snOPY snoRNA Orthological Gene Database

Family: SCARNA8

CLUSTAL 2.0.10 multiple sequence alignment H_sapiens300778 TGGGAGGCTGATACACAAATTGGGCTGAAATACTGCTCTACTTGTCACCATGCCTCCCTA O_anatinus303630 TGGGAGACTGATACACAGATAGGGCTGAAGTACTGCTCTAAATGTCACAATGCCTCCCTA T_nigroviridis300147 TGGGAGGCAGATACCTGGGCAGGCCTGA-GCGCCGGCCTGTCCGCCACGCGTCCTCCCGA T_nigroviridis300150 TGGGAGGCAGATACCTGGGCAGGCCTGA-GCGCCGGCCTGTCCGCCACGCGTCCTCCCGA ****** * ***** ** **** * * ** * *** ****** * H_sapiens300778 GAATAAA-CTGCCTTTTGATGACCGGGACGAATTGAGTGAAATCGTAACGGACAGATACG O_anatinus303630 GAATAAAACTGCCTTTTGATGACCGGAACGAATTGAGTGAAATCGTAACGGACAGATACG T_nigroviridis300147 CAGCATCGCTGCTCTCTGATGACCGCGGCGAGTTGAGGGAAATCGCCGCGGACAGATACG T_nigroviridis300150 CAGCATCGCTGCTCTCTGATGACCGCGGCGAGTTGAGGGAAATCGCCGCGGACAGATACG * * **** * ********* *** ***** ******* ************ H_sapiens300778 GGGCAGACAGAT O_anatinus303630 GGGCAGATAACT T_nigroviridis300147 GAGCAGACAGGC T_nigroviridis300150 GAGCAGACAGGC * ***** *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved