snOPY snoRNA Orthological Gene Database

Family: SNORA6

CLUSTAL 2.0.10 multiple sequence alignment D_melanogaster300211 AGTGCATATTATTAGAACCGGTTATGCA------TCTCA----ACAACTCAATCGGTGTC D_melanogaster300212 GCTGCATATCATTAGAGCTGACTATAAAG-----TTTCA----AAAATGTAATCGGTGTC H_sapiens300603 --TGCACACTATTAAAGCTCAGGGTGGAGGCCAGTCTTGGCTCATGAACTTCTGAGTGTC **** * **** * * * * * * * * * ***** D_melanogaster300211 AAAAT-ATGCAAAATAAAAAGCCACAT-TTTACTTGTCTTTATTTTGTAAAATTACTACC D_melanogaster300212 AAGA--ATATGCAATAACAATCAACACATTTACTTGTCTTTGGTTTGTCCTA-----AAC H_sapiens300603 GGAAGTGTGCTATATCAATGGCAGGAT-TTTCGCTAACACCAGTAGAGCTTGCCTCTATG * * ** * * * *** * * * * D_melanogaster300211 GCCAGCAATCTAAAGATTTCTAATGTTGCAACAACA D_melanogaster300212 ACTAACGTTCTGAAGATTTCTTATGTGTCAACAACT H_sapiens300603 ACTGG-AGTTTGGTAGTACTCGCTGCCACATAG--- * * * * ** **

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved