snOPY snoRNA Orthological Gene Database

Family: SCARNA13

CLUSTAL W (1.83) multiple sequence alignment H_sapiens300781 AATCTGTAGTCTTGGAGCCGCACAGGGTTGGTGGTACCCTCGAGCACACCAGACTTGCAG O_anatinus304440 CATCTGCAGCCTCGGAGGTGCTCTGGGTTGTTAGTACCCT-GGGCGGATGGGGCTCGCAG T_nigroviridis300096 -------AGTCTGCTCCTGGCAAAGAGCTGTTG---CTTGTGGGCACATCAAGGTTGCAG ** ** ** * * ** * * * ** * * **** H_sapiens300781 AAAAAGCATACTCCAGAGGAAGCTGAGGCATGCCTGCTCGAGAGCCAGCTGTTCCATGTG O_anatinus304440 AGAGAACATAGCCCAGAGGAAGCTGAGGCATGACTGTTAAAGGGGCAGCAGCGCCATGTG T_nigroviridis300096 AAAG----CATCCCAAAGAATGAAAAGGCGTGACTTCCAGAGCCCCGGGC-TTCCACGTG * * * *** ** * * **** ** ** ** * * *** *** H_sapiens300781 CAATTTTCCTCTGATAGTTT-CTGGTCACTGTTGCCACGGTGATAATGA-CTGGGCT-AT O_anatinus304440 CAATATTCCTCTGACACCAAACCAGATACTGTTGTCACGGCGATGATGA-CCTCTCTCGT T_nigroviridis300096 CGATCTTCTTTGAACACACTCCTGC------TTTCCACGGCGGTGATGGGCTCCATCTGT * ** *** * * * * ** ***** * * *** * * H_sapiens300781 GTCAT-TATCTATCCGCCAACAGTAAGAGAAGCTTTGCAGTCGAGATATTGTTT--AGCA O_anatinus304440 GTCATCTGTCTATCTATCAACAGTTAGAGCAGCGTCGCAGTCAAGATATGGTTC--GGCA T_nigroviridis300096 AGCCATCACCTTTCTTGAGGCAGGTAGAGGAAAA--GCAGCCT-GATATTGTTTGAAGCG * ** ** *** **** * **** * ***** *** ** H_sapiens300781 GATGGAGTGTTTTCTGTTGAACACTAAGTACTGCCACAAGT O_anatinus304440 AAGGGAGTGGTTTCTGCCGAACACTGAGAACTGCTATAAGC T_nigroviridis300096 GGGGAAGCTTTTCCCGTCAGACACTGTCGGCTGTGACACCC * ** ** * * ***** *** * *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved