGCTTGTCAAGAATACGCATAAGTTG-TGTGA-ATGT E_telfairi300613 -----GGCTTT--TGTGTTGCCCCTTCGCTTTCAGAAAC-TAGTGAACGT E_telfairi300641 -----AGCCTG--TGTGTTGCCCGTTCGCTTTCGGAAAC-TAGTGAACGT E_telfairi300799 -----GGCCTT--TGTGTTGCCCATTCACTTTCGGAAAC-TTGTGAATGT E_telfairi300824 -----GGCCTT--TATGTTGCCCCTTCACTTCTGGAAAG-TAGTGAATGT E_telfairi300839 -----GGCCTT--TGTGTTGCCCATTTACTTTCGGAAAC-TTGTGAATGT E_caballus300119 -----AGCCTT--TGTGTTGCCCATTCACTTTTG-AAAC-TAGTGAATGT E_europaeus300394 -----AGCCTT--TGTGTTGCCCATTCACTTT-GGAAAC-TAGTGGATGT E_europaeus300699 -----AGCCTT--TGTGTTGCCCATTCACTTTCGGAAAC-TAGTGAATGT F_catus300058 -----AGCCTT--TGTGTTGCCAATTCACTTTTGGAAAC-TAGTGAATGT H_sapiens300438 -----AGCCTT--TGTGTTGCCCATTCACTTT-GGAAAC-TAGTGAATGT L_africana300057 -----AGCCTT--TGTGCTGTCCATTCACTTTTGCAAGC-TTGCCGATGT L_africana300199 -----AGCCTT--TGTGTTGCCCGTTCACTTTCGGAAAC-TAGTGAATGT L_africana300511 ----GACCTGT--GGGTTGCCCATTCGCTTGCAGAAACC-AGTGA-ATGT M_mulatta300431 -----AGCCTT--TGTGTTGCCCATTCACTTT-GGAAAC-TAGTGAATGT M_murinus300040 -----TAGCTT--TCTGTTGCCTGTTTACTTTCAAAA-C-TAGTGAATGT M_murinus300229 -------------------------AGAAAAAAAAAAGA-AATAAAGAAA M_murinus300414 -----AGCCTT--TGTGTTGCCCATTCACTTT-CGAAAC-TAGTGGATGT M_domestica300052 -----GCCTTT--TGTGTTGCCCGTTCACTTTGGCCA-C-TGGTGCACGA M_musculus300451 -----AGCCTT--TGTGTTGCCCGTTCACTTT-GGTCGC-TAGTGAATGT M_musculus300609 ATAAAGAAAAT--ATCCAATTTAAAAAATGGAAAGGGA--------ATGT M_musculus300763 -----AGCCTT--TGTGTTGCCCATTCACTTTTGGTCAC-TAGTGAATGT O_anatinus302353 ------------------------------TGCTACGG--TAATGACTGG O_anatinus303868 -----TGCCTT--GGTGTTGCCCATTCATTTGTGACGG--TGATGATTTG O_anatinus304463 ----TGCCTTT--TGTGTTGCCCGTTCATTTTTGGTTAC-TGATGAATGT O_anatinus304539 -----TGCCTT--TGTGTTGCCCATTCATTTGTTACGG--TAATGACTGG O_anatinus304540 ----TGCCTTT--TGTGTTGCCCGTTCACTTTTGGCTGC-TAGTGAATGT O_cuniculus300000 -----AGCCTT--CGTGTTGCCCGTTCGCTCTTGCAAAC-TGGCGAATGT O_cuniculus300438 -----GGCCTT--TGTGTTGCCCCTTCGCTCATGGAAAC-TAGTGAATGT O_cuniculus300499 -----AGCATT--TGTATTGCCTGTTCGCTTTTGGAAAT-GAGTGAATGT O_garnettii300118 --------------------------GACAAGAGGATTG-CTTGATCACA O_garnettii300354 -----CCCCTT--TGTGTT-CCCATTCACTTT-GGAAAC-TAGTGGATAT O_garnettii300415 -----AGCCTT--TGTGTTGCCCATTCACTTT-GGAAAC-TAGTGGATGT O_garnettii300650 --GGCATTTCT--TCCTCTTTGCCAAGAGAAAAGGGAGG-TGATGGATGT P_troglodytes300333 -----AGCCTT--TGTGTTGCCCATTCACTTT-GGAAAC-TAGTGAATGT P_pygmaeus300555 -----AGCCTT--TGTGTTGCCCATTCACTTT-GGAAAC-TAGTGAATGT R_norvegicus300163 -----AGCCTT--TGTGTTGCCTGTTCACTTTTGGTCAC-TAGAGAATAT R_norvegicus300214 -----AGCCTT--TGTGTTGCCCGTTCACTTTTGGTCAC-TAGTGAATGT R_norvegicus300458 ----AAGCTCT--GAGTGCCTGCAAAAAGAAACAGGAG--------ATGT S_cerevisiae300063 -ATACAAAATT--AATCGTGCGGATTAATAATCCAGGACTATAAAACCGT S_araneus300994 -----CGCCTT--TGTGTTGCCCATTTAC-TTTGGAAGC-TAGTGAATGT S_tridecemlineatus300044 -----AGCCTT--TGTGTTGCCCGTTCACTTTTGTAAAC-TAGTGAATGT T_nigroviridis300063 -----TGCCTTTATGTGTTGCTCTGTCATTGTTGA---CGTAATGACCAG T_nigroviridis300120 -----TGCCTTCTCGTGTTGCCCGTTTGCTGTCTCCTAC--AGCGAATGC T_nigroviridis300137 -----TGCCTTCTCGTGTTGCCCGTTTGCTGTCTCCTAC--AGCGAATGC C_familiaris300000 GGTGTC-AA-AAAAAGCAGAATCTAAA--CACTTTG---CAGCC-TTTTC C_familiaris300208 GGTGTCAG--AAAAGGCGGA-AAGCAA--GGCCCTGG--CGGCG--CTTC C_porcellus300084 GGTGTC-AA-AAAAGGCATAAA-TAAA--AGCTTTG---TAGCT-TTTTC C_porcellus300095 GGTGTCAA--AACAGGCATAAATAAAT--GTCTTA-----ATTATTTT-C C_porcellus300335 GGTGTC-AA-AAAAGGCATAAA-TAAA--A-CTTTG---CAGCT-TTTTC C_porcellus300402 GGTGTC-AA-AAAAGGCATAAA-TAAA--AGCTTTG---CAGCT-TTTTC C_porcellus300410 GGTGTCCAA-AAAAAGCATTGA-TAAA--AGCTTTG---CAGCT-TTTCC D_rerio300200 GGTGTCAA--ATAGGGCATACATTAAT---ACAT-GACATGGCCACTGAA D_rerio300201 GGTGTCAA--CTAAGGCACACATTAA----ACCTTGAAATAGCCAAAGAG D_rerio300239 GGTGTCAG--AAAAGGCGCACATTAAC----TCTTATTGTGATC-TTAAA D_rerio300276 GGTGTCAA--AAAAGGCATACAGTAAT---ACTCTTGGTTAGGCATTTAC D_novemcinctus300181 GGTGTCAA--AAAAAGGTCCCTTGAAAATTCTTTTG---CAGCC-TATTC E_telfairi300003 GGTGTCAG--AAAAGGTACAAATTAAACACCCTGTC----AGCCATGTT- E_telfairi300008 GGTGTCAA--AAAAGGCACAAATTAAACACTCTCGC----GGCCACACT- E_telfairi300039 GGTGTCAA--AAAAGGCGCAAATGAAACACCCTGGC----AGCCACGTC- E_telfairi300225 GGTGTCAAC-AAAAGGCAGATGTTCACCTCTCTGTG----GGTG--GTTT E_telfairi300227 GGTATCAA--AAAAGGCGCAAATTAAC------------AAGCGGCCATC E_telfairi300267 GGTGTCAA--GAAAGGTGCAAGTTAAACACCCTCACTCACAGCCACGTT- E_telfairi300313 GGTGTCAA--AAAAG-CATAAATTACATGCTTTTGC----AGCC--ATTT E_telfairi300438 GGTGTCAA--AAAAGGCATAAATTAAA--TTCTTTT---GCAGC-CATTA E_telfairi300613 GGTGTCAA--AAAAGGCCCAAATTAACCACCGTGGC----AGCCACGTT- E_telfairi300641 G-TGTCAA--A---GGCGCAAAGTAAACACCCTGGC----AGCCACGTTT E_telfairi300799 GGTGTCAA--AAAAGGCATAAATCAAATTCTTTTGC----AGCC--ATTA E_telfairi300824 GGTGTCCAA-AAAAAGTGTGAATTAAA--CTTTTTG---CAATC-ATTTC E_telfairi300839 GGTGTCAA--AAAAGGCATAAATTAAAT-TCTTTTG---CAGCC--CCTC E_caballus300119 GGTGTC-AA-AAAAGGCGCAAACTAAA--CACTTGG---CAGCT-TTTTC E_europaeus300394 GGTGTCAA--AAAAGGCTCAAATCGAA--CACTTAT---CAGGCTTTT-C E_europaeus300699 GGTGTCAA--AAAAGGCATACATT-AA--CACTTAG---CAGGCTTTTTC F_catus300058 GGTGTC-AA-AAACGGTGGAA---------GCTTTG---CAGCC-TTTTC H_sapiens300438 GGTGTCAA--AAAAGGCGTAAATTAAA--CGCTTTG---CAGCC-TTTTC L_africana300057 GGTGTCAA--AAAAGCTGCAAATTAAACTCTTTGCT-----GCCATTTT- L_africana300199 GGTGTCAA--AAAAGGCGTAAATTAAA--CCCTTTG---CAGCCATTTT- L_africana300511 GGTGTC----AAAAGGCATCAATTAAA--TTCTTTG---CAGCC-ATTTC M_mulatta300431 GGTGTCAA--AAAAGGCGTAAATTAAA--CGCTTTG---CAGCC-TTTTC M_murinus300040 GGTGTCAA--AA-ATGTGTAAATTAAA--CACTTAT---CAGCATTTT-C M_murinus300229 GAAAGGCT--AGGTCCT-TAAATTAAA--TGCTTTG---CAGCC-TTTTC M_murinus300414 GGTGTCAA--AAAAGGCATAAATTAAA--TACTTTG---CAGCC-TTTTC M_domestica300052 GGTGTCAA--AAAAGGCGCAAAG-GAA--GACTTTG---CAGCC-TCCTC M_musculus300451 GGTGTCAG--AAAAGGCATAAATAAA---TGCTTTG---CGGCC--TTTG M_musculus300609 GGTGTCAA--AAAAGGCATAAATAAA---TGCTTTT---CGGCC-TTTCC M_musculus300763 GGTGTCAA--AAAAGGCATAAATAAA---TGCTTTG---CGGCC--TTTC O_anatinus302353 GGTGTCAA--AAGAGGCACAAATTATA--TGCTCTG---CAGCA-TGTTT O_anatinus303868 GGTGTCAA--GAGAGGCATAAATTAGG--TGCTCTG---CAGCG-TGTTT O_anatinus304463 GGTGTCAA--AAAAGGCGCAAATGAAA--CTCTTGG---CAGCTCTGTTT O_anatinus304539 GGTGTCAA--AAGAGGCATAAATTATA--CACTCTG---CAGCA-TGTTG O_anatinus304540 GGTGTCAA--AAAAGGCGCAAATCAAA--TCCGTGG---CAGCCCTATTT O_cuniculus300000 GGTGTCAA--AGAAGGCGCACAGTGAA--TGCTTGC---CAGCC-TTTTC O_cuniculus300438 GGGGTCAA--AAAAGGCATACAGGGAA--TGCTTTGC--AACCT--TTTC O_cuniculus300499 GGTGTC-AA-GAAAGGCAAACAGGGAA--TACTTTG---CAGCC-TTTTC O_garnettii300118 AGAGTTTG--AGAAGGTGTAAATTAAA--C-CTTTG---CAGCC-TTTTC O_garnettii300354 GGTTTCAA--AAAAGGCATAAATTAAA--CACTTTG---CAGCCTTTT-C O_garnettii300415 GGTGTCAA--AAAAGGCGTACATTAAA--TGCTTTG---CGGCC-TTTTC O_garnettii300650 GGTGTCAA--AAAAGGCGTAAATTAAA--TACCTTG---CAGTC-TTTCC P_troglodytes300333 GGTGTCAA--AAAAGGCGTAAATTAAA--CGCTTTG---CAGCC-TTTTC P_pygmaeus300555 GGTGTCAA--AAAAGGCGTAAATTAAA--CGCTTTG---CAGCC-TTTTC R_norvegicus300163 GGTGTCAAAGAAAAGGCATAAATTAA---TGCTTTG---TAGCC--TTTC R_norvegicus300214 GGTGTCAA--AAAAGGCATAAATTAA---TGCTTTG---CGGCC--TTTC R_norvegicus300458 GGTGTCAA--AAAAGGCATAAGTTAA---TGCTTTG---CGGCT-TTTCC S_cerevisiae300063 GTTGTTTATATCGAGTCTCTTTTGGTATAAGCGTCAAGTCCATCGGAGAG S_araneus300994 GGTGTCAA--GAAAGGCGTA-AAGTAA--GCCCTTGG--CAGGG--TTTT S_tridecemlineatus300044 GGTGTC-AA-AAAAGGCACA-AATAAA--TACTTTG---CAGCC-TTTTC T_nigroviridis300063 GGTGTCAA--GCGAGGCATACAGAAAC---ACATGTGGCTGCCTGTGGAA T_nigroviridis300120 GGTGTCGA--TAAAGGCAAACATCAAT---GTTTTGGATTGGCCTAAGCA T_nigroviridis300137 GGTGTCGA--TAAAGGCAAACATCAAT---GTTTTGGATCGGCCTAAGCA C_familiaris300000 CTGTCCTTGAATTTT--------------TGGTGT-AGGAGCTGTATA-A C_familiaris300208 CTGCCC--GGACCGT-------GGGTCT---GGGGCGCGCGCCGC-CG-G C_porcellus300084 CTGCCCTTATATTTG-------GTATATTTGGTGT-AGGAGCTACACA-A C_porcellus300095 CTGACCTTATATTGG-------ATATATTTGGTGC-AGGAACAGCATA-- C_porcellus300335 CTGCCCTTATATTTG-------GTATATTTGGTGT-AGGAGCTGCACA-A C_porcellus300402 CTGCCCTTGTATTTG-------GTATATTTGGTGT-AGGAGCTGCACA-A C_porcellus300410 CTGCCCATGTATTTG-------GTATAGTTGGTGT-AGGAGCTGCACA-A D_rerio300200 AGGTAT----CTCCA-------TCCTTGCCTTT--CAGAGGCTTCATGTA D_rerio300201 AGGACC----GGCCA-------CTCGTTCTCTTGCTT---GTGCTGTAAC D_rerio300239 TGGTTGTCAAAGTA------------CTTCCGTTAAATAAGCTCAACAAT D_rerio300276 AAAGTG--ATTTCTC-------TGTATCACGCTGTCTAAAGCTCAA-ACC D_novemcinctus300181 CTGTCCTTGAA-TTT------ATTGTGTTTGGTGT-AAGAGCTGCATA-G E_telfairi300003 CTGCTTTTGAA-TTC------GGTTTCTTTGGCGT-CGGAGCTGCATA-A E_telfairi300008 CTGCTTTTGAA-TTT------GGTGTCTTTGGCAT-AAGAGCTGCATA-A E_telfairi300039 CTGCCTTTGAA-TTC------GGTTTCTTTGGCGT-CGGAGCTGCGTA-A E_telfairi300225 CTGCCCTTGAA-TTT------GGTGTCTTTGGTAC-AAGAACTGCTTA-C E_telfairi300227 CAGCTGAGAAGCACAC-----CAGACTGTCTGACT-ACGAGGTGCAGA-A E_telfairi300267 ATGCTTTTGAA-TTT------GGTTTCTTTGGCAT-AGGAGCTGCCTA-A E_telfairi300313 TTGCCCTTGAATTTT------GGTTTCTTTGGCGG-AGGCACTGCATA-A E_telfairi300438 TTGCCCTTGAA-TTT------GGTTTCTTTGGCAT-AGGTGCTGCATA-A E_telfairi300613 CTGCCTTTGAA-TTC------GGTTTCTTTGGCGT-GGGAACTGCATA-A E_telfairi300641 CTGCTTTTGAAATTC------AGTTTCTTTGGCAT-CTGAGCTGCATA-A E_telfairi300799 CTGCCCTTGAATTT-------GGTTTCTTTGGCGT-AGGCGTTGCATA-A E_telfairi300824 TTGCCCTTGAA-TTT------TGTGTCTTTGGTGT-AGAAGCTGCGTA-A E_telfairi300839 CCCCCCCCCAATTTAAAT--ACACATCTTTCATTT----CTCAGCATA-- E_caballus300119 CTGCCCTTGAATTTG-------ATATCTTTGGTGT-AGAAGCTGCATA-A E_europaeus300394 CTGCCTTTGATTTTG-------ATGTCTTAGGCAT-AGGAACTGCATA-A E_europaeus300699 CTGCCTTTGAACTTG-------ATGTCATGGGCTT-AGGAACTGCCTA-A F_catus300058 CTGCCCTTGAATTTTAATTTGAATATTGTTGGTGT-AGGAGCTGGATA-A H_sapiens300438 CTGCCCTTAAA-TTT------GATACCTTTGGTGT-AGGAGCTGCATA-A L_africana300057 CTGCCCTTGAA-TTT------GGTGTCTTTGGTGT-TGGGGCTGCATC-A L_africana300199 CTGCCCTTGAA-TTT------GATTTCTTTGGTGT-AGGAGCTGCGTA-A L_africana300511 CGGCCCTTGAA-CTT------GATATCTTTGATGT-AGGAACTGCATG-A M_mulatta300431 CTGCCCTTGAA-TTT------GGTATCTTTGGTGT-AGGAGCTGCATA-A M_murinus300040 CTGTTCT----------------TAAATTTGGTGT-AGGAGCTGCGTA-A M_murinus300229 CTGCCCTTAAA-TTT------GGTATCTTTGGTGT-AGGAGCTGCATA-A M_murinus300414 CTGCCCTTAAA-TTT------GATATCTTTGGTGT-AGGAGCTGCATA-A M_domestica300052 TCGGCAGGCATCTGC-------GTGCCTTGGCCGA-GTGTGCTGGCAA-A M_musculus300451 CTTGCCCTGGAGTTC------GGTATCTCGGGTGT-AGGAGCTGCATA-A M_musculus300609 TGTCTCTGGAG-TTT------GGTATCTTGGGTGT-AGGAGCTGCATA-A M_musculus300763 CTGTCCCTGGAGTTT------GGTATCTTGGGTGT-ACGAGCTGCATA-A O_anatinus302353 GATTTT-AGGAGTTA--------CTTCCTTTATTC-TTTTGCTGCTTTTG O_anatinus303868 GATTTT-AGGAGTTA--------CTTCCTTTCTTC-TTTCGCTGCTCT-G O_anatinus304463 CACCCTAGGTTTCCG--------TTCCTTTGGTGC-TTTTGCTGC----G O_anatinus304539 GGTTTTTAGGAGTTA--------CTTCCTTTCTTC-TTTTGCTGCTTTTG O_anatinus304540 --TCACTGGATTCTA--------TTCCTGTGGTGT-ACTTGCTGCAC--- O_cuniculus300000 CTGCTCCTGATGTG--------GTGCCTTGGCTGC-G---GCAGGGGA-A O_cuniculus300438 CTGCCCTTAGACTGT-------GTATCTTCCGGGCAGGACTCCCA-CA-A O_cuniculus300499 TGGCCCTTAGGTTTG-------GTATCTTCCGTGC-AGGAACTGTACA-A O_garnettii300118 CTGCCCTTAAA-TTT------GATATCTTTGGCGT-AGGGACTGCATA-A O_garnettii300354 CTGATTTTAAACGTG-------GTCTCTTTGGAGT-AAAGGCTGCATA-A O_garnettii300415 CTGCCCTTAAA-TCT------GGTATTTTTGGTGT-AGGAGCTGCATA-A O_garnettii300650 CTGCCCTTAAA-TTT------GGTATCTTTGGTGT-AGGGACTACATA-A P_troglodytes300333 CTGCCCTTGAA-TTT------GATATCTTTGGTGT-AGGAGCTGCGTA-A P_pygmaeus300555 CGGCCCTTAAA-TTT------GGTATCTTTGGTGT-AGGAGCTGCATA-A R_norvegicus300163 CTTTCCCTGGAGTTT------GGTATCTTGGGTGT-AGGAGCTGCATA-A R_norvegicus300214 CTCTCCCTGGAGTTT------GGTATCTTGGGTTTCAGGAGCTGCATA-A R_norvegicus300458 TTTCCCTGGAG-TTT------GGTATCTTGGGTTTCAGGAGCTGCATA-A S_cerevisiae300063 ATCATCATTTTGTTCATCTTAATGCCCTTTTGTGTAGGAAATTGAGGGAA S_araneus300994 CCTGCTTGTGACCCT-------GCTGTCTCAGGCACAGGAACTGCACA-A S_tridecemlineatus300044 CTGCCCTTAAATTTT-------ATATTTTTGGTGT-AGGAACTGCATA-A T_nigroviridis300063 AGAGTTTCAGTTAAC-------TCCCTAAAGCAGCCAGCTGCACGA-ACA T_nigroviridis300120 AGGTTC----TACC--------CCAGTAGCCTTGTCTTAAGTTCTATACC T_nigroviridis300137 AGGTTC----TACC--------CCAGTAGCCTTGTCTTAAGTTCTATACC C_familiaris300000 -GTAACAGTT---------------------------------------- C_familiaris300208 GTC-ACAGTT---------------------------------------- C_porcellus300084 -GTAACAGTT---------------------------------------- C_porcellus300095 GTA-ACAACT---------------------------------------- C_porcellus300335 -GTAACAGTT---------------------------------------- C_porcellus300402 -GTAACAGTT---------------------------------------- C_porcellus300410 -GCAACAGTT---------------------------------------- D_rerio300200 ATGGACACTT---------------------------------------- D_rerio300201 AAGAACAACA---------------------------------------- D_rerio300239 AAGAACATGA---------------------------------------- D_rerio300276 AAGTACAACA---------------------------------------- D_novemcinctus300181 GTA-ACAGTT---------------------------------------- E_telfairi300003 GGA-ACAGTT---------------------------------------- E_telfairi300008 GGA-ACGGTT---------------------------------------- E_telfairi300039 GGA-ACAGTT---------------------------------------- E_telfairi300225 GTA-ACAGTT---------------------------------------- E_telfairi300227 GGGACCAGT----------------------------------------- E_telfairi300267 GGA-ACAGTT---------------------------------------- E_telfairi300313 GAA-ACAGTT---------------------------------------- E_telfairi300438 GGA-ACAGTT---------------------------------------- E_telfairi300613 GGACACAGTT---------------------------------------- E_telfairi300641 GGA-ACAGTT---------------------------------------- E_telfairi300799 GGA-ACAGTT---------------------------------------- E_telfairi300824 GTA-ACTGTT---------------------------------------- E_telfairi300839 AGCTCCAACA---------------------------------------- E_caballus300119 -GTAACAGTT---------------------------------------- E_europaeus300394 GTA-ACAGCA---------------------------------------- E_europaeus300699 GTA-ACAATA---------------------------------------- F_catus300058 AGTAAGAGTT---------------------------------------- H_sapiens300438 GTA-ACAGTT---------------------------------------- L_africana300057 GAT-ACAGCT---------------------------------------- L_africana300199 GTT-ACAGTT---------------------------------------- L_africana300511 GTT-ACAGTT---------------------------------------- M_mulatta300431 GTA-ACAGTT---------------------------------------- M_murinus300040 GTA-ACAGTT---------------------------------------- M_murinus300229 GAA-ATAGTT---------------------------------------- M_murinus300414 GTA-ACAGTT---------------------------------------- M_domestica300052 GTG-ACAGTC---------------------------------------- M_musculus300451 GTT-ACAGAA---------------------------------------- M_musculus300609 GTA-ACAGTA---------------------------------------- M_musculus300763 GTA-ACAGTA---------------------------------------- O_anatinus302353 AGGGACATTG---------------------------------------- O_anatinus303868 AGGGACATTG---------------------------------------- O_anatinus304463 AGGAACATAT---------------------------------------- O_anatinus304539 AGGGACATCC---------------------------------------- O_anatinus304540 AGGAACATGG---------------------------------------- O_cuniculus300000 GTG-CGTCCC---------------------------------------- O_cuniculus300438 GTA-ACTGTT---------------------------------------- O_cuniculus300499 -GTAACAGTT---------------------------------------- O_garnettii300118 GTA-ACAGTC---------------------------------------- O_garnettii300354 GTA-ATAAGT---------------------------------------- O_garnettii300415 GTA-ACAGTT---------------------------------------- O_garnettii300650 GGG-GCAGTC---------------------------------------- P_troglodytes300333 GTA-ACAGTT---------------------------------------- P_pygmaeus300555 GTA-ACAGTT---------------------------------------- R_norvegicus300163 GTA-ACAAAG---------------------------------------- R_norvegicus300214 GTA-ACAGAA---------------------------------------- R_norvegicus300458 GTA-ACAGAA---------------------------------------- S_cerevisiae300063 GTTTAGGCTTCTCAACATTTTAAGACGCCTATGCAAGGGCTGGTAGGACA S_araneus300994 GGA-ATAGGA---------------------------------------- S_tridecemlineatus300044 -GTGACAGTT---------------------------------------- T_nigroviridis300063 CAC----------------------------------------------- T_nigroviridis300120 AAGAACACTT---------------------------------------- T_nigroviridis300137 AAGAACACTT---------------------------------------- C_familiaris300000 ------- C_familiaris300208 ------- C_porcellus300084 ------- C_porcellus300095 ------- C_porcellus300335 ------- C_porcellus300402 ------- C_porcellus300410 ------- D_rerio300200 ------- D_rerio300201 ------- D_rerio300239 ------- D_rerio300276 ------- D_novemcinctus300181 ------- E_telfairi300003 ------- E_telfairi300008 ------- E_telfairi300039 ------- E_telfairi300225 ------- E_telfairi300227 ------- E_telfairi300267 ------- E_telfairi300313 ------- E_telfairi300438 ------- E_telfairi300613 ------- E_telfairi300641 ------- E_telfairi300799 ------- E_telfairi300824 ------- E_telfairi300839 ------- E_caballus300119 ------- E_europaeus300394 ------- E_europaeus300699 ------- F_catus300058 ------- H_sapiens300438 ------- L_africana300057 ------- L_africana300199 ------- L_africana300511 ------- M_mulatta300431 ------- M_murinus300040 ------- M_murinus300229 ------- M_murinus300414 ------- M_domestica300052 ------- M_musculus300451 ------- M_musculus300609 ------- M_musculus300763 ------- O_anatinus302353 ------- O_anatinus303868 ------- O_anatinus304463 ------- O_anatinus304539 ------- O_anatinus304540 ------- O_cuniculus300000 ------- O_cuniculus300438 ------- O_cuniculus300499 ------- O_garnettii300118 ------- O_garnettii300354 ------- O_garnettii300415 ------- O_garnettii300650 ------- P_troglodytes300333 ------- P_pygmaeus300555 ------- R_norvegicus300163 ------- R_norvegicus300214 ------- R_norvegicus300458 ------- S_cerevisiae300063 GACATGC S_araneus300994 ------- S_tridecemlineatus300044 ------- T_nigroviridis300063 ------- T_nigroviridis300120 ------- T_nigroviridis300137 -------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved