snOPY snoRNA Orthological Gene Database

Family: SnoR30

CLUSTAL 2.0.10 multiple sequence alignment A_thaliana300059 ----------------------------ACGATGAGGATGTACAGCTCCCTCTTCTGATT A_thaliana300215 TTTAATGATGATGGGGATTTTGGAGATTACGATGAGGATGTACAGCTCCCTCTTCTGATT ******************************** A_thaliana300059 AAGCTGAAGAGAATTGCTGGCAGAATCGAACCTAAATCACTAGCCACTACTGAGTT A_thaliana300215 AAGCTGAAGAGAATTGCTGGCAGAATCGAACCTAAATCACTAGCCACTACTGAGTT ********************************************************

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved