Xenopus_tropicalis Locus INTS5
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis INTS5
Xenopus_tropicalis
INTS5
scaffold_1179
SNORD30
11946..12016
17403
CAGAATATCAAAGGCTATTGTGATACTAATATCTACAGTTAGTACTAGTGGTTGTATTT
ATAGTTTATGTATGTGAGTGTATAGATTGGTAGGTGTGGGTTAGGTGTGCTGGGTTTACT
TGGATGGGTTGAACTTGATGGACACTGGTCTTTTTTCAACCCTATGTAACTATGTAACTA
TAACTATGAAGATTCCAAACATCTCACACGTCTGCATTATCTGTTATATTTCTGTTTTGG
TGTCACTGTGGTATATTTAATTTTTTCTTTATTAACAGGTATGCTTTGTGATCATACAAA
ATGCTGGGGTGCTGACTTGGTGATCTGTTTTATTTCTTGTGCACCCCTTCATTACCTTTT
GATAAACTGTGTTAAATGCATGTGGCCTCCAGACGTGATTCTTATTGTTCGTCTCTGTTT
CTTCCCAGGTGATGTTTGCTTGATGTAGACAACATTCAACATTACAACCGGCCTCATGCT
TTCTTCGCAGCCTCAACCACTTCCTCAACTGAGGTACTAGACAGTTATACTTCCATACTA
TGCTCCACTTTTTTATTTAACCTTACCACAGGTAGGGGGTGATTGCGCTCTATTCCCCAT
GTACCACTTTCTAATTGATATCAAATTATAATAGTGAATAAAGATAAATAAAACCACAGT
TGCATTAAGAGTGAAGACACACAGAGCTACTAGTAGCAGCTACTTTTTCATGGATACTAA
ATGCTGGGAAATCCCCTGCCATAGACAATAGTGATAATTGCCTCTACTAAAACACACAGT
CAATTTTCAGTAAATGATCAGCATTGTCTAGTTAAGTAGCTGCTACTAGTAGCTCCGTGT
GTCTTCACCCTTAAGCTTTCACAGAGCTAAGAGACAAGGTGATGGAGGTCCCTGTCCCAT
AGAGCTTATAATCTAAATGGGAGTTTCCCCCTCCCATTTCTTTCATTTGTCTATTTTGCC
TTATTTTTTTCTCTATCTCTCTTTCCCTTTACAGTCCCTTGGAGCTCTCTCTGCAAATCA
AATCGTTCTTGAGTGGTACAGATCCACAGCATGGTCATAAATTGAGTCCACGTGACCATG
CCCGCTGCTCCCTTCTGCTTCTACAGTGTCTGCCTCCTGCCCGACATGCAGTGCTTGAAC
ACTTGCGTACTGTGTTTCATGACAGTGTTTCCTCTTTTTTGAGTGAGCGTGACTCTCAGG
ATGCACTCCCACCATCATCTTCATCTCAGCGCAGGCCACCTCCACCTCCATCTACACAAG
GACTGGATGAAGTTACACTTGAAGTTCAGAGGGTTCTGGAAGAGTTCATCAAACTTAACC
CTCGGGCATGGGCTCCTCTTATATCTGCTTGGTCTATAGAGCTCATGGGACAGCTTAGCA
GTAAACATGCAGGTAGACAGGGGATGCCACACTCTGCAAGCCTCAATGAATTGCTGCAGT
TATGGATGTCCTGTGGTGCCACTCGTGTGCTTATGGATATCTACACCCACTGCCTGTCCA
CCATGATTGGTAGCTGTCCAGATGCTTGTGTTGATGCCCTGCTGGACACTTCTGTTCAGC
ATTCACCTCACTTTGACTGGGTTGTTGCTCATATTGGAAATTCATTCCCTAGTACAATAA
TTAGCCGTGTTCTTTCATGTGGCCTGAAGGATTTCTGTGCACACAGCTCCCCAACTGATA
CCGCTGACAAGCGTGTGCCAAAGTTGGGCTCTGTTGTTGGAATCCTGGGGCACCTTAGTT
CCCGCCATGGGCAAAGCATCAGACAGGAAATTCTGAGAATGTTCCATGAAAGTTTAAGAC
CTGGAAGTAAGCAGCAGCGGGCGACCTTGCCATACCTTCTTCAGTTGGCAGCCCTTTCCC
CATCCCTGTTGGGTACTGTATGCCAGGATCTGGTTGATTCTCTAAAGCCTGCTACATTAT
CCCAGCTACAGCAGCACTGCACCACTTTGCCTCGTGAAGAGCTGGACAACATGTTGAACC
TGAGTGTGCACCTTGCTTGTCAGACATCTGCAGGTGCCCCTCGTCTTTTGCGATTTCTTC
TGGACACTGCTATGCCTGCTTCTGTTATAACTACACCAGGCTTGGCAGTGCATGATTCTG
TGAGAGAGGCCTGTGATCGCATTGTGCGTTTACTACTTCTTAGCTTACAGAAACAAGTGT
ATGGGAGGCCTGGGTCAAGGGGAACTTCTGAAGTACAGCCACGAGCTGTACCATTTCTAG
AAGCCATGAGAGGACATCTTCCTGAGCTCTGTGCTGAGATGTTACGTTTAGAAAGAAAAC
GGCACCTCTGGATTCACCAACTGATTGGGCTACTTTGTATATACAGCAGCCCACCGTGTT
CCTCTGAAGCTCTCTGCATATTGCTCACTTTAGCTCAGAGCTCTGAAGAGCTTGGACTTG
CAGTGCAACTGCATGCAGTTTTGTCTTCCTCTGTACAAGGATTGGCACAAGCAGCAGTTA
CTCGAAGTGTGGCTCAGATACATGCAGGAGCCTTGACTGATAAATGTGCACTTCAGCTAC
TTCAGAACTTGGCACTAGTTGTACAGTGTGAAGAGGGAAGCATGGGTAGGGAGGTAGGAA
TGGCACTCTCAGAGTACCTCTCTGATTTTGGGCAGTTGCTGCTTCACAGTGAACCTGGAG
TTTGTGAAGCAGCCTGTATCTTGCTATGCTCTTGTCCCTTACCAACCTCTATACCTCCTT
CTCAACTCCATATTCTGATTCGTTCTTCTTCCCATTTTCTCTTCCGCTCCATGCATATTC
GCAGTTCCTCAGGGGTCAGCAGTGCTTCTCGTCTCCTTCTGCGGCTCTGCAGAGTATCAT
CTGCTGGAAGGAAAGCTGTATTGAACCAGCTAGTGGAAGGTGCTTTACATGAGGGAAATG
CAGGTTTGTTTGGAGGAAACAGGCCTTCATCCACTGGACCTAGACTGGGTAATGATACTG
CCTCTTTGTTAGAAAGCAACAGTCATCTAGGGTCAGCTGTGGACTTTTCAGGTAGTGTGT
GGTCTGTATTTCATGCAGGTGTAATTGGGGCAGGGCTCAAGCCAGAAGAGAATAGTAAAC
AGCTTGGGGAAGAGGAATGTACTGAAAATACGCAAAGCTTGCTCTCTCTTCTCTGCCATT
GCTGTGCCAGGAAAGGAGAGGATGGGGGACAATCAACTACGTTAGACCCTGAGGCAGCCA
AAACACTGGCAGTAACACTGACTGAAAATGCTTGTCCTGATGTCACAAATAGTGAACTTG
CTTGGCCTCCAGAAGATCATGCACGCACCACAGTGCAGAGAGACCTACTCATCTACAAAT
GCTTTTGTCAAAACCCTCTACTGTTTCAGCTTCTCCACTTGATTGCACAAGGTCGGCCTG
CACTTTGCTATTGCTCAGTGCTGCTTAGAGGACTTTTGGCTGTACTCCTGGCATATTGGG
AGGCATCTCGTCATCAGGATTCTGTGAGCTCTTCTTGGCACTTAAAGGCATCCTGTGAGT
TGGTGTCCTGTATGGGAGAAGGACAGCTGCTACCCCCTGCACTTACAAACATGCATGAGA
TGTTTTCTCTCCTTGCTCCGTTTGAGGTCCGTCTTTTACTCCTCAGTGTTTGGGACTTCA
TACAAGAAAACGGCCCATTTCCACAAAGATTTGTCTTTCAGTCAGGAAGAGGGATATTTA
CTAGAGACTTTTCCAGAGAAGGTGATCCAGCAAAGTACATGAGCATTGTTCATAGCGTCT
TACATCGTAATGTTGATCGATTGGGGCTGCTTTCGGGGAGATTCCAGCTGTAGGTTATTT
ATACAGACATTTTTACATATGTCTTAGCATGCTTGATTGGTTTATGCCTTAAATACATAA
TATGCCAAAACATGTCTAAAAAAACATAGTTGTATAATAAAAAATGCTCCTTTGTGTAAA
AAATATTTCTTATTCTTAAATAAATGTTATAACATTTTCATGTGACATTAAAATATAATG
CCTGCTGCCCTTTACAGTGGAGGAAATAATTATTTGACCCCTGACTGATTTTGTAAGTTT
GTCCAATGACAAAGAAATGAAAAGTCTCAGAACAGTATCATTTCAATGGTAGGTTTATNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACCCCCAAAGC
AAAATGTTTCCACCCCCATGCTTGACGGTGGGGACGGTGTTTTGGGGGTCATAGGCAGCA
TTTTTCTTCCTCCAAACACAGCGAGTTGAGTTAATGCCAAAGAGCTCTATTTTGGTCTCA
TCAGACCACAGCACCTTCTCCCAGTCACTCACAGAATCATTCAGGTGTTCATTGGCAAAC
TTCAGACGGGCCTGCACATGTGCCTTCTTGAGCAGGGGGACCTTGCGAGCCCTGCAGGAT
TTTAATCCATTGCGGTGTAATGTGTTTCCAATGGTTTTCTTGGTGACTCTGGTCCCTGCT
AATTTGAGGTCATTAACTAACTCCTCCCGTGTAGTTCTAGGATGCTTTTTCACCTTTCTC
AGAATCATTGACACCCCACGAGGTGAGATCTTGCGTGGAGCCCCAGAGCGAGGTCGATTG
ATGGTCATTTTGTGCTCCTTCCATTTTCGAACAATCGCACCAACAGTTGTCACCTTCTCT
CCCAGCTTCTTGCTAATGGTTTTGTAGCCCATTCCAGCCTTGTGCAGGTCTACAATTTTG
TCTCTGACATCCTTGGACAGCTCTTTGGTCTTTCCCATGTTGGAGAGTTTGGAGTCTGCT
TGATTGATTGATTCTGTGGACCTGTCTTTTATACAGGTGACTAGTTAAGACAGGTGTCCT
TAATGAGGTTGACTAATTGAGTAGAAGTGTCTAACCACTCTGTGGGAGCCAGAACTCTTA
ATGGTTGGTAGGGGTTCAAAAACTTATTTCACTCAATGAAATGCAAATCAGTTGCTATCT
TTTATTTAAAGTTATTTTTTCGATTTTCCTTTTGATGTGCTATCTGCCACTGTTAAAATA
AACCTACCATTGAAATGATACTGTTCTGAGACTTTTCATTTCTTTGTCATTGGACAAACT
TACAAAATCAGTGAGGGGTCAAATAATTATTTCCTCCACTGTATGTGTACAGGGCTTCTG
TGTAGGAGGGGTTGTATGATTAAGCGGTATAGCATAGCTAATAGCCTTCAAGAAAAGCAC
AAAAAAAGGTATTGAGTTTGACAGGATGCTCATGCTCACTTTAAAGCCACAGAAAATTGA
AGCAAAGGGACAAAACCTATGAGAAATTGTAATAGGGATCATCCTAATGTCTGAGAGAAA
TGTTGCAACATTAAATAGCACAGTTATGCAAAATTTATTTAGTATTGATGTACCATCACA
TTATTATCTATTTAAAAATTGGCTGGCCAGCCTACCATCATTCACAACCACATATAATCA
CATTAATATCTTACTTTACACCATAAGTGTACTATATAGCAGGAGGTAAAAAAAAAAAAA
AAAATAAAGTCCCAACAAAATTTAAAAATAAAATGAAATAAGTCAATTTTCAATTCAAAA
CACAAAAACAACCAAAAATCACTTGTATTGATTGTTGCTCCTGAAGGATAGAGGTGTTAT
ATGATTTATGCAGGTTCTTAATTTGCAGAGTTAACTTCTGTTATAATTCAGGTGAGGTTT
GTGCATACCAATGTTACTAATGTTCAGTTTTCCTTGTTCGTGCTGCTGCATATCGCGCCA
AATTACCATTGAGCGGCCAATATATTTGCACATATAATTGATGTTATTTAGGTGAACGTT
CCTACCACCACCAATTCAAACTACTTCCAGCAACTGATACAGGGCGTCCCCCAGTTGTTA
TATCCATGTAGCGTAGAGTTTGTAATAAGATGAAAAATAGAACAATCTCATCCAGCTCAA
GCACGTTCTTTATGGCGTTTGTTTTTTAACCTCTACACTTTCTCTCGCACCGATGACTGT
CTCACTCCGCTCACTTTCTCCCACCAGTACCGATGTTACTTGCTCAAGGAGGAGAGGTGT
CGCAGGTGGAAGTAAGTAACATTGGTACTGGTGGGAGAAAGCGAGCGGAGTGAGACGGTC
ATCGGTTCGAGAGACCTGCTATATAGTACACTTATGGTGTAAAGTAACATATTAATGTGA
TTATATGTGGTTGTGAATGATGGTAGGCTGGCCAGCCTATTTTTAAATTGATTTTAATGT
AATGGTAAATCAATACTAAATATATCTTGCATAATTTTAATTGCTCCTTTCTATAGAAAG
TGGTGGAGGTGGAAGGGGTCCCCACCTTTTATTATTGGTATTGTGCAACATTCTGTTGAA
AGATTAATTTCTGGAATAAATTAAGTGTACCTGTAAGCTATTTAGAATATAAAGATTTTA
GTTCATATGCAGGAATCTAAACCCATTGAATTGTACCTGCTACATAACCTGAGCCGTTTC
CTCATTTTCAGAATGTATGGCTGCCCCTGTGGCTACACAACAAGCTTCTTTGTATTGACT
ATAGTAGTCTTTCCGAAGCAAACATAACTATTTTACCAGAGCAGGGCAACAGTATAATAT
ATTTGATTTACTTTCATACACTTTCATTATTTGGTGTTAGTGTTCCTTGAAAACCATTGT
TTAGGTGCATACCCCCTTTAATAAGCAATTAATAAAGTTTTTCAGGAAAAAACAAAACAG
GATGTAGCACTGAAAATGACATTCCTTTTCTTCCCCTAAAGAAGTGCAAATATTTGTTTT
CTTTATCCAGTGATGAAAAACGTAATGGAGTAAAAAAATTCCCCGAAAGGGTCATGGATG
TCAAAGAGATTTAAACCAATATTTATTCTGAATAAACAAGATTGTCTAAAACACAGATAT
TTAACTATAGGTCAGTGTCCAAAGGCTTCATAGATTTCACTGTATGACAATATTTCCATA
ATGCCACACTCTTGCACCAAGACCCCTGTACATGTACAGTTTGTAAGACATCGAGGACGC
TTCCTGCTGAATGGCTCAGATCATTCCTGGGGGGGGTATATAGCATTCTTGTAGGATGGG
GTAGCAGGAGAGAGGAGAGAGCTGCGCGTCTCTGGCACAGAAAAAAAGAGACAAGAAATC
CTGTTTCTTTTGATAGAGGGCTCAGTGCAGCGTTTTTGTGAGTGCTTATGGCTGTATTTA
CATAGACCTTTCTGATAAAGCTTACTTAGTTTTTACCTATCCTTCTCCTTTAAGCAAGCT
GTATGAGAAATACTTGGCCTAATATGTGTAATAAACTGAACAACAATAACATTTGAGGAT
GCAATAGGGTTGGGTCAGGGCTGCTGGGGCTCCCCGGGTATTTTCCTGGTGTCCCAGCGC
CCCAGTTCCGACCCTGTGAATTTGTAAGCAAAAAAAGCACCCACACTAGGTAACATCTTA
GCCCCAAGTGAGTTTAAACGTGATAAATCAAATCATAAACAGAAGGGATATATCAGTGCA
GTTCCTCACGCTGTATAACTTGCTCACAGGTGCATGAGTCAAAACACTTCACTACAACAA
GTACAAAGTCAGTATAACATACATACTTACACTACAGGTATTGTGTGACAATTTATGTAT
TTATTAACTTGTATGAGTTGTAACATTCAGTATGTTGGGTGCACAGCTCAGATTACAGCT
AAAAGTGATGCAACAATGGTAGCTCAACACTTCTCGTCCTGTAATGGGGGAAATATGTCA
ATTCTACGGATTCAGGGTATAGATAATGTAACTATGTAAGGTAGAGGTGGAAATAAATTA
AAGAAACTTTTGAAGTTGGAAGCAAAATGGATATTTGTATTAAATACTCATGAACCACAG
GGTCTAAACACTAGATGGGATTTAAATTGTCATGTGTAAATAATCAATGTTGGTTTATTT
ATTTATTTTTTTCTCTTTTTTTTTCGCAGTTAGTTGATTGTGAACATATATAGATATCAA
TGGATACTTGTACTGCTTTATATCATGTTTTTAACTTTATGATGTCGTCTCTGAATGCCT
CTTAAACCCACAGCTGTTTGCTGTTAACTCTGTAACAACATTAGAATTAATACTTAAATA
ATGGCATCAATTTAAATATAAACCAATGAAATTCAATGGGTGGAAATGGATTGGATATTG
ATTGATTTTCCTAACCATTAACCTTTGTCCCCCAGTGACCCACTGTGAAAAATTTGTGGA
CACTGGCATTATATGTTTGATAATGGCAGCAGATAAAATTTCCACACTAAAATCAATTAA
AGAAATGTGTTTGGCTGTTAGTGGCTATGCCCATTTTTCCCTAACCCTGAATATGTAGTC
AGCCAGTGACTGTGTAAAGTTTGGAAACCCTGACAAAAATAGTGTGAGAAAGGCAGCATT
TTAAATTTAAACCAAAAAAAAAAATTAAATAGGTGAAGTCTGATTGGCTGTTGGTGGCTC
CACCTGCTTTTTTCAAAACCTAAAGATGTAGTCCTTGAGTGACCCTGGTGTTAACACTGT
GAGAATGGAAGCCCTTTTATTACACTACATTTTAAACAATACATGCCAAAAATAGTTTTG
ATATATTATTCTCAATTAATGATCCTGAGAAATTATAACACCATACTAATGAGTCACTTA
GATTCCTGAGACCGGATTGTGTTGTAGATAGAATTACATGTGTCATAGTAAGATGGGTTG
AAAAAAGACATACGTCCATCACGTTCAACCATAATGCCTATATATAACCTGCCTAACTTC
TAGTTGATCCAGAGGAAGGCAAAAAAAACCATCTGAAGCCTCTCTAATTTGCCGCAGAGG
GAAAAAATTCCTTCCTGACTCCAAGATGGCAATTAGACCAGTCCCTTGATCAACTTTTAC
TAAGAGCTATCTCCCATAACCCTGTATTCCCTCACTTGCTAAGAATCCATCCAGCCCCTT
CTTAAAGTTATATAATGTATCAGCCAGCACGACTGATTCGGGGAGGGAATTTCACAACTC
TCACAGTAAAAAATCCTTTCCGTATATTTAAATGGAACCTCCCTTCTTCTAAACGGAGTG
GGTGCCTTTGTGTCCGTTGGAAGGACCTACTGGTAAATAAAACATTAGAAAGGTTATTAT
ATGATGCCCTTATATATTTATACATAGTTATCATGTCACCTCTTAAGCGCCTCTTCTCCA
GTGTAAACAGACCCAACTTTACCAGACTTTCTTCATAACTGAGACTTTCCATACCCTTTA
CCAGCTTAGTTGCCCTTCTCTGGACCCTCTCTAACTCAATAATGTCCCGTTTGAGCACTG
GAGACCAAAATTGAACTGCATATTCTAGATGGGGCCTTACCAGCGCTCTGTAAAGGGGAA
GAATAACCCCCTCCTCCCGTGAATCTATACCCCTTTTAATACAGCTCAAAACCTTGTTTG
CCCTTGCAGCTGCTGCCTGGCATTGCTTGCTACAGCCAAGTTTATTATCTACAAGGACTC
CGAGGTCCTTTTCTGTTATGGATTTGCCTAGTGCAGTCCCATTAAGGGTATAAGTGGCTG
CATATTTTTACATCCCAGGTGCATGACCTTACATTTATCCACATTAAATCTCATCTGCCA
CTTAGCCGCCCAGATTGCCAGTTGGTCAAGATCCTGCTGCATGAGGAATATATCCAATAT
TTATTTGTATAATTTTATTTTCAATTCTCAATTTCAATATCTCTAGCATACAGGTTTTCA
CATTTTATGTCCCATTGTATTAAATACGCTATATTCATGTTTGCACATATTATTCTTTCA
TTTTGATTTGATTTTTGTTATTTTAAGTGTACTCTTGATTTTTTATTTCTCCTGCTGTCC
CTGGTTCCTGGTCTGTTGTTCATTTCCCTTTTTTTCACGTATTCTTGATTTTCTGTGTAT
CACTTTGCGTGGTGTCGTCACTACCCGTGGTATATATGGTCATATGAATAAGTTTGGGAA
CCTCTCTCAGCCTGCATGATTTATTCAACAAAAAAGATAACAGTGGTATGTCTTTAATTT
CCCAGGAACATCTGAGTACTGGGGTGTTTTCCGAACAAAAGTTTTTAGTGAAGCAGTATT
TAGTTGTATGAAATTAAACTTAAATGGGAAAAACTGGCTGTGTAAAAATTTGAGTACCCT
TGTAATTTTGCTAATTTGAATGCATGTAACTGTTCAATACTGATTACTGGCAACATCAAA
TTGGTTGGATTAGCTCATTAAGCCTTGAACTTCATAGCCAGGTGTGCCCAATCAAGGAGA
AGGAAAGGCAAAGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNATCAGTCACAGAGTTGAAGTTAAGCAGGGGTTGGATATTTCAACAAGACAATGGC
CCTAAACACACTTCTAAATTAACAAAGGCATCTATGCAGAGGGAGAAGTACAATATTCTG
GAATGGCCATCACAATCCCCCAATTTGAATATCATCGAAAATCTATGGGATGATTTGAAG
CAAACTGCCCATGATCGCCATTTAACTGAACTCGAGAGATTTTGTATGGACGAATGGTCA
AAAATACAGCCATCCAGAATCCAGACACTCATCAAAGCTATAGGAGGCATCTAGAGTCAA
AAACATTTGCAAAAGGAGGCTCAACTAAGTACTGATGTAATATCTCTGTTGGGGTGCCCA
AATGTATTCACCTGTCTAATTTTGATATGATACATATTGCATATTTTCTGTTAATCCAAT
AAACTTTATGTCACTGCTGAAATACTACAGTTTCCATAAGGCATGTTATATATAAAAAGG
AAGTTGCTACTTTGAAAGCTCAGCCAATGAGAAACAAAACTCCAAAGAGTAAAGAGAGGC
GCCCAAACTGAATGGTATCTTCTGATTGCCTGCCGCCTGTAGTTTTCTACAACCTTAAAT
CCTGAATTACATGGCAATTCTAAAGTGAAATCTTTTTTAGGTCTACTAAAGAGGTGACGA
ACTACAGGCTTTTTGCCGCCCCTGGTAACTAGGGGGTGCTGCCGTCTAAGGCGAGTTTCT
CAACTTGCCACATAGTAGCAGCGCCCCTGATAACGCCAACTCTGGATCAGCTGAAATTTC
AGTTTGGAGCAATTGTGTAACCAATTGAAAAGTTTGGGTCCAAAAGTTATGTACTATGGG
ACAATAGTATCTGACAGCCCCAAAAGCAAGTTGATGGATAATAGAGTGTAAATTTATTTT
TTAGGACTGGTGTAACATACCATTTGGAGAGAAGCTTACATGCTGTTTCTTTGATGCTTA
TGCAGGGAGAAATTCTTTTCACATATTGCCAATTTTTTTTTAATTTCTAGTATGAGAAAG
AGGTATGCATAAGTATTTCCTAAGCTCATATAATTGCAAGGGATATCTGGTGTTACTGAT
ATTAATTGGGAATATGTCGGAGAGATAGATCCTGAAAGGTGCATGGGAGACTTGCAGCCA
GATTTAAACACCAATGTTTCTAGTGTAGGACGTTTTGGGCTTTGTGAGAGATAAAAATGT
AGGATTTGTGTATAGTAATAGTGTTCTGAGGAGGGGGTTTTATCATTTGCCTTTAGGGTT
TCTAATGATTTCAGGCCTCAAGGTGTAATGAGCTTTAGTGGTTTGTGAAAATTATTTTGT
GTCCACCAAGAGAAAGTGTTAAGGGAAAGCCCTGGGGGAAAATCAGGGTTCCCACAAGTG
ACTTGTGTAAATTGAATTGTAACTGCTCCCTGCCTGGGCATTTCAGTAGCTGGCTGCTAG
GGTCCAACTTATACACTAGGAAGCAATTTAATTGACACTGGAGTATTAGTAGGCCTATAT
ACAAAGATGCATACAAATGTACCTTTAATTCCAAGTTTTAAAAGGCAATTGCTATACAAA
CTAAAATAAAGACCAATTTAAAAAATTGCTAAGAGGAAATTCTATTATAGGGTAAATTTA
ACATCAACTACCTCTTTAAACAGCATGACACATGAAGCATAGATGCATTGTTTATGCCTT
ATGCACTGACATGATGAAGTCAATCTTATGGAATCTCGTTTGTCTGAATAAGTCTGATGA
GACATTATCTGACAGTGTTCTGTGTTGGAGAAAAATTGCATGTTGCACAGTCTTCTGAAA
CTGTATAATATGCCTGTATGATATGGAGGAGCTACTGATGATGCCAAACAACTGTGCCAC
AGTATTGATTTCTGAAAAAACAGATCATTGAAGGTAATACTATTAAGTGTGTGTCTATAT
AGCTTCTCTTAATATGCAGTGCCTAACGTTGAATCAGGCACGACTGACTGTACCCAGTGC
CTGGGACCATATGATATGATGTGGGGGGGCAGCATTGACAGTTCATGTGGTCTCCAGTGA
TGAATCATCCACTTTACCCTGAGCTGACGCATGTTGGGTATGACAAGGATCATCGCTATA
CTAAAGAGACCCCCCTTAACTTAGCAGAATACTAGGTAGTTGGGGCTTACAGGTATTTTT
CTTCTCCTCAGCTTGTGTTCAGAAGCTGCACAAATCGGGTGAGTATAGACTGCAATGACA
AACATTTAATTTGCCTCCTCATCCTGTAAAGTTCGAACATTTAAACTTGTCAAAGCAAAT
TACTGGTCAAAGATTTACAATATTGTGACTTGATTTAAATACTAGAATAAGTAACCTATC
ATTGTATAAGTAGCACTTATATAGAATAAGTGCTCTATAAATAGATTTGATCTTATACTG
CCCAAGTCTGAAGTCAGTGACTGAGTGGTACAATCTGAGCTGCATTGTAGCACCTGTGCT
TCCACTTAGGCTGGGGGTCCCCAACCTTTTTTTACCCATTCTAATGTAAAAATTTGTCGA
GCATCCCAAGCATGAAAACAGTTCCTGGGGGTTCCATAATAAGAGCTGTAATCAGATATT
TGGTAGCCCCTATGTGGAGTGGCGGCCTACAGAAGGCTTTGTTTGGCAGTAAATCTAGTT
GTTATACAACCAAACCTTGCCTCCAATACAGGTATTTACAGTGGTGTGAAAAACTATTTG
CCCCCTTCCTGATTTCTTATTCTTTTGCATGTTTGTCACACAAAATGTTTCTGATCATCA
AACACATTTAACTATTAGTCAAAGATAACACAAGTAAACACAAAATGCAGTTTTTAAATG
AGGGTTTTTATTATTTAGGGAGAAAAAAAATCCAAACCTACATGGCCCTGTGTGAAAATG
TAATTGCCCCCTGAACCTAATAACTGGTTGGGCCACCCTTAGCAGCAATAACTGCAATGA
AGCGTTTGCGATAACTTGCAACGAGTCTTTTACAGCGTTCTGGAGGAATTTTGGCCCACT
CATCTTTGCAGAATTGTTGTAATTCAGCTTAATTTGAGGGTTTTCTAGCATGAACTGCCT
TTTTAAGGTCATGCCACAACATTTCAATAGGATTCAGGTCAGGACTTTGACTAGGCCACT
CGAAAGTCTTCATTTCGTTTTTCTTCAGCCATTCAGAAGTGGATTTGTGGTGTGTTTTGG
GTCATTGTCCTGCTGCAGCACCCAAGATCGCTTCAGCTTGAGTTGACGAACAGATGGCCG
GACATTCTCCTTCAGGATTTTTTGGTAGACAGTAGAATTCATGGTTCCATCTATCACAGC
AAGCCTTCCAGGTCCTGAAGCAGCAAAACAACCCCAGACCATCACACTACCACCACCATA
TTTTACTGTTGGTATGATGTTCTTTTTCTGAAATGCTGTGCTATTTTTACGCCAGATGTA
ACGGGACGCGCACCTTCCAAAAAGTTCAACTTTTGTCTCGTCGGTCCACAAGGTATTTTC
CAAAAAGTCTTGGCAATCATTGAGATGTTTTTTAGCAAAATTGAGACGAGCCATAATGTT
CTTTTTGTTTAAAAGTGGTTTGCGCCTTGGAAATCTGCCATGCAGGCCATTTTTGCCCAG
TCTCTCTTTCTTATAGTGGAGTCGTGAACACTGACCTTAATTGAGGCAAGTGAGGCCTGC
AGTTCTTTAGATGTTGTCCTGGGGTCTTTTGTGGCCTCTCGGATGAGTTGTCTCTGCGCT
CTTGGGGTAATTTTGGTCGGCCGGCCAATCCTGGGAAGGTTCACCACTGTTCCATGTTTT
TGCCATTTGTGGATAATGGCTCTCACTGTGGTTCGCTGGAGTCCCAAAGCTTTAGAAATG
GCTTTATAACTTTTACCAGACTGATAGATCTCAATTACTTTTGTTCTCATTTGTTCCTGA
ATTTCTTTGGATCTTGGCATGATGTCTAGCTTTTGAGGTGCTTTTGGTCTACTTCTCTGT
GTCAGGTAGCTCCTATTTAAGTGATTTCTTGATTGAAACAGGTGTGGCAGTAATCAGGCC
TGGGGGTGACTACAGAAATTGAACTCAGGTGTGATAAACCACAGTTAAGTTATTTTTTAA
CAAGGGGGGCAATCACTTTTTCACACAGGGCCATGTAGATTTGGAGTTTTTTTTCTCCCT
TAATAACGTAAACCTTCATTTAAAAACTGCATTTTGTGTTCAATTATGTTATCTTTGACT
AATAGTTAACGGTTTTTGATGAGCAGAAACATTTAAGTGTGACAAACATGCAAAAGAATA
AGAAATCAGGAAGGGGGCAAATAGTTTTTCACACCACTGTAATAATAAGCACCTGCTTTG
AGGCCACTGGTAACAACATCCAGTGGTTGGTGAGCACCATGTTGCCTGCAAGCCCCTGGT
TGGGGATCACTGGCTTAGGCATTAACATGGCTGTTTCCATAAAGTTTTATTCGCTTGCTT
AATCCAGTTTTACTGTAACGTAAAGTGTCATAACCTTAATTCTTTTTCAGCTTCTACATG
TGGCAAATCTGCTAACTTGCTGTTCACTGAGGTTCTGGTGCCAAGCACGAAAACATTGGG
TTCCCTCCGCTGATAACATGAGATCTAGCCTACTATGTATTCAAATGTATACAATGCAAC
AGTAACAAATTACAACAGCTAAATATAATGTTGTTGCCTCCTAAAGGCAAAATGATGTAC
AAACAACAGAAATAGATGTGTGTACTCCATGACAGGAATATGCAATTCCATTTATGGCTC
TTAGAGCCTCAGTTGAGTAGTAGTTCCATATGATACAGACACCAAGGCAGCGCACTGTTG
GAAGTATATTTTTCACCTGACCTGTACATAAGGTACAGGTTATGTATACACCCTTAATTA
AGACCTAGGTTTGTCACTTACAAATGTAGTAATGTGTATACCCATACAGTTCTGCAGAAT
CTCAACACTTTATAAATTTTAAAAATGAAGTGCTACCCTATTTAAATGTGTTTTAATGTT
GCTAAATCATATATGCATGACCCTGCACAAGGTTTTGATGTCTAGTTCCAAGGAAAAACC
TTTTTAACATCAGGACTAGTTTCTTCCCGAAATGACCTACTGAATACTCCATTACATCCT
GGCATTACATGGGCAGTGCAGGCCCTCTGTACCTCTTGTTTTGGTGGCTTGCTGGTTTAA
TTTATACACACATTTATTGTGCAACAATGCAGAATATGTTGGTGTTTTAAAATGTGTTAA
TATATTATATAATCCAACACACTGGGGTCTTGTTCATGATCACTACTTTGATCACAACTT
TGTCTCTAGTGAAGACTTCCCTTCATTCATAATGCAGTAGTTTGATGAAAGCAAGATGCC
TGCAATGGATAAATGCCCCTGGCATACATGCCCAGTCTATTTTATTTATTTATTTTTATA
GCATTCACCACATTTGCCCAGGCAGAGTGGGAACAGCTATTTGGTTAACCTGATTTCAGA
TGATTTTCTGTCTTATCCAGCAAGCTATTAAAGATATTTCTCTATGCAACCTTTCTAAAT
TCTGTCAGTCTAGAATCCTCAGCAATGGACAATCTCTGGGGCCGATTGCACCCAGAACTG
GCTTTGCCTCTAAAATTTAATAGATTTTGGGCACATGCCAGCTTTTTTTCCCTACAAAGA
TCCTCAAATCCCACATTGTCTTAAAATGTCCTGCTCAAAGTAAACCAGTTCAGCTAGCCA
TAATTTTTGCCAATGTATTTCGATCACCATCTATAGAGGGTCCAGAATTCCTGCTGGTCA
CCCACAAAGTGGTTGTAATTACAGAACTTGAACTGGTCTCAGAGCTCTTGCCATTCCTCC
AAGCTGTAGACAAGTGGGCACACTGTGCAGGAGCTGAATTTTCATCTCCCACCTATTTGA
TGCATTGTGCTCTGCAGGGCAATAGTAATCCTCTTCCAGGTCTGCCTCCATTCTTAACCG
CTGTTGTATCCCATGGGTCAGGGATCATCTGCAGAGTAGAGCAGTCCGAGGCATTCATAT
CTCTGCCAGAACAAGGTGTTCTCTCTGGGATCTGTGGCATCCAAGAGTCATCTGTATACA
GGGGCGATTCTGGACATATCGCCGCCTGAGGCGGCTCCTGGATGCCGCCCCCCCCCCAGC
GCTTACCTTCTGAGCGCAGGAGCGGGTCCGGGGGCGGTGAGATCGCTAGTGCAGAGAGCG
CAATTGCGCTCTCTGCACTAGAAGAGCCGAATTTCCGGTTTAAAAACTGGAAATTCTGCT
CTTAAAGTTACCAGGAGCGGCTTTTTGCCGCCCCTGGTAACTGGGGCGCTTCTGCCGCCT
GAGGCGAGTTTCTCAACTCGCCTAATGGCAGTAGCGCCCCTGTCTGTATAGTCAAAGGTA
TCCCATGAGTCATTGTTCATACCAGGTGGAGCTTCTATGATGCAGGAATGTATTAGGGAG
CTTTGGGTACACAAAACAACCTCTTGCCACCAGTCTAATGGTGCCAGGCCACGTAAGGAA
GTGGGTTTAGGGTAGGACTCACACACACAATTTCTTTAGGGAATGAGTTTCTATAGAAGC
CAGTCTGCACTTAGCAGTTCTGCCTGTGAATGTGCCAGGGTTGGGCGCTGCTACAGCTGA
TCACTGGAACATGTAAATACAGCTGCTGTGGTAACAGCTGGGCAGTCTCTGGGATCGTCC
ATGTCTATAAAAAGACTAACAAATTGAAACTGTAATTTCTTATAACCTCAGCCGCTTACC
TGCATCTCAGACCATGGGGTCTGCTGTACTGTAGTCCCCCCTCCCCTACCTTTAAATATA
GCTGCACAGTCGAGCCAGGAGGTACCAGACATTAGGAGCAGGGGAGGAGGGGCTGGTTGT
ACCAGGTCCCCTGATAAGATTTTACTGCAGGGGGGCCCCAGAGCTACCAAGTTACTGCAC
TTATGGCAAAGCCACCATTTAGACACTGAAAACACAGGCAATGCAGTGGTCCTAAATTTT
CTAGAATGCAATAGCTCCCCCATAATCTTATGTCCCCAAATGTTGGACTACAACTCCCAG
TATGCTTTTAACTCATTGTTTTTCATTCCACACTTGCACTTGCCTCTAAACAATGTTTAT
ATCCAGTTTATAGCACATGTTAAATCTCCAACCAGACACCTAAGTATAAAGCCACTATCT
CTGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..3768, 16367..16403
1001..3768, 16367..16403
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved