snOPY snoRNA Orthological Gene Database

Family: SNORD76,snoRNA:Me28S-A1666

CLUSTAL 2.0.10 multiple sequence alignment D_melanogaster300156 TGTAAATGATGATTTATTATTATTTGCTACTCTTGAAGGTCATTGATGAATACTTTCACC D_melanogaster300159 TGAAAATGATGATTAATTATTATTTGCTACTCTTGAAGAGCTTTGATGAATACTTACACC ** *********** *********************** * ************* **** D_melanogaster300156 TTAAAACCTGATG D_melanogaster300159 TTAGAAACTGAGT *** ** ****

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved