snOPY snoRNA Orthological Gene Database

Family: SNORA12

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300156 ---CATAGTGGGGGTTTGCTCTCTGGCATACTTGTTAGGTTTTCAAGGGA C_familiaris300353 ---AGTTGTGGTGGTTTTCTTTCTGGCACATTTGTTAAATTTTCAAATGG C_porcellus300073 ---AGTTGTGGTAGTT-TCTTTCTGGCACATTTGTTAAGTTTTCAAAGGC C_porcellus300219 ---AGTTGTGATAGTC-TCTTTCTGACACATTTGTTAAGTTTTCAAATGG C_porcellus300482 ---CATTGTAGTAGTT-TCTTTCTGGCACATTTGTTAAGTTCTCAAATGG C_porcellus300491 ------GAAAGTAGTT-TCTTTCTGGCACATTTGTTAAGTTTTCAAATGG C_porcellus300514 ---AGTTGTGGTAGTT-TCTTTCTGGCACATTTGTTAAGTTTTCAAATGG C_porcellus300791 ATATGGTGTGGTAGTT-TCTTTCT-------TTGTTAAGTTTTCAAAAGG C_porcellus300835 ---GGTTGTGGTAGTT-TCTTTCTGGCACATTTGTTAAGTTTTCAAATGG D_novemcinctus300227 ------GACCATAGCTGAATGGCAGATTCATTAAGTTT----TCAAATTT D_novemcinctus300577 ---AGTTGTGGTGGTTTTCTTTCTGGTGCATTCATTAAGTTTTCAAATGG E_caballus300069 ---AGTTGTGGTGGCTTTCTTTCTGGCGCATTTGTTAAGTTTTCAGATGG E_caballus300356 ---AGTTGTGGTGGCTTTCTTTCTGGCGCATTTGTTAAGTTTTCAGATGG E_europaeus300351 ---GCTTGTGGTAGTTCTCCTCCTGGCACATTTGTTAAGTTTTCAGATGG E_europaeus300459 ------------------ATTAGTGCTTTATAAAAAACAAGATAAAAAAA E_europaeus300655 ---AGTGGTGGTAGTCCTCCTCCTGGCACATTTGTTAAGTTTTCAAATGG F_catus300304 ---GGTTGTGGTGGTTTTCTTTCTGGCACATTTGTTAAATTTTCAAATGG H_sapiens300473 ---AGTTGTGGTGGTTTTCTTTTTGGCACATTTGTTAAGTTTTCAAATGG L_africana300503 ---CGTTGTGGTGGTTTTCTTTGTGGTACATTTGTTAAGTTTTCAAATGG M_mulatta300072 ---TCTCATGGTAGTTTTCTTTTTGGCACATTTGTTAAGTTTTCAAATGG M_mulatta300487 ---GGCTGTGGTGGTTTTCTTTCTGGTACATTTGTTAAGTTTTTGAATGA M_mulatta300595 ---AGTTGTGGTGGTTTTCTTTTTGGCACATTTGTTAAGTTTTCAAATGG M_murinus300036 ---AAACTTGGAAAAAAGTTTTCTCACATGTGTTAAGT--TTTCTAAGGG M_murinus300216 ---AATTGTGGTGGTTTTCTTTCTGGCACATTTGTTAAGTTTTCAAATGG M_murinus300251 ---GATTCTGGTGGTTTTCTTTCTGGTACATTTGGTAAGTTTTCCGGTGG M_murinus300564 --------------AAGAGTGAGATCTTTCTGGCACAT---TTGTTAAGT M_domestica300106 ---TGATGTGGTAGTTTTCTTTCTGGTCCATTTGTGAAG-TATCAAATTG M_musculus300802 ---TTGGGTGGTAGTG-TCTTCCTGGCGCATTTGTTAAGTGTTCAAATGG O_anatinus302245 CATGGTGGCGGC-GCCCCCTTTGTGGCTGATTTGTTAAAGTTTCAAATGG O_cuniculus300482 ---ATTTGTGGTGGTTTTCTCTTTGGTCCATTTGTTAAGTTTTCAAATGG O_garnettii300032 ----ATTAGGATGGTTTTCTTTCTGGCACATTCGTTAAGTTTTCAAATGG O_garnettii300254 ---TTTTGTGGTGGTTTTCTTTCTGGCACATTCGTTAAATTTTCAAGTGG O_garnettii300527 ---GATAATGTTGAAAGCTTTGCAGAATTGTTGAAAATACTATGTGAAGA O_garnettii300716 ---AATTGTGGTGGTTTTCTTTCTGGCACATTTGTTAAGTTTTCAAGTGT P_troglodytes300094 ---GGTTGTGGTGGTTTTCTTTCTGGTACATTTGTTAAGTTTTCAAATGA P_troglodytes300146 ---TCTCGTGGTAGTTTTCTTTTTGGCACATTTGTTAAGTTTTCAAATGG P_troglodytes300718 ---AGTTGTGGTGGTTTTCTTTTTGGCACATTTGTTAAGTTTTCAAATGG P_pygmaeus300341 ---GGTTGTGGTGGTTTTCTTTCTGGTACATTTGTTAAGTTTTCAAATGA P_pygmaeus300355 ---TCTCGTGGTAGTTTTCTTTTTGGCACATTTGTTAAGTTTTCAAATGG P_pygmaeus300668 ---AGTTGTGGTGGTTTTCTTTTTGGCACATTTGTTAAGTTTTCAAATGG R_norvegicus301104 ---TTTGGTGGTAGTG-TCTTCCTGGTGCATTTGTTAAGTGTTCAAATGG S_araneus300923 ---AGTTGTGGTGGTT-TTCATCTGGCGCATTTGTTAAGTTTTCAAATGG S_tridecemlineatus300221 ---TTGAGTGGGGGGATTCTTTTCGCTGCATT-----GGTTTCCAAATGG T_belangeri300364 ---AGTTGTGGTGGTTTTCTTTCTGGCGCATTTGTGAAGTTTTCAGATGG C_familiaris300156 GCC-TGACTCTGCCACATATACTAGATAGAAGCTGGCA---------A-G C_familiaris300353 GCC-TGACTCTGCCACATATATTACATAGGAGCTGGCA---------AAG C_porcellus300073 GTC-TGACTCTACCACATACATTGTA-AGGAGCTAGCA---------AAA C_porcellus300219 GTC-TGACTCTACCACATACATAATA-AGGAGCTATCA---------AAA C_porcellus300482 GTC-TGACT--ACCACATACATTGTA-AGGACCTAGCA---------AAA C_porcellus300491 GTC-TGACTGCACCACATACATTGTA-AGGAGCTAGCA---------AAA C_porcellus300514 GTC-TGACTCTACCACATACATTGTA-AGGAGCTAGCA---------AAG C_porcellus300791 GTC-TGACTCTACAACATACACTGTA-AGGAGCTAGCA---------AAA C_porcellus300835 GTC-TGACTCTACCACATACATTGTA-AGGAGCTAGCA---------AAA D_novemcinctus300227 GCC-CGATTCTGCCACATATAATATATAGCAGCTGGCA---------AAG D_novemcinctus300577 GCC-TGATTCTGCCACATATAATATAGAGGAACTGGCA---------AAG E_caballus300069 GCC-TGACTCTGCCACATGTATTATTTAGGAGCTGGCA---------AAG E_caballus300356 GCC-TGACTCTGCCACATATATTATTTAGGAGCTGGCA---------AAG E_europaeus300351 GCT-TGACTCTATCGCATACATTATTTAGGAGCTGGCA---------AAG E_europaeus300459 ----TAACTCTACCACATACATTATTTAGGAGCTGGCG---------ATG E_europaeus300655 GCTT-GACTCTACCACATACATTACTTAGGAGCTGGCA---------AAG F_catus300304 GCC-TGACGCCGCCACATATATTATATAGGAGCTGGCA---------AGG H_sapiens300473 GCC-TAACTCTGCCACATATATAATATCGGAGATGGCA---------AAG L_africana300503 CCCCTGACTCTGCCACATATATTACACAGGAGCTGGCA---------AAG M_mulatta300072 GCC-TAACACTGTCACATGTATTATATTGGAGCTGGCA---------AAG M_mulatta300487 GCC-TAACTCCACCACATGTATTACATAGGAGCTGGCA---------AAG M_mulatta300595 GCC-TAACTCTGCCACATATATAATATCGGAGATGGCA---------AAG M_murinus300036 GCC-TACTTATGCCACATATATTATATAGAACCTGGCA---------GAG M_murinus300216 GCC-TAACTCTGCCACATATATTACAGTGGAGCTGGCA---------AAG M_murinus300251 GCC-CGACTCTGCCACATATATTATACCGGGGCTGGCA---------GAG M_murinus300564 TTC-TGCCCGAGTCTGCCACA-TATTTTGGAGCTGGCA---------AAG M_domestica300106 GCC-TGATTCTACCACATAGATTATGCAGGAGCAAGCA-----------G M_musculus300802 GCC-CGACTCTGCCACATACATTATGCAGGAGCTGGCA---------AAG O_anatinus302245 GCCCCGGGGCAACCACACAGAAGGCAGAGGAGCCGG-----------AGA O_cuniculus300482 GCC-TGACTCGGCCACATACATTATAAAGGATCTGGCA---------AAG O_garnettii300032 GCC-TAACTCTGCCACATATATTATATTTGAGCTGGCA---------AAG O_garnettii300254 GCC-TAACTCTGCCACATATATA-----GGAGCTGGCA---------AAG O_garnettii300527 GTC-TTATGTTGCCATACATATTATATTGGAGCTGGCAAAGGCTTCAGAG O_garnettii300716 ACC-TAACTCTGCCACATATATTATATCGGAGCTGGCA---------AAG P_troglodytes300094 GCC-TAACTCTGCCACATACATTATATAGGAGCTGGCA---------AAG P_troglodytes300146 GCC-TAACACTGCCACATGTATTATACTGGAGTTGGCA---------AAG P_troglodytes300718 GCC-TAACTCTGCCACATATATAATATCGGAGATGGCA---------AAG P_pygmaeus300341 GCC-TAACTCTGCCACATACATTATATAGGAGCTGGCA---------AAG P_pygmaeus300355 GCC-TAACACTGCCACATGTATTATACTGGAGCTGGCA---------AAA P_pygmaeus300668 GCC-TAACTCTGCCACATATATAATATCGGAGATGGCA---------AAG R_norvegicus301104 GCC-TGACTCTGCCACATACATTATGTAGGAGCTGGCA---------AAG S_araneus300923 GCC-TGACTCTGCCACATACATTATAGAGGAGCTGGCA---------AGG S_tridecemlineatus300221 GCC---AC-TTGTCTTTCGCATTATATTGTAGCTAGTA---------AT- T_belangeri300364 GCC-TAACTCTACCACATATACGACGTCGGAGCTGGGA---------AGG * C_familiaris300156 ACTTGATGGGAGATTG-------G-CTCCCACATGT-------------- C_familiaris300353 GCTTGATGACACAGAT-------ATCTCTCTCTAGCCTTTCCTGC----- C_porcellus300073 GCTTACAGACTGAAAT-------ATCTCTCTTGAGCTTTTTTT-GT---- C_porcellus300219 GCTTAAAGACGAAAAT-------ATCTCTCTTGAGCTTTTATT-GT---- C_porcellus300482 GCTTAAAGACTGAAAT-------ATCTCTCTTGAGCCTTTTCT-GT---- C_porcellus300491 GCTTAAAGACTGAA---------ATATCTCTTAAGCTTTTTTTGGT---- C_porcellus300514 CTTTAAAGACTGAA---------ATGCCTCTCGAGCTTTTTT--GT---- C_porcellus300791 GCTTAAAAACTGAAT--------ATCTCTCTTGAGCTTTTTTTGGT---- C_porcellus300835 GCTTAGAGACTGAAAT-------ATCTCTCTTGAGCTTTTTT--GT---- D_novemcinctus300227 GCTTGATGACAAAGAG-------GTTTCTTGCAAGACTTTCCT-GC---- D_novemcinctus300577 GCTTGATGAAAAAGAG-------ATTTTTTGCTAGCCTTTC--AC----- E_caballus300069 GCTTGATGACAGAGAT-------ATCTCTCT--AGCCTTTCCTGC----- E_caballus300356 GCTTGATGACAGAGCT-------ATCTCTCT--AGCCTTTCCTGC----- E_europaeus300351 GCTTGATGACAAAGAGATCCCTCATCTCTCTCTTGCCTTCCCC-TT---- E_europaeus300459 GCTCGATGAAAAGGAG-------ATCTCTCTCTAGCCTTTCCC-AC---- E_europaeus300655 GCTTGATGACAAAGAGACC----TCTCATCTCTCTCTTGCCTTCCCCTT- F_catus300304 GCTTGATGACAGAGAG-------ATCTCTCTCTAGCCTTTCCTGC----- H_sapiens300473 GCTTG-TGACGGAGAT-------ATCTCTCTTAAGCCTTTCCTGC----- L_africana300503 GCTTGATGAGAAAGAG-------ATCTCTCTCTGGCTTTTCCCGT----- M_mulatta300072 GCCTG-TGACAAAGAG-------ATCTCTCTCAAGCCTTTCACGCCTTTC M_mulatta300487 GCTTGATGACAAAGAG-------ATCTCTCACAAGTCTTTCTCAC----- M_mulatta300595 GCTTG-TGACAGAGAT-------ATCTCTCTTAAGCCTTTCCTGC----- M_murinus300036 GCTTGAAGACAGAGAA-------CTGTCTCAAG--CCCTTCCT-GC---- M_murinus300216 GCTTGGTGACAAAGAG-------ATCTCTCTTAAGCCTTTTCTGC----- M_murinus300251 GCTTGATGACA--GAG-------GTCTCTCGTAAGCCTTTTCTGC----- M_murinus300564 GCTTGAAAACAAAGAG-------ATCTCTCTTAAGCCTTTCCT-GC---- M_domestica300106 TCTTGGGGATGGTCAG-------GCCTCATCTGAGCCTTTCCCCCTTCAG M_musculus300802 GCTTAGAGACAAAGAA-------GTCTCTCTTGAGTGTTTCCTAAT---- O_anatinus302245 GCCTGGTGGCGGTGAGCTC----TCTTCCATCAGGAACTCCTTGGCTTC- O_cuniculus300482 GCTTGATGACAGAGA---------TTTCTGTTGAGCCTATCCTGC----- O_garnettii300032 GCTTGATAACAAAGAG-------ATTTCCTGCC--TTTCTT--GT----- O_garnettii300254 ACTTGATGACAAAGAG-------ATCT-------GCCTTTCCTCC----- O_garnettii300527 GCTTGATGACAAAGA---------CATCTCCTT--CCTTTCCT-AC---- O_garnettii300716 GCTTGATGACAAAGAG-------ATCTTCT----GCCTTTCCTCC----- P_troglodytes300094 GCTTGATGACAAAGAG-------ATCTCTCTCAAGCCTTTCCCAC----- P_troglodytes300146 GCCTG-TGACAATGAG-------ATATCTCTCAAGCCTTTCATGCCTTTC P_troglodytes300718 GCTTG-TGACAGAGAT-------ATCTCTCTTAAGCCTTTCCTGC----- P_pygmaeus300341 GCTTGATGACAAAGAG-------ATCTCTCTCAAGCCTTTCCCAC----- P_pygmaeus300355 GCCTG-TGACAATGAG-------ATATCTCTCAAGCCTTTCACGCCTTTC P_pygmaeus300668 GCTTG-TGACAGAGAT-------ATCTCTCTTAAGCCTTTCCTGC----- R_norvegicus301104 GCTTAGAGACAAAG----------TCTTTCTTGAGTGTTTCCTAAT---- S_araneus300923 GCTGGAGGACAGAGAG---------CTCTCTCGAGCCGTTCCCGT----- S_tridecemlineatus300221 GTTGA-AGACAGAAAG-------ATCTATCTTAAGCTTTTCTTGC----- T_belangeri300364 GCTGGGTGGCAAACAG-------GACTCCCTGAAGCCTTTCCTGT----- C_familiaris300156 ---------------------------- C_familiaris300353 ----ATTAGGCATTGGCTCTCACA-TGT C_porcellus300073 ----ATCACATATTGACTCTCACA-ATC C_porcellus300219 ----ATCAGATATTGGCTCTCACA-ATC C_porcellus300482 ----ATCAGATATTGGCTCTCACA-ATC C_porcellus300491 ----GTCAGGAAGC----CAAGTA-A-- C_porcellus300514 ----ATGAGACATTGGCTCTCACA-ATC C_porcellus300791 ----ATCAGATAGTGGCTCTCACA-ATC C_porcellus300835 ----ATGAGATATTGGCTCTCACA-ATC D_novemcinctus300227 ----ACCAGAGTTTGGCTCCCCCA-TGT D_novemcinctus300577 ----ATACCAGTTTGGTTCCCATA-TGT E_caballus300069 ----ATCAGCGATTGGCTCTCACA-TGT E_caballus300356 ----ATCAGCAATTGGCTCTCACA-TGT E_europaeus300351 ----ATCAGACATTGGCTCCTACA-GAA E_europaeus300459 ----ATCAGAGCTTGGCTCCTACA-TAT E_europaeus300655 ----GTCAGATATTGGCTCCTACAGAG- F_catus300304 ----ATCAGGGATTGGCTCCCACA-TGT H_sapiens300473 ----ATCAGAGAATGGCTCCCACA-TGT L_africana300503 ----GTCAGAGATTGGCTTCCACA-CGT M_mulatta300072 CTCCATCAGAGAATGGCTCCCACA-TGT M_mulatta300487 ----ATCAGAGGCTGGCTCTCACATAT- M_mulatta300595 ----ATCAGAGAATGGCTCCCACA-TGT M_murinus300036 ----ATGAGAGATTGGCTCCCACA-TGT M_murinus300216 ----ATCAGAGATTGGCTCCCACA-TGT M_murinus300251 ----ACCAGAGACCGGCTCCTGCA-CGT M_murinus300564 ----ATCAAAGATTGGCTCCCACA-GCA M_domestica300106 ----GTATTGCTTTAGCTCCTACA-TGC M_musculus300802 ----AACAG--ATTGGCTCCCATA-TGT O_anatinus302245 ----CACAGGA----------------- O_cuniculus300482 ----ATCACAGCTTGGCTCCCACA-TGC O_garnettii300032 ----ATCAGAGATTAGGGCCCACA-TGT O_garnettii300254 ----ATCAGAGAT-GGCTCCCACAGTG- O_garnettii300527 ----ATCAGTGATTGGCTCCCAGA-TGT O_garnettii300716 ----ATCAGAGAT-GGCTCCCACA-TGC P_troglodytes300094 ----ATCAGAGGCTGGCTTTCACACAT- P_troglodytes300146 CTCTATCAGAGAATGGCTCCCACA-TGT P_troglodytes300718 ----ATGAGAGAATGGCTCCCACA-TGT P_pygmaeus300341 ----ATCAGAGGCTGGCTTTCACACAT- P_pygmaeus300355 CTCTATCAGAGAATGGCTCCCACA-TGT P_pygmaeus300668 ----ATCAGAGAATGGCTCCCACA-TGT R_norvegicus301104 ----AACAG--ACTGGCTCCCATA-TGT S_araneus300923 ----GTCCCCGCTTTGCTCTGACAGAC- S_tridecemlineatus300221 ----ATCAGAGATTGGCTCTCTCA-TGT T_belangeri300364 ----AGCAGAGCTCGGCTCCCACA-GGT

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved