snOPY snoRNA Orthological Gene Database

Family: SCARNA15

CLUSTAL 2.0.10 multiple sequence alignment H_sapiens300779 CTGGAGACT-AAGAAAATAGAGTCCTTGAA--ATCAAGCTGACTCTGCTTTTAGCCTCCT T_nigroviridis300044 CAGGAGGTTTAAGAAGGTGAGACTACTAAAGGATATAGTCTTCACCGATACCCACCTCCT * **** * ***** * * ** ** ** * * * * ****** H_sapiens300779 AAA-TGAAAA-GGTAGATAGAACAGGTCTTGTTTGCAAA-ATAAATTC-AAGACCTACTT T_nigroviridis300044 AAAGTGAAAGCGGTAGTGTGAACCA-CCTGATCTCCAGAGATAGGTCCTGAGTGCTCTGC *** ***** ***** **** ** * * ** * *** * * ** ** H_sapiens300779 ATCTACCAACAGCA T_nigroviridis300044 ACCTACCTACAATC * ***** ***

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved