snOPY snoRNA Orthological Gene Database

Family: SCARNA11

CLUSTAL W (1.83) multiple sequence alignment C_elegans300074 ----------------------------------GTTTTTCTAGAGATTTCACCGATTCT H_sapiens300794 -----------------TTGTCCTGGCCTATTTTTCTGCTCCCCTGTGCTCAGTTCTAAC O_anatinus303099 -----------------CCGTCCCGGCCCTTGCAGCTGCCCCCCTGTGCCGAGCTGTGGC S_cerevisiae300001 TACTAGCACATATGTCAAATTCCTAATTAACGTTTTTTATATTCATCGTTTCTTAGAGCC T_nigroviridis300064 ----------------------------------------CTGTCGAACCATGTTA-GCC C_elegans300074 TTTGAAGTATCGGTGCACCAAGTGAAAAATAAAAT----TGCGACGCTTTAGTGACGCTG H_sapiens300794 AGGGTAGTCT----G-GCAGGACACACAGCAATTC----CCTCTCAGTTTAGGAGGGCCG O_anatinus303099 GGGGGGGTGTCCG-G-GCGGGACACACAGTAACCCTAACCCTCTCCATTTAGGAGGGCCC S_cerevisiae300001 GTAATTGTGCTGATATCAATATCAGGGAAGAACATACCATATAGAGGTGTCAAGTACACC T_nigroviridis300064 GGTGGGGTTTCAG-ACATGTGACAAAGAGTAAGTT-----TGCCCAATAAAGGGGATGAG ** * ** * C_elegans300074 GAGAAAGTTTTTATCCAGTGT--CTAAAGGCGCGGCGCAACATTT------ H_sapiens300794 TCCTAAGAATAGGGCTGGCTC--TTAAAGGCACGAGAGGACAATT------ O_anatinus303099 CCCCGAGGCTGGGGGTGGTCC--TTAAAGGCAAGAGAGGACAAA------- S_cerevisiae300001 GAACGATCGTGGTGCTCCCTCAGCCACGGGCGTGCTTGGACGCTATTCCCA T_nigroviridis300064 TTCCAAGTTGGGAGCTCCATC--CTAAAGGCAGGGCAAAACATT------- * * *** * **

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved