snOPY snoRNA Orthological Gene Database

Family: SCARNA17

CLUSTAL W (1.83) multiple sequence alignment H_sapiens300783 AGAGGCTTGGGCCGCCGAGCTGGACCCGGACCGGTTTTGGGTACTGTACTGGGGGCAGGG O_anatinus302903 ------------------------------------------------------------ H_sapiens300783 CAGAGAGGTGGGCGGCAGTTGGGGTGCGGTGATTGTAGTAGGCTAGGGCGCTTTCGGGTC O_anatinus302903 ----------------------------------------------------TTGGCAGG ** * H_sapiens300783 CCCATTG-CAGCCCCCGGATGAGCCCGCAGTATTTTCCTTATATGATCAGGTCCCATTGC O_anatinus302903 GCAGTTGATCGACCCCACATGATCCCAT--TATTTTCCTTATATGATCAGGCTTCACGAC * *** * **** **** *** ********************* ** * H_sapiens300783 GGGCGGCGCCGCTTGCCCGGAGCCTGAGAGGATTATGAAAACGTGGCGAGCGAAATGGGG O_anatinus302903 AAG-GGCAGCCCTTGTTCGAAGCCTGAGGTGATTCTTTTTTGAGAGCTGGCGA--TGGGG * *** * **** ** ******** **** * ** **** ***** H_sapiens300783 CCAGGGGACCTGGAGCAGGGGCGTGAGGAGAGTAGGCAGCGGGTGAGGCTGGACGGGAGG O_anatinus302903 CTTAGGGTTCAGCGT--------------------------------------------- * *** * * H_sapiens300783 GAGGTCTAGGGAGGCCTCTGCCGCGGGCACTGTGAGTCCTGGCCGATGATGACGAGACCA O_anatinus302903 ------------------------------------------------------------ H_sapiens300783 CTGCGCAATCTGAGTTCTGGGAACCAGGTGATGGAGTATGTTCTGAGAACAGACTGAGGC O_anatinus302903 ------------------------------------------------------------ H_sapiens300783 CG O_anatinus302903 --

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved