Xenopus_tropicalis Locus rpl7a
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis rpl7a
Xenopus_tropicalis
rpl7a
scaffold_878
SNORD24, SNORD36, SNORD36, SNORD36
2717..2790, 3746..3823, 4063..4138, 4416..4488
7020
TATTAGCAGTCACTGAGGGGTTCTGTGCCCCCCATATAAAGGCACAAGGCTGCAGGCTG
AGTTATACAGGGAACTCTGAGTATCACTCATGTATTATAAGGGATAATGTACCCCCTACT
GTAAATGATAAGGATATTAGCAGTCACTGAGGGGTTCTGTGCCCATATAAAGGCACAAGG
CTGCAGGCTGAGTTATACAGGGAACTCTGAGTATCACTCATGTATTATAAGGGATAATGT
ACCCCCTACTGTAAATGATAAGGATATTAGCAGTCACTGAGGGGTTCTGTGCCCATATAA
AGGCACAAGGCTGCAGGCTGAGTTATACAGGGAACTCTGAGTATCACTCAGAAATGTACG
GAAATAATTGAATGCAGTTTACCTGTCCCAGTAAGTGATACCGCCACTTCCACTGAGGGG
TTCTGTGCCCATATAAAGGCACAAGGCTGCAGGCTGAGTTATACAGGGAACTCTGAGTAT
CACTCATGTATTATAAGGGATAATGTACCCCCTACTGTAAATGATAAGGATATTAGCAGT
CACTGAGGGGTTCTGTGCCCATATAAAGGCACAAGGCTGCAGGCTGAGTTATACAGGGAA
CTCTGAGTATCACTCAGAAATGTACGGAAATAATTGAATGCAGTTTACCTGTCCCAGTAA
GTGATACCGCCACTTCCACTCTCGGCAGCCCCAGCACAAACCCTCACACACACAGTACAT
CCGCTCCCGCCCTTCGTTCCGCTTTGATTGGCCGAACCTCCTCATGCTAAAGCGTGATTG
GCGCCTCCGCACGTCAATCCCCGTACATACAAGCTTGCCTGTTTCAGGTTACGGTGCTAC
AACAAATCCTCTTAAAGCGCCAGCGCTTCCAGCAGAACCCCCAGTCACGCAATCGCGGCC
GCGGTCCCTTTAAGCGCCCTCGCTGTACAAATCTCGCGAGATCTCAGAGGCGATACAAAT
ATTACCCACAATGCCTCTTTCTTCCTTTCTCTGCCCCTGTCCACCATGGTGAGTGCTCGC
CGGCGCCGCTCTTGTTATCCGCTTCCATCCTACCGCTGTTGGCCGCTCTATCCCCCGCCG
CCCGGCTCACTTTGCTCCTGGATACCTCTGCCTTATATTCCCGGGGATATTTACCGGCCA
TGGATAATGTTTATACGGGATCCGGCAACTGGTGAAAGTTCTTCCTCTCCTATTGGCTAT
GGCTTCCGCAGGCCTGGCAGCCCTTATGGGAAACGGGGAGAATTTCTGATATTATCCATT
GCTTCCAAGGAGCAGGCCCAGACCCCGGGCTCTATTAGTTCTGACTGCCGCATTGGGCTA
AGCCTGTGCAAGTGATGTGATGAAATATTTGCTATCTGAGCCACAGTGCTGACACTCTAC
CCACCAAGATCGCTGATGCACAGCCTTATGGCAGGGTTCTGGCCCAGTAGATCCTGTCTG
GCTACTGTATGGGGGTGACTGGAGGATCTAGTGCAACTGTAAACATTGATGCCCCATTCA
GTTGCAATAGCTGACCACATGGGTAGCCCAATGGCATACTTGGGCACTGTGGGAATCCTG
TTTGGCTTGGGGTGGGGGTTGTAGAGCTATTATTGACTGGGGTAGTAGCCTGTAGCCGTG
CTCTTTATCCAGGGGCAATAGACTTGCCCTGGTATTGAAGCACTAGAGGGTGCCCAGGTG
TCACATGTTCTCAGCCTAAGTGGCAACTCTGGGTTTGCTTGCTGTCACCCTAATGTAGTG
CTTCTCAACCTTTCTTTAATACAGTTCCTCATGTTGTGGTGACCCCCGACCATAAAACTA
TTCCTAAGACCATCAGAAATGTTTTCTGATGGCCTTAGTTGACCCCCGTGATAGGCTGGA
CCCCCAGGTTGAGAACCGTTGCCCTAATGCATCTATTTCTCTGCAGCCTAAAGGGAAGAA
GGCCAAGGGGAAGAAGGTGGCACCCGCCCCTTCCGTCGTGAAGAAGGCCGAGGCCAAGAA
GGTGGTCAACCCTCTGTTCGAGAAGAGGCCAAAGAACTTCGGCATTGGTGAGTGTTGCTG
TGCTTTACCCATGATCCCTTCATAAAGTCTTTCCTATAGTTGTGTTGGAGAGATCTCCTA
CTTGGACATCATCCTGCTGTCAACATCTCACTCCTGCTGTGACTTGTAGACTAAGAGTAG
GGGAAGAGTCAAGGGTTCCAGATTCCGGCCTAGGCAGTGACTTGGATCTAAAGGGTCCAT
ATAAGGCAGTGGTTCTCAACCTTCGTCATGTTGTGGTGACCCCCAACCATAAAATTACTC
CTAAAACCATCAGAAATGTGTGTTTTCCAATGGTCTTAGGAGACACCTGTGAAAGGGTCC
CAAAGTGGTCCTGACCCACAGGTTGCGAACCGTTGGTATAAGGGAAAATGTCCATAGGAA
TGATGTAAGCAGGATTAAGGCCACATGTGGAGTCCAAGCACATGGCCATTGGTGGGGTGG
CCATAAGCCCCTGAACTTGTCACCATCTTACCTTCTCAATGTTCTTCTTGTTGCCTCTCA
GGTCAAGATATCCAGCCCAAGCGTGATCTGACCCGCTTTGTCAAATGGCCCCGTTACATC
CGACTCCAGCGCCAGAAGGCCATCCTGTACAAGAGGCTCAAGGTCCCACCTGCAATCAAC
CAGTTCACCCAAGCCTTGGACCGTCAGACAGGTACGTTCTCCTTTATGGCCTGGATGTTC
CTTTTGGCCACGTTCCGTGCAGATGATGCCAACTAATATTTGCTATCTGACTAGCAGTGA
TTACACACTTTCCACCAAGATCGCTGATGCACATTGTGGTTGCTTCTAACTACCCTATAC
AGGTATTGGACCCCTTATCCGGAAACCCATTATCCAGAAAGCTCCGAATTACAGAAAGCC
TGTCTCCCATAGACTCCATTTTACTCAATTCAGAATTTTAAAACTGATTTCCCTTTTCTC
TGTAATAATACGAGTACCTGTACTTGATCCCAACTAAGATATAATTACCCCTTATTGGGG
GCAGAACAGCCCTATTGGGTTTATTTCATGGTTAAATGATTCCCTTTTCTCTGTAATAAT
AAAACAGTACCTGTACTTGATCCCAACTAAGATATAATTACCCCTTATTGGGGCAGAACA
GCCCTATTGGGTTTATTTCATGGTTAAATGATTCCCTTTTCTCTGTAATAATAAAACAGT
ACCTGTACTTGATCCCAACTAAGATATAATTACCCCTTATTGGGGGCAGAACAGCCCTAT
TGGGGTTAATTAAGGTATGAAGATCCAAATTACAGAAAAAACCCTTATCCGGAATACCTT
TTGGTCCTGAGCATTCTAGATAACTGGTCCTATACCTGTACCTAGAACTCCCAATATGGT
AGCCTGGCTATGTTCTGTATTAGTGCACCGGGGTTCCGGAACTAATGACTGGTCTCTCCA
ACAGCCACACAGCTCTTCAAACTGGCCCACAAGTACAGACCTGAGACTAAACAGGAAAAG
AAGAAAAGGCTGCTGGCCAGGGCTGAGCAGAAGGCCGCTGGCAAGGGAGACGTTCCCACC
AAGAGACCACCTGTACTCAGAGCTGGTAAGTACAACCTTCTGTGGGGGCTGTAGTCACAT
TATAGGGGGTCTTAGAGTGCGCAGGCAGCTGTCGGCACTTTGTGGGTGCTAACACCTAGG
ATGGAACACAGAATGTCTTTCATGTTGCCTTTCTGACACTGGCTTGTCTAGAGGGTGAGG
TACAAAGTGACCACAAGATGGCGCTATTGCAGTGATGGCTGAATTTCTTCACCTGAAACC
ACTTGTGTGGATGTAAAAACACGAGCTTTTTAACACTGAGCAGTAGCCTCTAGTTTGGGG
GGGTCGATAATGGCGCCTCATTGGGGAATGGATGGACTGACGGGCTTTTGGCCTTGCAGG
TGTCAACACTGTCACCACCCTTGTGGAAAACAAGAAGGCTCAGCTTGTTGTGATCGCCCA
TGATGTCGATCCCATCGAGGTAGGTCAATCGAGTACTTTTTTAAAGGGGAAGTTCACCTT
GTAGTTTGTACATTGGCCGATATTTTTCTGGGGTGCTTTTGGATCGCAATGATGTAATTG
AATTTCTTCACCTGACTGGATAATGAAGATTAAATCCGAGCTTTTTAACCCTGAGCTGTC
CAAGCTGCTGCTTTGCTATTGGCGTAACGATAATTATGCTTTGTTTCTTTAACCCTGAAT
TTATTCCTCTTCCCCCAGCTCGTCGTGTTCCTCCCTGCTTTGTGCCGCAAGATGGGAGTC
CCATACTGCATTGTCAAGGGCAAGGCCAGACTGGGCCGCCTCGTGCACAGGAAGACCTGC
ACCAGCGTAGCACTCACACAGGTTAACCCGTAAGTAACTTATTACTAAAGCTTATTGGGG
GGGGGGGGGTGGGTTGTAGAACTAAACGTCCCTCCTGTGCAATGATGTGCATAGAATTTC
TTCACCTGAATGACCGTGTGGCACTCAGAGCTTTTTAACCCTGAGCGGCAGTTGGGGGGC
CCCGTGTTGCACTGGCAGTTGCACCAGAATGGGAGCCGGCAAATAACCAGTTTCTTTCCC
CCACAGTGAGGACAAAGGTGCCCTCGCCAAGTTGGTGGAAGCAGTTAAGACCAACTACAA
TGACCGATTCGATGAGGTATGGCTCAATGCAGCCATTTTGTTTTTTATATATATTTTTGG
TCTTCATTTTCTCCCTGACAGGACAAGGTTAAAGTGCAATAGTGTGGGGGCTAAAAGCTA
TTGGCTTTGCATATTATTGCACTGTAAGGGAATTTACAGATGTGCTAAATTGCACCAGGG
AGGTTTATCCTAGAAGCCAATCTGATCTTTGCATTAGTTCCCCAACTTGTAGCCGGCCCA
AGCTGATTGGCTGATAGTGGCACATTATTGGCCAATGCTGGCAAATCTTAATTGTAAAGA
ACAGCTGATAACTTGACGGGCTTCTTGAGACAGATGGGTTTTGAGGTTTGCATTTAAATG
CAGAGGGGGACAGGGTTTGGTGGGACACAGACCCATAACTGGTGGTCCGTTGAGAATGCT
AGCCTGGCCAACTTGGCCATGCAGATAGGGCAAGCCATTTAAAGGGCAGTGCCAGCTGGC
TTCTATTCCCCTTTCTATAGGCCAATCCTTTGTAGCATCAGTGTATGAGTAGGCGACTTT
GTCCCTACGAGACAGTGTTGGCGGCAGCTTATTTGGCCCAAGTGTAGAGCCTTCCAATGG
TCCCCAAAAATTGGCCCAAAATAGTCAGATTGTTGGCCCCAGGGCCAGTGATGGATTTAG
GCCAATATGTTCCAGTTCATGGGTGACCAAATGGGGGCCCAGATCTGCTCTTTTGGTGGC
CTCTTTAAAGTGTTTCTGGCAGTATATGGCCAGCTTAAGACAGCAAGGATTAAGGTGCCC
ATACACACTAAGATCCGCTCACTTGGCGAGGTCGCCATGTGAGCGGATCTTCCGATATCC
CCACCTACAGTTGGGCGATATTGGGGAACATGTAGGCTAATTTGATTGTTTTCCCTGGGG
CCAAACGATCGAATTATAACGGGAGCAATGGGCGCAGTCTGTATGGGGACTGCATCAACG
AGCCGATGCGGTCCCCAATTCAACTAAATCTTTTAACCTGCCCGATCGATATCTGCCCAA
TTTCAGCCAAGATATCAGTCTGGCATGCCCCCTCGTTCCTGCCCCTACATGGGCCGATAA
GCTGCAGAATGGGTCCAAGGGACAGATATCGGCAGCTACAATCGGCCCGTGTATGGGGGC
CTTTTAGTCTGTGCCCATATACACTGATATCTATAGATTCGTATTGCCCATGTGTTGCAA
TTAACAAGCCTAATCGTTAATTTCCTAATCTCTTCACTCCTAGATCCGTCGTCACTGGGG
TGGTGGTATCCTGGGCCCCAAGTCTGTTGCCCGCATCGCCAAACTGGAGAAGGCAAAAGC
AAAGGAGCTGGCCACCAAGCTTGGTTAAATGTACCGATCTTGTTGTTTTGTTCTGTACAG
AAATAAAAAAAATAAACTCCAGAAATGTGCTCTCTTGTGTTACTGCTACTTAACTATAGG
GTCTGTGGCCCTAACCCTCCCATAACTCCTGTTTCATATAATCACTAAGGTCACGTGGGG
CACTTGTGTGGGGAGACTGCCAGAATCCCAAGGAATTACTGGAAAAATGCATTATGGGTA
CTCTAACTGTACACATGCAAATATATAATGCACATGTTGGCTTCCTTTGCTGGCTACTAA
CAGACAGCTGAGGTTGCCTCGGTGGCTACCAATACAAAAAATAGCTTCTGTGGGCTGTTT
CACCTTCCCTTTGGCTTTTGTGATGTTTGTTGCCCACGGGGTATCCACCAGAAATGTACA
ATCCTGTGTGGAGCTGTGGTGACGCTAGTGCCCAAAAGGGTCCACTCTGGTGTTCCGTTC
CCTTAACCCATAGCAAGGTTAGCCCACCTGTCTGCAACCTTGTTATGGGATAACAGTTTC
TACCACAAATGTGATTGGCTGTTATATCAACCTGAGCTTAATTAACAGTATAGAGGCTGT
GGGATTTGTGCCAATAAGTTGGGCTGAAAGGCGTGTTCAAGGAAATACATGTAAATAGAG
GGGTAGTTGACTTTCAAACTAACTTTAGCATGGTGTAGGCATTAATATTCTGACAGTTTG
CAGTTGGTCTTTTTTTTTTTTATTTATGGCTTCAGTTGTTTTTTTTTTAGCAGCTATCTG
GTTGCTAGGGACTTATTTACTCTAGTAACCAGGCATTGGGGTGAGTGAGACGGGTATGAA
TAGAAGAGGACCTGCATAGTAAGAAGTAGTAAAAAAAGAATTATATATATATATATATAT
ATATATAATAATCCTCGCTGAGCAATAGTTAATGGGTTGTCGGGGGTCGGTGACCCCAAT
TTGAAAGCTGGAAAGAGTCATAAGGGGAAGGCAAATAATTCAAAACCTATACAAGTTGAT
TAGAAATAGCCATACTAGAACATGAAGTTAAAGCCCACCCTTTTAAAGAGGTAACATACA
A
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1007, 1906..2026, 2521..2670, 3424..3564, 3899..3978, 4218..4348, 4566..4635, 5863..6020
1005..1007, 1906..2026, 2521..2670, 3424..3564, 3899..3978, 4218..4348, 4566..4635, 5863..5967
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved