snOPY snoRNA Orthological Gene Database

Family: SNORA1

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300030 ------AGCCTTGTTCTAGATGG-----AAAT-GGGCTCTA-TTATTCAC C_familiaris300076 ------AGCCTTATTCTAGATGG-----AAAT-GGGCACTG-TCATTCAT C_familiaris300116 ------AGCCTCATTCTCGATGA-----AAGC-GGGCACGA-TTGTTTGT C_familiaris300154 ---------------------------TCTCTCAAATCTTTAAAAACAAT C_familiaris300198 ------AGCTTATTTCTAGATGA-----AAAT-GGGCACTG-TCCCTCAT C_familiaris300213 ---------------------------------GGCTAGTCTTTCAAGAA C_familiaris300467 ------AGCCTCATTCTAGATGG-----TAAT-GGGCACTG-TCCTTCAT C_porcellus300025 ------AGCCTCATTCTAGATTA-----GAAT-GGGCTCTG-TTGATT-- C_porcellus300081 ------ATCCTCATTCTAGATTA-----GAAT-GGGCACTG-TTGATC-- C_porcellus300122 ------TGCCTCATTCTAGATTA-----GAAT-GGGCACTG-TTGATT-- C_porcellus300144 ------------ATTTTAGATTA-----GAAT-GGGCACTG-TTGATT-- C_porcellus300183 ------AGCCTCATTCCAGATTA-----GAAT-GAGCACAG-TTGATT-- C_porcellus300192 ------AGCCTCG------TCTA-----GGTTAGGGCACTG-TTGATT-- C_porcellus300358 ------AGCCTCATTCTAGATTA-----GAAT-GGGCTCTG-TTGATT-- C_porcellus300486 ------AGCCTCATTCTAGATTA-----GAAT-GCGCATGG-TTGATT-- C_porcellus300589 -----TAAATTGAA---AATCCA-----AAAT-AGGCATTG-TTGATT-- C_porcellus300622 ------TGCCTCATTCTAGATTA-----GAAT-GGGCACTGGTTGATT-- C_porcellus300779 ------AGCCTCATTTTAGATTA-----GAAT-GGGCACTG-TTGATT-- C_porcellus300800 ------GGCCTCA------TCTA-----GAAT-GGGCGCTG-TCAACT-- C_porcellus300893 ------AGCCTCATTCTAGATTA-----GAGT-GGGCACTG-TTGAT--T D_rerio300212 --------TGCCAAGCAGAATTTC----AAAACTGGAATTACTCAAATAG D_novemcinctus300086 ------TTTTAAAAAATATGTGAG-----AAT-GGGCACAG-TTGATCGT D_novemcinctus300185 ------AGCTTCATTCCATG--A-----GAAT-GGGCACAG-TTGATCAT D_novemcinctus300225 ------AGCCTCAGTCCATATGA-----GAAT-GGGCA--G-TTGACCAT D_novemcinctus300246 ------AGCCTCATTCCATAAAA-----TAAT-GGGTACAG-TTGATCAT D_novemcinctus300265 ------AGCTTCATTCCATATAA-----GAAC-TGGCACA--CTGATCAT D_novemcinctus300286 ------AGCCTCATTCCATATGG-----AAAT-GGGCACAG-ATGATCAT D_novemcinctus300306 ------AGCCTC-TTCCATATGA-----GAAT-GGGCACAC-TTGACCAG D_novemcinctus300390 ------AGCCTCATTC-ATATGA-----GAAT-GGTCACAG-TTGATCAT D_novemcinctus300395 ------AGCCTCATTCCTTG--A-----GCAT-GGGCACAG-TTTATCAT D_novemcinctus300421 ------AGTCTTATTCCATATAA-----GAAT-GGGGACA--GGGATCAT D_novemcinctus300447 ------AGCCTCATTCCATATTA-----GAAT-GGGCACAG-TTGATCAT D_novemcinctus300455 ------ATCCTCA-TCTGTATGA-----GAAT-GGGCACAG-TTGCTCAT D_novemcinctus300612 ------AATACCGTTGTAGGCAGA----TGAT-GGACACAG-TCATTCAG E_telfairi300049 ------AGCCTCAGTCTGTGA-------AAGT-GGGCACAG-CCGATCAT E_telfairi300097 ------AGCCTCAGTCTGTGA-------AAGT-GGGCACAG-CTGATCAC E_telfairi300110 ------AGCCTCAGTCTGTGA-------AG-T-GGGCACAG-CTGATCAT E_telfairi300112 TGCTGCAGCCTG--TCTGTGA-------A-GT-GGGCACAG-CTGATCCT E_telfairi300233 ------AGCCTCAGTCTGTGA-------ACCT-GGGCACAG-CTGATGAT E_telfairi300240 ------AGCCTCAGTCTGTGA-------AAGT-GGGCACAG-CTGATCAC E_telfairi300316 ------AGCCTCAGTCTGTGTGC-----AAAT-GGGCAGAG-CCGATCAT E_telfairi300408 ------AGCCTGAGTCTGTGA-------AAGT-GGGCACAG-CTGATCAC E_caballus300023 ------AGCCTCATTCCAGATGA-----AAGT-GGGCACTG-TTGTTCAT E_caballus300085 ------AGCCTCATTCTAGATGA-----AAAT-GGGTGTTG-TTGCTAAT E_caballus300149 ------GGCCTCATTTTAGATGA-----AAAT-GGGCACTC-TTATTCAT E_europaeus300112 ------AGCCTCATTCTAGATAA-----AAAT-GGGCACTG-TTGATT-T E_europaeus300270 ------AGCCTCATTCTAAATAA-----AAAT-GGGCACTG-TTGCTT-T E_europaeus300417 ------AGCCTCATTCTAGATAA-----AAAT-GGGCACTG-TTGATT-T E_europaeus300460 ------TGTAAAAAGAAAAATGA-----AAAT-GTGCACTG-TCGCTT-T E_europaeus300483 ------AGCCTCATTCTAGATAA-----AAAT-GGGCACTG-TTGATT-T F_catus300013 ------AGCCTCATTCTAGATGG-----AAAT-GGACACTG-TTGTTCAT F_catus300049 ------AGCCTCATTCTAGATGG-----AAAT-AAGTACTA-CCATTCAT F_catus300054 ------AGCCTCATTCTAGATGG-----AAAT-GGGCACTG-TCATTCAT F_catus300130 ------AGCCTCATCCTAGATGA-----GAAC-GGGCATTG-TTGTTTGT H_sapiens300749 ------TGCCTCATTCTAGA--------GAAT-GGGCACTG-TTGATCAT M_mulatta300049 ------TGCCCCATTCTCAAGGA-----GAAT-AGGCACTG-TTGATCAT M_mulatta300052 ------AGCCTCTTTCTAGATGA-----AAAT-GGGCACTA-TCGACCGT M_mulatta300070 ------AGCCTCATTCTAGATGA-----GAAT-GGGTACTG-TTGATCAT M_mulatta300213 ------AACCTCATTCTAGATGA-----GAAT-GGGCATTG-TTGATCAT M_mulatta300662 ------TGCCTCATTCTAGATGA-----GAAT-GGGCACTG-CTGATCAT M_murinus300112 ------AGCCTCAT-CTCAAGGA-----GATT-GGGCACTG-TGGGCCAT M_murinus300193 ------AGCCTCATTCTAGATGA-----GAAT-GGACACT---TGATCAT M_murinus300332 ------AGCCTTATTCTACATAA-----GAAT-GGGCACTG-TTGATCAT O_anatinus304399 ------TGCCCCATTCCAAATAT-----TCAT-GGACACAG-TTCATGTT O_cuniculus300016 ------GGCCTCATTCTAGATGA-----GAAG-TGGCACTG-TGGATCAT O_cuniculus300171 -------AGTCTAAAACAGGAGA------AAT-GGGCACTG-TTGATCAC O_cuniculus300367 ------GGCCTCATTCTAGATGA-----GAAT-GGGCACTG-GTGACTGT O_cuniculus300397 ------GGCCTCATTGTAGATGA-----GAAT-GGGCACTG-TTAAACAT O_garnettii300344 -----------AAATATATATGA------GAT-GGGCACTG-TTGATTTT O_garnettii300471 ------GACCTCATTCTCCAGGA-----CATG-GGGCACTG-TTGTCCAT O_garnettii300557 ------AGCCTCATTCTAAATAAAATAAGAGT-GGGCACTG-TTGATAAT O_garnettii300561 ------TACCTCATTCTAGATGA-----GACT-GGGCACTG-T------- O_garnettii300668 ------AGCCTCATTCTAGTTGG-----GAGT-GGGCACTG-TTGATAAT P_troglodytes300136 ------AGCCTCATTCTAGATGA-----GAAT-GGGTACTG-CTGATCAT P_troglodytes300158 ------AGCCTCTTTCTAGATGA-----GAAT-GGGCACTG-TCGATCAT P_troglodytes300470 ------TGCCCCATTCTCAAAGA-----GAAT-AGGCACTG-TTGATCAT P_troglodytes300481 ------AGCCTCATGCTAGATGA-----GAAT-GGGCACTG-TTGATCAT P_troglodytes300672 ------TGCCTCATTCTAGA--------GAAT-GGGCACTG-TTGATCAT P_pygmaeus300297 ------TGCCTCATTCTAGA--------GAAT-GGGCACTG-TTGATCAT P_pygmaeus300370 -------GCCCCATTCTCAAAGA-----GAAT-AGGCACTG-TTGATCAT P_pygmaeus300413 ------AGCCTCTTTCTAGATGA-----GAAT-TGGCACTG-TCGATCAT P_pygmaeus300422 ------AGCCTCATTCTAGATGA-----GAAT-GGGTACTG-CTGATCAT P_pygmaeus300519 ------AGCCTCATGCTAGATGA-----GAAT-GGGCACTG-TTGATCAT R_norvegicus300295 ------AGACTCATTGTACATAA-----GAAT-GGGCATTG-TTGTTGGT R_norvegicus300860 ------AGCCTCATTGTACATAA-----AAAT-GGGCATTG-TTGTTGGC S_araneus300276 ------GGCCTCATTCCATGTGC-----ATGT-GGGCCCAG-CTGACCCT S_tridecemlineatus300048 ------AGCCTCATTCTAGATGA-----GA-T-GCTCACTG-TTGATTA- S_tridecemlineatus300191 ------ACCCTCATTCTAGATGA-----GAAT-AGGCACTG-TGGATTA- T_belangeri300064 ------ATCCACTTTAGAGATGA-----GAAT-AGGCACTG-CCGATCAC T_belangeri300181 ------AGCCTCATTCTAGTTTC-----AATT-GGACACTG-TGGAT--C C_familiaris300030 ---GGTGTCC-AAAAATTGTT--AATGTGG-CT-ACTCTAAGACA--TAG C_familiaris300076 ---GGTGTCC-AGAAATTGTT--AATGTAG-GT-ACATTGAGACA--TGG C_familiaris300116 ---GGTGTCT-ACAAATGGTT--AATATGG-CA-ACACTGAGACAGATAG C_familiaris300154 AAAAATTTTTTAAAAAGTTTT-----GTGG-CT-ATATTGAAACA--CAA C_familiaris300198 ---GGTGTCC-AGAAATTGTG--AATGTGG-TT-A-ACTGAGACG--GGA C_familiaris300213 A--AATGATTAAGAAGGGAAGGCAAGAGTGGCT-ACATTGAGACA--CAG C_familiaris300467 ---GGTGTCC-AGAAATTGTT--AATGTGG-CT-ACATTGAGACA--CAG C_porcellus300025 ---GGTGTCC-AAAATTAATC--AATGTGG-CTGAAATTGT----CACAA C_porcellus300081 ---AGTGTCC-AAAACTGGTC--AATGTGA-CTGAAATTGT----CACAG C_porcellus300122 ---GGTGTCC-AAAACTGGTC--AATGTGG-CTGAAATTGT----CACAG C_porcellus300144 ---GGTGTCC-AAAACTGGTC--AATGTGG-CTGAAATTGT----CACAG C_porcellus300183 ---GGTGTCC-AGGACTGGTC--AGGGTGG-CTGAAACTGGGA--TGCAG C_porcellus300192 ---GGTGTCC-AAAATTGGTC--AGCGTGG-CTAAAACTGAGA--CCCAG C_porcellus300358 ---GGTGTCC-AAAATTAATC--AATGTGG-CTGAAATTGT----CACAA C_porcellus300486 ---GCTGTCC-AAAACTGGTC--ATTGTGG-CTAAAATTGAGACACACAA C_porcellus300589 ---GGTGCCC-AAAATTAGTT--TATGTGC-CTAAAATTGAGA--CACAG C_porcellus300622 ---GGTGTCCCAAAACTGGTC--AATGTGGGCTGAAATTGT----CACAG C_porcellus300779 ---GGTGTCC-AAAACTGGTC--AATGTGG-TTGAAATTGT----CACAG C_porcellus300800 ---GGTGTCC-AAAATTGGTC--AGTGCAG-CTAAA-TGGAGA--CACAG C_porcellus300893 ---GGTGTCC-AAAATTGGTC--GGTGTGG-CTGAAATTGAGATA--CAG D_rerio300212 AGCAAGTTCC-TCAATCTGCA-------AGGCTAGAAAAACGC----CAG D_novemcinctus300086 ---GGTGTCC-AGAATTGATA--AATGTGG-CT-AAATTGAGACA--CAG D_novemcinctus300185 ---GGTGTCC-AAAATTGATA--AATGTGG-CT-AAATTGAGACA--CAG D_novemcinctus300225 ---GGTGTCC-GGAAGTGATA--GATGTGG-CTACAATGAGAC---ACAA D_novemcinctus300246 ---AGTGCCC-AGAACTGCTA--A-TATGG-CT-AAATTTAGACA--CAA D_novemcinctus300265 ---GGTGTCC-AGAATTGCTT--A-TGTGG-CT-AAACTGAGATG--CAG D_novemcinctus300286 ---GGTGTCC-AGAA-----A--AATGAAG-CT-AAATTGAAACA--CAG D_novemcinctus300306 ---GCTGTC--AGAAATTGTT--AATGTGG-CT-AAATTGAGACA--TAG D_novemcinctus300390 ---GATTTCC-AGAACTGCTA--A-GATGG-CT-AAATTGAGA-A--CAG D_novemcinctus300395 ---GGTGTCC-AAAATTGATA--AATGTGG-CT-AAATTGAGACA----G D_novemcinctus300421 ---GGTGTCC-AGAACTGATA--AATGTGG-CT-AAACTGAGACA--CAG D_novemcinctus300447 ---GGTGTCC-AGAATTGCTT--A-TGTGG-CT-AAACTGAGAGG--CAG D_novemcinctus300455 ---AGTGTTC-AGAAT-TGTT--GATATGG-CTAAATCAAGAC---ATAG D_novemcinctus300612 ---GGTGTCC--AGAATTGTT--AATGTGG-CT-AAATTGAAGCA--TGA E_telfairi300049 ---GGGGTCT-AGACG-GGCA--GTTGTGG-CTGAAAAAATG----ACAG E_telfairi300097 ---GGTGTCC-AGACA-AGCA--GTTGTGG-CTGAAAGGATG----ACAG E_telfairi300110 ---GGTGTCC-AGACA-GGCA--GTTGTGG-CTGAAAGGATG----ACAG E_telfairi300112 ---GGTGTCC-AGACG-GGAA--ATTGTGG-CTGAAAGGATG----ACAG E_telfairi300233 ---GGTGTCC-AGACA-GGCA--GTTGTGG-CTGAAAGGATG----ACAG E_telfairi300240 ---GGTGTCC-AGACA-AGCA--GTTGTGG-CTGAAAGGATG----ACAG E_telfairi300316 ---GGTGTCC-AGAAT-GGCA--ATTTTGA-CTTAAAAAAAG----ACAA E_telfairi300408 ---GGTGTCC-AGACG-GCAG---TTGTGG-CTGAAAGGATG----ACAG E_caballus300023 ---GGCATCC-AGAAATTATT--AATGTAG-CT-ATATTGAGACA--CAA E_caballus300085 ---GGTGTCC-AAAAATTGTT--ATTGTGG-CC-ATATTGAAACA--CAT E_caballus300149 ---GGTGTCC-AGAAATTGTT--AATGTGG-CT-ATATTGAGACA--CAG E_europaeus300112 A--GGTGTTC-AGAA---ATA--GATGTGG-CTACATT--GA---TACAG E_europaeus300270 T--GGTG------AA---ATA--GATGTGG-CTACATT--GA---TACAA E_europaeus300417 T--GGTGTTC-AGAA---ATA--GATATGG-CTACATT--GA---TACAG E_europaeus300460 T--GGTGTTT-AGAA---ATA--GATGTGG-CTACACT--GA---TACAG E_europaeus300483 T--GGTGTTC-AGAA---ATA--GATATGG-CTACATT--GA---TACAG F_catus300013 ---GGTGTCC-GGAAATTGTT--AATATAG-CT-ACATTAAGACA--CAA F_catus300049 ---GGTGTCC-AGAAATTGTT--AACGTGG-CT-ACAATAAGACA--CAG F_catus300054 ---GGTGTCC-AGAGATTGTT--AACGCGG-CT-ACACTGAGACA--CAC F_catus300130 ---GGTGTCC-ACAGATTGTC--AGTGTGG-CT-ACATTGAGGCA--CAG H_sapiens300749 ---GGTGTCC-AAAAATAGTT--AATGTGG-CT-AAATTGAGACA----G M_mulatta300049 ---GCCATCC-CGAGATTGTT--AATGGGG-CT-ACATTGAGAAA--CAA M_mulatta300052 ---GGTGTCT-GAAAATCGTC--A--GCGG-CT-AAATTGAAACA--CAG M_mulatta300070 ---GGTGTCC-AAAAA-AGTT--AATGTGG-CT-AAACTGAGACAG--AG M_mulatta300213 ---GGCGTCC-AAAAATAGTT--AATGTGG-CT-AAACTGAGACA----G M_mulatta300662 CATGGTGTCC-AAAAATAGTT--AATGTGG-CT-AAATTGAGACA----G M_murinus300112 ---GGTGCCC-AGAAATGGTT--AAAGGGG-CT-AAATTGAGACA--CAA M_murinus300193 ---AGTGTCC-AAAAATTGTT--GATGTGG-CT-AAATTGA--CA--CAG M_murinus300332 ---GGTGTCC-AAAAATTGTT--AATGTGG-CT-AACCTGAGACAT--AG O_anatinus304399 ---TGTGTCA---CATGGAAC--AATGTGG-CT-ACAGTGAAA-GCACAG O_cuniculus300016 ---GGTGTCC-AAAAAAGGTT--ACTGTGT-CT-AAATTGAGACA--CAG O_cuniculus300171 ---GGCCTCC-AAAAATTGTGGCAACGTGG-CT-GAACAGAGACA--TAG O_cuniculus300367 ---GGTATCC-AAAATTA-TC--ATTATGG-CT-AAACTGAGACA--CAG O_cuniculus300397 ---GGTGTCC-AAAAACTGTT--AATGTGG-CT-AAATTGAGATA--CAG O_garnettii300344 ---GGTGTCC-AAAAATTGTT--TATGTGG-CT-AAACTGAGACA--CAG O_garnettii300471 ---GGCATCC-AGAAATTATT--AATGGGG-CT-AAATTGAGATT--CAA O_garnettii300557 ---AGTGTTC-AAAAATTGTT--AATGTGG-CT-AAATTGAGACA--CAG O_garnettii300561 ---AATATCC-AAAAATTGTT--AATGTGG-CT-CAATCGTGGCA--CAA O_garnettii300668 ---AGTGTCC-AAAAATTGCT--AATGTGG-CT-AAATTGACATA--CAG P_troglodytes300136 ---GGTGTCC-AAAAA-ACTT--AATGTGG-CT-AAATTGAGACAC--AG P_troglodytes300158 ---GGTGTCT-GAAAATTGTA--A--GTGG-CT-AAATTGAAACA--CAG P_troglodytes300470 ---GCGATCC-AGAGATTGTT--AATGGGG-CT-ACATTGAGAAA--CAA P_troglodytes300481 ---TGTGTCC-AAAAATAGTT--AATGTGG-CT-AAATTGAGATA----G P_troglodytes300672 ---GGTGTCC-AAAAATAGTT--AATGTGG-CT-AAATTGAGACA----G P_pygmaeus300297 ---GGTGTCC-AAAAATAGTT--AATGTGG-CT-AAATTGAGACA----G P_pygmaeus300370 ---GCCATCC-AGAGATTGTT--AATGGGG--T-ACATTGAGAAA--CAA P_pygmaeus300413 ---GGTGTCT-GAAAATTGTA--A--GTAG-CT-AGATTGAAACA--CGG P_pygmaeus300422 ---GGTGTCC-AAAAA-AGTT--AATGTGG-CT-AAATTGAGACAC--AG P_pygmaeus300519 ---GGTGTCC-AAAAATAGTT--AATGTGG-CT-AAATTGAGACA----G R_norvegicus300295 C--AATGTCC-AGAACTGGTC--AATGTGG-CTAAATTGAGA---TACAG R_norvegicus300860 C--AGTGTCC-AG----TGTC--AATGTGG-CTACATTAAGA---TACAG S_araneus300276 ---GGTGTC----CAGAGGGA--AATGTGA-CC-ACATTGA---CCACAG S_tridecemlineatus300048 ----GTGTCC-AAAGTTGGTC--AATGTG--CT-AAACTGA--CA--CAG S_tridecemlineatus300191 ----GTGTCT-AAAATTGGTC--AGTGTGG-CT-AAATTGA--CA--CAG T_belangeri300064 ---ATCGTCC-AAAAATGGTT--CCCCTGG-CT--AGTTGAGACA--CAG T_belangeri300181 ---AGTGTCC-AAAA-TTGTT--AATGTGG-CT-AAATTGAGACA--CAG C_familiaris300030 GTT--ATGCTT--CCAT-CACAGCAAGTTTTT--------TGCAGTG-CT C_familiaris300076 GTT--ATGCTT--CCAT-TACAGCAAGTTCAT--------TGCAATG-GT C_familiaris300116 ATT--ATGCTT--CCAT------------TAT--------TGCAAGG-GC C_familiaris300154 GTT--ATGCTT--TCAT-CACAGCAGATCTAT--------TGCAGTG-GT C_familiaris300198 GGC----GCTT--CCAT-CACAGCAAGATGAC--------CGCAGGG-GT C_familiaris300213 GTT--ATGCTT--CTAT-CATAGCAAGTTTAT--------TGTAGTG-GT C_familiaris300467 GTT--ATGCTT--CCAT-CACAGTAAGTTTAT--------TGCTGTG-GT C_porcellus300025 GTC--ATGCTT--CTAT-CATAGTAAATGT---------TTACAG-TGGT C_porcellus300081 GTC--ATGTTT--CCAT-CACAGTAAATGT---------TTACAG-TGGT C_porcellus300122 GTC--ATGCTT--CCAT-CACAGTAAATGT---------TTACAG-TAGT C_porcellus300144 GTC--GTGCTT--CCAT-CACAGTAAATGT---------TTACAG-TGGT C_porcellus300183 GTC--ACACTT--CCAT-CACAGTAAACAT---------TTATAG-TGGT C_porcellus300192 GTGT-ATGCTT--CCAT-CACAGTAAGTGT---------TTATAG-TGGT C_porcellus300358 GTC--ATGCTT--CTAT-CATAGTAAATGT---------TTACAG-TGGT C_porcellus300486 GTC--ATGCTT--CCAT-C--AGTAAATGT---------TTACAG-TGAT C_porcellus300589 GTC--ATGGTT--CTAT-CACAATAAATGT---------TTACAG-GAGT C_porcellus300622 GTC--ATGCCTTCCCTT-CACAGTAGATGG---------TTACAGGTAGT C_porcellus300779 GTC--GTGTTT--CCAT-CACAGTAAATGT---------TTACAG-TGGT C_porcellus300800 GTG--ATGCCT--CTGT-CATAGTAAATGT-A-------TCACTG-TGGT C_porcellus300893 GGA--ATGCTT--CCAT-CACAATAAATGT-T--------TACATTG-GT D_rerio300212 GTT---TGCTT--TCAT-CACTGTAAACCCCA-------TTGCAGAG-AT D_novemcinctus300086 ATT--ATGCTT--CCAC-CAGAGTAAATTCAT--------TGCAGTA-GT D_novemcinctus300185 GTT--ATGCTT--CCGT-CACAGTAAATTTAT--------TGCAGTA-GT D_novemcinctus300225 GTT--ATGCTT--CCAT-CACAGTAAA-TCAA-------ATGCTACC-GT D_novemcinctus300246 GTT--ATGCTT--CCAT-CACAATATATTTAT--------TGCAGTG-GT D_novemcinctus300265 GTT--ATGCTT--CCAT-CACAGTAAATTTAT--------TTCAGTG-GT D_novemcinctus300286 TTT--ATCCGT--CCAT-TACAGTTAATTTAT--------TGCAGTA-GT D_novemcinctus300306 GTT--ATTCTT--CCAT-CACAGTAAATTTAT--------TGTAGTG-GT D_novemcinctus300390 GTT--GTGCTT--CCAT-CACAGTACATTTAT--------TGCAGTG-GT D_novemcinctus300395 GTT--ATGCTT--CCAT-CACAGTAAATTTAT--------TGCAGTG-GT D_novemcinctus300421 GTT--ATGCTT--CCAT-CACAGTAGATTTAT--------TGCAGTG-AT D_novemcinctus300447 GTTTTATGCTT--CCAT-CACAGTAAATTTAT--------TGCACTG-GT D_novemcinctus300455 GTT--ATGCTT--CCAA-AACAGTAAAATTTA-------TTGCTGTG-TT D_novemcinctus300612 GAT--ATGCTT--CCAT-CCCAGTAAATCCAT--------TGCGGTG-GT E_telfairi300049 GTT--TTGCTT--CCAT-CA-TGTGGA-TTAA-------TTTCAGTG-GT E_telfairi300097 GTT--TTGCTT--CCAC-CACTGTGGG-TTAA-------TTTCAGTG-GT E_telfairi300110 GTT--TTGCTT--CCAT-CACTGTGGG-TTAA-------TTTCAGTG-GT E_telfairi300112 GCT--TTGCTT--CCAT-CACTGTGGA-TC-A-------TTTCAGTG-GT E_telfairi300233 GTT--TTGCTT--CCAT-CACTGTGGG-TTAA-------TTTCAGTG-GT E_telfairi300240 GTT--TTGCTT--CCAC-CACTGTGGG-TTAA-------TTTCAGTG-GT E_telfairi300316 GTT--TGGCTT--CCAT-CACTGTAGA-TTAA-------TTTCAGTG-GT E_telfairi300408 GTT--TTGCTT--CCAT-CACTGTGGG-TTGA-------TTTCAGTG-GT E_caballus300023 GTT--ATGCTT--CCAT-CACAGTAGGTTTGT--------TCCAGTG-GT E_caballus300085 GTC--ATCCTT--CCCT-CACAGTACGTGTAT--------TGCAGCG-GT E_caballus300149 GTT--ATGCTT--CCAT-CACAGTACGTGTAT--------TACAGTG-GT E_europaeus300112 GTT--AAGCTT--CCAC-CACAGCATCT---A-------TTGCAT-TGGT E_europaeus300270 GTT--AAGCTT--CCAC-CACAGCATCT---A-------TTGCAT-TGGT E_europaeus300417 GTT--AAGCTT--CCAC-CAAAGCATCT---A-------TTGCAC-TGGT E_europaeus300460 GTT--AAGCTT--CCAT-CACAGCACCTT--A-------ATGCAG-TAGT E_europaeus300483 GTT--AAGCTT--CCAC-CAAAGCATCT---A-------TTGCAC-TGGT F_catus300013 GTT--ATGCTT--CTAT-CACTG------------------GCAGCG-GT F_catus300049 GTT--ATGCTT--CCAT-TGCAGCAAGTTGAT--------TGCAGTG-GT F_catus300054 ATT--TTGCTA--CCAT-CACAGCAAGTTTAT--------TGCTGTG-GT F_catus300130 GTT--ATGCTC--CCAT-CACAA---GTGTAT--------TGCAGGG-GT H_sapiens300749 GTT--ATGCTT--CCAT-CACAGTATGCATAT--------TGCAGTG-GT M_mulatta300049 GCT--ATGTTT--CCAT-CACAGCAAACACAT--------CACTGTG-GT M_mulatta300052 GTT--ATGCTT--CCAT-AACAGTGTATATAT--------TGCAGTG-GG M_mulatta300070 GCT--ATGCTT--CCAT-TACAGTACACACAT--------TGCAGTG-GT M_mulatta300213 GTT--ATGCTT--CCAT-CACAGTATGCATAT--------TGCAGTG-GT M_mulatta300662 GTT--ATGCTT--CCAT-CACAGTATGCATAT--------TGCAGTG-GT M_murinus300112 GTT--ATGGGT--CTGC-AACACCAAATGTAT--------TGCAGTG-GT M_murinus300193 GTT--ATGCTT--CCAT-CACAGTACATGTAT--------TACAGTG-GT M_murinus300332 ATT--ATGCTT--CCAT-CATGGTATATATATATATATATTGCAGTG-GT O_anatinus304399 GTT--TTGCTT--CCAT-CACAGTAAAAATAAG------TTACTCTG-GT O_cuniculus300016 GCC--ATGCTT--CCAT-CACAGTAAATGTAA--------TGCAGTG-GT O_cuniculus300171 ATT--GTACTT--CCAG-CACAGTAAATGCAT--------TGCAGTG-GT O_cuniculus300367 GTC--ATGCTT--CTAT-CACAGTAAACGAAC--------TGCAGTG-GT O_cuniculus300397 GTT--ATGCTT--CCAT-CACAGCAAATGAAT--------TGCAGTG-GT O_garnettii300344 GTT--ATGCTT--CTAA-CACAGTTTATGTAT--------TGCAGTG-GT O_garnettii300471 GTT--AGGCAT--CCAT-CACAGCAAACATAT--------TAAAGTG-GT O_garnettii300557 GTT--ATGCTT--CCAT-CACAGTATATGTAT--------TACAGTG-GT O_garnettii300561 GTT--ATGCTT--CCAT-CACAGTGTATTTGT--------TGCAATA-GT O_garnettii300668 GTT--ATGCTT--CCAT-CACAGTATATGTAT--------TACNN----- P_troglodytes300136 GCT--ATGCTT--CCAT-CACAGTACACATAT--------TGCAGTG-GT P_troglodytes300158 GTT--ATGCTT--CCAT-AACAGTATCTGTAT--------CGCAGTG-GT P_troglodytes300470 GCT--ATGTTT--CCATTCACAGCAAACACAT--------CACAGTG-GT P_troglodytes300481 GTT--ATGCTT--CCAT-CACAGTATGCATAT--------TGCAGTG-GT P_troglodytes300672 GTT--ATGCTT--CCAT-CACAGTATGCATAT--------TGCAGTG-GT P_pygmaeus300297 GTT--ATGCTT--CCAT-CACAGTATGCATAT--------TGCAGTG-GT P_pygmaeus300370 GCT--ATGCTT--CCATTCACAGCAAACACAT--------CGCAGTG-GT P_pygmaeus300413 GTT--ATGCTT--CCAT-AACAGTATATGTAT--------TACAGTG-GT P_pygmaeus300422 GCT--ATGCTT--CCAT-CACAGTACACATAT--------TGCAGTG-GT P_pygmaeus300519 GTT--ATGTTT--CCAT-CACAGTATGCATAT--------TGCAGTG-GT R_norvegicus300295 GTC--ATGCTT--CCAT-TACAGCAGATTAAA-------TTACAG-TGGT R_norvegicus300860 GTC--ATGCTT--CCAT-CACAGCAGATTAAA-------TGACAG-TGGT S_araneus300276 GTC--ATGCTT--CCAT-CATAGCAG--GCTCG------TTGCTGTG-GT S_tridecemlineatus300048 TTT--CTGCGT--TCAC-CACAGTATATGTAT--------TGCAGTGTGT S_tridecemlineatus300191 TTT--ATGCTT--CTAT-CACAGTATATGTAT--------TGCAGTG-GT T_belangeri300064 GTT--ATACTT--CCAT-CATGGTAAATGGAT--------TGCAATG-GT T_belangeri300181 GCT--ATGCTT--CCAT-CACAGTAAACGTAT--------TACAGTG-GT C_familiaris300030 GA----CAATGAGACACGTAATATTT C_familiaris300076 GAGTTACAATGAGACCTGTAACATTT C_familiaris300116 AA----GAATGAGACCTGTAACATTT C_familiaris300154 GA----CAATGAGACTTGTAACATTT C_familiaris300198 GA----CCACGAGGCC-ATAACATCC C_familiaris300213 GA----CAATGTAACATTTTTCACTA C_familiaris300467 GA----CAATGAGGCCTGTAACATTT C_porcellus300025 AA----CAATGAAACTTGTAACATTT C_porcellus300081 GA----TAATGAGACCTGTAACATCT C_porcellus300122 GA----CAAAGAGACCTGTAACATCT C_porcellus300144 GA----CAATGAGACCTGTAACATCT C_porcellus300183 GA----CGGTGAAACCTGTGACATTT C_porcellus300192 GA----TAATGACACCTGTAACATTT C_porcellus300358 AA----CAATGAAACTTGTAACATTT C_porcellus300486 GA----CAGTAAGACCTGTAACATTT C_porcellus300589 GA----CAATGAGACCTGTAACATTT C_porcellus300622 GG----ACAAGAGACCTGTGACATCT C_porcellus300779 GA----CAATGAGACCTGTAACATCT C_porcellus300800 GA----CAGTGAGACCTGCGACACTT C_porcellus300893 GA----CAGTGAGACATTTTGGCTAA D_rerio300212 GA----CAATGAGGCCTGGAATATTC D_novemcinctus300086 GA----CAATGAGAACTGTAATTTTT D_novemcinctus300185 GA----CGAAGAGATCTGTAACATTT D_novemcinctus300225 GA----CAATGAGACCTGTAACAATT D_novemcinctus300246 CA----CAATAACACCTGTAACTTTC D_novemcinctus300265 GA----CAATGAGATCTGTAACATTT D_novemcinctus300286 GA----CAATGAGACCTATAACATTT D_novemcinctus300306 GA----CAGTGAGACCTGTAATACAT D_novemcinctus300390 GA----CACTGAGACTTGCAACTTTT D_novemcinctus300395 GA----CAATGAGACCTGTAACATTT D_novemcinctus300421 GA----CAATGAGACCTGTAACATTT D_novemcinctus300447 GA----CAATGAGACTTGAAACTTTT D_novemcinctus300455 GT----CAGTGAGACCTGTAACATTT D_novemcinctus300612 GA----AAATGACACCTCTAACATAT E_telfairi300049 GA----CAATGAGACCTGTAACACTA E_telfairi300097 GA----CAATGAGACCTGTAACACTT E_telfairi300110 GA----CAATGAGACCTGCAACACTT E_telfairi300112 GA----CAATGAGACCTATAATACTT E_telfairi300233 GA----CAATGAGACCTGTAACACTT E_telfairi300240 GA----CAATGAGACCTGTAACACTT E_telfairi300316 GA----CAATGAGACCTGTAATACTC E_telfairi300408 GA----CAATGAGACCTGTAACACTT E_caballus300023 GA----CAGTGAAACCTGTAACATTT E_caballus300085 GA----CAATGAGACCTGTAACATTT E_caballus300149 GA----CAATGAGACCTGTAACATTA E_europaeus300112 GA----CAATGAGGCCTGCAACATGT E_europaeus300270 GA----CAATGAGGCCAGCAACATGT E_europaeus300417 GA----CAATGAAGCCTGTAAGATGT E_europaeus300460 GA----CAATGAGGCCTGAAACATGT E_europaeus300483 GA----CAATGAAGCCTGTAAGATGT F_catus300013 GA----CAATGAGACCTATAATGTTT F_catus300049 GA----CATTGAGAACTGTAACATTT F_catus300054 GA----CAGTGAGACCCATAACAGCA F_catus300130 GA----CGGTGAGACCTGCACCATTT H_sapiens300749 GA----CAATGAGACCTGTAACATTT M_mulatta300049 GA----CAATGAGACCTGTAACATTT M_mulatta300052 GA----CAATGAGACCTGTAACATTT M_mulatta300070 GA----CAATGAGACCTGTAACATTT M_mulatta300213 GA----CAATGAGACCTGTAACATTT M_mulatta300662 GA----CAATGAGACCTGTAACATTT M_murinus300112 GA----CAATGAGAACTGTAATGTTT M_murinus300193 GA----CAATGAGACCTGTAACATTT M_murinus300332 GA----CAATGAGACCTGTAACATTT O_anatinus304399 GA----CAATGAGACCTGTAACAGGA O_cuniculus300016 GA----CAATGAGAATTATATTTTTG O_cuniculus300171 GA----CAGTGAGACCTGAAACATTT O_cuniculus300367 GA----CAAGAAGACCTCTAACATTT O_cuniculus300397 GA----CAATGAGACCTGTAACAATT O_garnettii300344 GA----CAATGAGGCCTGGAATATTT O_garnettii300471 AA----CAAGGAGACCTGTAATATTC O_garnettii300557 GA----CAATGAGACCTGTGACATTT O_garnettii300561 GA----CAATGAGACCTGTGACATTT O_garnettii300668 -------------------------- P_troglodytes300136 GA----CAATGAAACCTGTAACATTT P_troglodytes300158 GA----CAATGAGACCTGTAACACTT P_troglodytes300470 GA----CAATGAGACCTGTAACATTT P_troglodytes300481 GA----CAATGAGACCTGTAACATTT P_troglodytes300672 GA----CAATGAGACCTGTAACATTT P_pygmaeus300297 GA----CAATGAGACCTGTAACATTT P_pygmaeus300370 GA----CAATGAGACCTGTAACATTT P_pygmaeus300413 AA----CAATGAAACCTGTAACATTT P_pygmaeus300422 GA----CAATGAAACCTGTAACATTT P_pygmaeus300519 GA----TAATGAGACCTGTAACATTT R_norvegicus300295 TA----CAATGAGACCTGCAACATTT R_norvegicus300860 GA----CAATGAGACCTGCAACATTT S_araneus300276 GA----CAATGGGACCTGTGACAGGT S_tridecemlineatus300048 GA----CAGTGAGAC-TGTAATATTT S_tridecemlineatus300191 GA----CAATGAGACCTGTAACATTT T_belangeri300064 GA----C---GAGTGCTGTCACATTT T_belangeri300181 GA----CAATGAGACCTGTAACATTT

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved