Xenopus_tropicalis Locus ENSXETG00000023692
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis ENSXETG00000023692
Xenopus_tropicalis
ENSXETG00000023692
scaffold_4841
SNORD77
1465..1524
4402
CTATATAACTGCATTGTTCAGCAGATCGGAATATACAATGCAGCTATGGCTGTATGCCT
ATATAACTGCATTGTTCAGCAGATCGGAATGTACAGTGCAGCTATGGCTGTATGGCTATA
TAACTGCATTGTTCAGCAGATTGGAATGTACAGTGCAGCTATGGCCGTATGGCTATATAA
CTGCTTTGTTCAGCAGATTGGAATGTACAGTGCAGCTATGGCTGTATGCCTATATAACTG
CACTGTTCAGCAGATCGGAATGTACAGTGCAGCTATGGCTGTATGCCTATATAACTGCAT
TGTTCAGCAGATCGGAATGTACAGTGCAGTTATGGTTGTATGCCTATATAACTGCATTGT
TCAGCAGATTGGAATGTACAGTGCAGCTATGGCTGTATGCCTATATAACTGCATTGTTCA
GCAGATCTGGAATATACAATGCAGCTATGGCTGTATGCCTATATAACTGCATTGTTCAGC
AGATTGAAATGTACAGTGCAGCTATGGCTGTATACCTATATAACTGCATTGTTCAGCAGA
TTGAATATACAATGCAGCTATGGCTGTATACCTATATAACTGCATTGTTCAGCAGATTGG
AATATACAATGCAGCTATGGCTGTATGCCTATATAACTGCATTGTTCAGCAGATTGGAAT
GTACAGTGCAGCTATGGCTGTATGCCTATATAACTGCATTGTTCAGCAGATTGGAATGTA
CAGTGCAGCTATGGCTGTATGCTTATATAACTGCATTGTTCAGCAGATTGAAATGTACAG
TGCAGCTGCGGCTGTATGCCTATATAACTGCATTGTTCAGCAGATTGGAATGTACAGTGC
AGTTACGGTTGTATGCCTATATAACTGTATTGTTCAGCAGATTGGAATGTACAGTGCAGC
TATGGCTGTATGCCTTTATAACTGCATTGTTCAGCAGATTGGAATATACAGTGCAGCTAT
GGCTGTATGCCTATATAACTGCATTGTTCAGCAGATTGGAATGTACAGTGCAGCTATGGC
TGTATGCCTATATAACTGCATTGTTCAGCAGATTGGAATGTACAGTGCAGCTATGGCTGT
ATACCTATATAACTGCATTGTTCAGCAGATTGGAATATACAATGCAGCTATGGCTGTATG
CCTATATAACTGCATTGTTCAGCAGATTGGAATGTACAGTGCAGCTATGGCTGTATGCCT
ATATAACTGCATTGTTCAGCAGATTGGAATGTACCAGTGCAGCTATGGCTGTATGCCTAT
ATAACTGCATTGTTCAGCAGATTGGAATGTACAGTGCAGCTATGGCTGTATGCCTATATA
ACTGCATTGTTCAGCAGATTGGAATGTACAGTGCAGCTATGGCTGTATGCCTATATAACT
GCATTGTTCAGCAGATCGGAATGTACAGTGCAGCTATGGCCGTATGCCTATATAACTGCA
CTGTTCAGCAGATCGGAATGTACAGTGCTGCTATGGCTGTATGCCTATATAACTGCATTG
TTCAGCAGATTGGAATGTACAGTGCAGCTATGGCTGTATGGCTATATAACTGCATTGTTC
AGCAGATTGGAATGTACAGTGCAGCTATGGCTGTATGCCTATATAACTGCACTGTTCAGC
AGATTGGAATGTACAGTGCAGCTATGGCTGTATGCCTATATAACTGCATTGTTCAGCAGA
TCGGAATGTACAGTGCAGCTATGGCTGTATGCCGATATAACTGCATTGTTCAGCAGATCG
GAATGTACAGTGCAGCTGTGGCTGTATACCTATATAACTGCATTGTTCAGCAGATCGGAA
TATACAATGCAGCTATGGCTGTATGCCTATATAACTGCATTGTTCAGCAGATTGGAATGT
ACAGTGCAGCTATGGCTGTATGCCTATATAACTGCATTGTTCAGCAGATCGGAATGTACA
GTGCAGTTATGGTTGTATGCTTATATAACTGCATTGTTCAGCAGATTGAAATGTACAGTG
CAGCTGCGGCTGTATGCCTATGTAACTGCATTGTTCAGCAGATTGGAATGTACAGTGCAG
TTACGGTTGTATGCCTCTATAACTGTATTGTTCAGCAGATTGGAATGTACAGTGCAGCTA
TGGCTGTATGACTTTATAACTGCATTGTTCAGCAGATCGGAATATACAGTGCAGCTATGG
CTGTATACCTATATAACTGCATTGTTCAGCAGATTGGAATGTACAGTGCAGCTATGGCTG
TATGCCTTTATAACTGCATTGTTCAGCAGATTGGAATATACAGTGCGGCTATGGCTGTAT
GCCTATATAACTGCATTGTCAGCAGATTGGAATATACAGTGCAGCTATGACTGTATGCCT
ATATAACTGCATTGTTCAGCAGATTGGAATATACAGTGCAGCTATGGCTGTATGCCTATA
TAACTGCATTGTCAGCAGATTGGAATGTACAGTGCAGCTATGACTGTATGCCTTTATAAC
TGCATTGTTCAGCAGATTGGAATATACAGTGCAGCTATGGCTGTAGGCCTATATAACTGC
ATTGTCAGCAGATTGGAATGTACAGTGCAGCTATGGCTGTATGCCGATATAACTGCATTG
TCAGCAGATTGGAATGTACAGTGCAGCTGCTACTGTATGCCTATATAACTGCACTGTTCA
GCAGATTGGAATGTACAGTGCAGCTATGGCTGTATGCCTATATAACTGCACTGTTCAGCA
GATTGGAATGTACAGTGCTGCTATGGCTGTATGCCTATATAACTGCATTGTTCAGCAGAT
CGGAATGTACAGTGCAGCTGCGGCTATATGCCGATATAACTGCATTGTTCAGCAGATCGG
AATGTACAGTGCAGCTGCGGCTGTATGCCTATATAACTGCATTGTCAGCAGATTGGAATG
TACAGTGCAGCTATGGCTGTATGCCTATATAACTGCATTGTCAGCAGATTGGAATGTACA
GTGCAGCTATGGCTGTATGCCTATATAACTGCATTGTCAGCAGATTGGAATGTACAGTGC
AGCTATGGCTGTATCCCTATATAACTGCATTGTCAGCAGATTGGAATGTACAGTGCAGCT
ATGGCTGTATGCCTATATAACTGCATTGTTCAGCAGATCGGAATGTACAGTGCAGCTATG
GCTGTATGCCTATATAACTGCATTATTCAGCAGATTGGAATGTACAGTGCAGCTATGGCT
GTCTGGCTATATAACTGCATTGTTCAGCAGATTGGAATGTACAGTGCAGCTATGGCCGTA
TGGCTATATAACTGCATTGTTCAGCAGATTGGAATGTACAGTGCAGCTATGGCTGTATGC
CTATATAACTGCACTGTTCAGCAGATCGGAATGTACAGTGCAGCTATGGCTGTATGCCTA
TATAACTGCATTGTTCAGCAGATCGGAATGTACAGTGCAGTTATGGTTGTATGCCTATAT
AACTGCATTGTTTAGGAGATTGGAATGTACAGTGNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1339, 1910..2061, 2234..2936, 4012..4356
1001..1339, 1910..2061, 2234..2936, 4012..4356
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved