Xenopus_tropicalis Locus rpl23a
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis rpl23a
Xenopus_tropicalis
rpl23a
scaffold_817
SNORD42
4949..5014
7344
tgatttaatgtacttcatatttaggttcgtgggctaaattcttgtgtgagtgcctttgg
ttgttcacggtcaaaaatctaaatgtctttcagagacagcaagtctgcataattcatcac
atgaagctcatcctgtatgactgaacaaagatatcatgctaagagatgaattgattttat
ctgcaatgtatggcattaccttttaatgagatctcctgtttcaggtaaatgtatatgcct
ttcattcctgctaagagaagattcaagctgtagtttagggagatactgcagctttttagg
cactgatagagcaatctacaatacctctatgaaaaaaaagttacttccacacactaatca
ctgttttgagggactggatttcaaaccgaatgcagtaaacagacaaagatttgaaattaa
tatttgtttattatataaacaacagatattgcccctgcactgggttcccccagccacatt
gctgggagacggataccagatatgatacgaccagagaggccactcttcagttatgacttg
gtacattgggccccagaactttcatgtgcattgaaaaacacaatgcacaacagacgtctg
acaatcaaaactttgagtttgcccctcgctgctacccattcattcatagcatttcccccc
cccaccaaaaaaaaaacgtcttcttttaaacagagaaagagactgctaattaactaattt
gggcacccagtcatttttctattgcgtttggatcacttttacgtgatcgttttaattctt
ggccagcctgttaccaacattcccacctccctgcttctacctagctcccctggcagcgaa
aacacacgtgatttaattaagttacagagccccgcgataacacccaagcaacacacaggc
aaaactacaattcccatggagcctttcgaagtgacgctttgctatcgcgagaatctcggg
cgctagtccctgtaatattgtgtgagaaacccctcgaacttCCTTTTGCCCAAGATGGCT
CCTAAAGCGAAGAAGGAAGgtgagggccgcggggaaacatgatgatattgactgcttttg
cggggtagcttgtgttctcttggcacactgtggtatgtgaatggtatgagggagccacac
gggctatgttatcccggtttgtctctcggtgaagcgtatgtacattacatagcgtgagcc
ggtggggccgcatgtgcatggagctgtagagcaggctaggccggtgctgccctgcttggg
ctgtttataattgatggcgataatgtgccgcggtcgttaacgtagattgaaacactatcg
cttagaataatggcctagaagctggcagccacctttatttatgttcctggtaaacgtggc
gctagaaaaggtttggtgcagatgatgttgtaaagcgatcaaagtatgaaactgatgatt
ccaatcctattactactgatgcacctgggaaactctcccaccatctctatgtaccaggta
cagtagggctaataaaccctaagcaagatctgatgtccctctttggtatccagtgctgag
accttaataactaatcaccacttcactaactttacattgggagttataaactcttctttt
gtgatttttggtttaaagtgttttatcagtgatagtaggcttgggtaagggcatgtaggc
tggtagtctgtttgttggggctcaagcctgtcagatctttgcccagccctcatgccactg
aataaaacagatatcaaatcacacctatgttaagaataagaaatagggtcaatgaaggca
agtgttatatactaatttgtttaaaaatccaaaatgtgtcagtgctactaaactgtagta
acctgtgctgtattgctaccattacaattttatggcaagcagatgggtttgatggggggc
cattagggtgtttttcctgccactgccctcaggcagaaacagcggtgaagagcctctcac
tacttgtcatcactcgggatattaatgattaaccaagcaaccaaccaatattgaatgtac
atatgacaagtgaatgtgtcagaatactccctgaagcattttggtgcccaggtttgcctc
tcactgccccatgtgccctatgccttccattatgcaggggtcagtgagtgatttttgcac
cctaatgctttccaattgagggtagtggtgaacataatgctcaatgtgccacatgccttt
agataattattggatgagtgctggtggcatttcccagtaacaaagctgctcatagtcagt
cacataattatcaatactgatgtgttcaatcttctattttagCTGTCCCTCCTAAGATTG
AAGCAAAGTCTAAGGCTCTCAAGGCCAAAAAGGCTGTGTTGAAAGGAGTCCATAGTCACA
AGAAAAAGAAAATAAGGACCTCACCAACCTTCAGGAGACCAAAAACACTCAGACTGAGGA
GGCAACCCAAATATCCTAGAAAGAGTGCCCCCACAAGGAACAAgtatgtattggttgtgt
taatttcttggaaaagttgcagcagagacgtagattgctatacacaacagtagatatgct
tggcttgtgacatttgtgtttattttagctttgtcatttactgttaaatattgggggaac
agatgatgtgatgtttatagcgatcaaagcctgaaaaacctgtgattggatattcattta
ctgatgtgcccctaatgtcacagtccatgatgctttttattaaataaatagccttctgac
agtatagccatagaaagattttgctgaaattcaagtgacttttctctagtaacacatggg
tgggcttcctgactaaatattttgcctgatacagtagggatccagtcagagatcatagat
tcattggacagttggccagattgtggggcactgtagttccaggtcattggcttttactga
cttgctatttaggccaaaactgctattcataccaaattttgattgcttaaagtattcttc
agagcggagccccaaccacacagtagcatgcagtttggttggacctgttggcgcttatgt
ggccagcattaaggctgtgcaatgccaaacctcccagtgatacatgtaaacaaggggtgg
tcaagtaggtttttattgtcattccaaccatatacagtacacagtgaaacgaaacagcgt
tcctccaggaccaagatgctacatacacgcaacacatgaattaacacaatgtaaatttaa
caacataaattcaaatattgtgcaaataattgcaaattgcaaagagtagttcagttaggt
agttttagatcaggtgattttcatgtgtgtgtttgttcagtcctaatgttatttagttcg
tctgaatgatttttgtgtgtccagtccctttgtgatgagaagacagatggcttgtgggta
taaactgttacataatctggatgtgagtgcccgaatgcttcggtatctttttccagatgg
cagaagggtgaagagtgagtgtgaggggtgtgaccaatcagccacagtgctggtggcttt
gcggatggtgtatatgtaggtgttcagaacgaacttgcctgtggtgcagtgcaactgtgg
cttgttaaataaaacttacccagatctgatgttgccagaaccacttcatttgtacaaaat
gtttactttgtgcctttgaacagttaaaggaggaatatcatggggtaaaatctaatttca
gttttagttgttttaaagttaaatcttaaaactaattacaactgaaagcttttattcagt
atgtaaccttgtgtctagtgtccctctgattataggtataggaaatccttatccttgtat
cagccatgcagtcattgtactcataatattaaagactgtaagttaagttttcacccaaat
tctcaccctaactggccttcattctgagccctcaaaggaaagccagtcctacagtatggg
aaagactgtagattatttgtagttaatttttggttttggagttttttgatcaatgtaact
tgtgtggttactagtgacaaattactcttaatgacttggcagcagttaggataattgtca
aagcaatagaagctgaatagtaagataagcaataaaaagaatgaagcctgatttgttttt
tggttgtagggttcagtgaccataaggctaatgcacaggactgctcctgccatgaggcaa
ggtacagccaaggttgcactgcactgtaccacagacagcagcagccccagagttgctgct
gctaatgccacaggggcagattctcagcctgcgattaaatgtgtgtgtatgtaacctgct
aaaattttatttgtaaaatttcctctttatgttgttgaaatggtaaagagctgtttgtat
attttattatagaccaagataacatctgaaaatagaaaatccataaaactcaatgtatct
tgccattaaagaaagcatactttcgtgaaaaaaatagtttcagaatcattaaacttttat
attagaatgtataggcagggcattgcttagagaagcgacctgagtaagttagcgtcagtt
cattttcctttttttgtaaaggccacatttccgatgtgctattgcaaatatagttcctga
ttaaatttgacagattatcataaattaaatgctttgtttggtgttgccttgacagctaag
tattttttttttatattttagGCTTGATCATTATGCTATTATCAAGTTCCCACTGACCAC
TGAGTCAGCCATGAAGAAGATCGAGGACAACAATACTCTGGTTTTCATTGTTGATGTTAA
AGCAAACAAGCACCAGATCAAACAGGCAGTGAAGAAACTCTATGACATTGATGTACAAAA
AGTGAACACCTTGATCAGgtgagagatggcaagattaatatcctgtatcggtgcttaagt
ttagtaatgggtagcctatgtagtttcttgtgcgaatgatggaaaacatattaatgctga
aaatattgatgtttccaaaggaaccactgatgcataagttaaaacttaaaaatgtgtttt
cagtaattttttctttagtattaactgttggtcattgtgttttagGCCTGATGGTGAAAA
GAAAGCATACGTCCGCCTAGCTCCAGATTATGATGCTTTGGATGTTGCAAACAAGgtaac
tgttctacttattgtacagcgctgcagaatatgttggcgctttataaataaattttaata
ataatttagtactcaattacttcccatgaatgacttttgtaaattcattcctatggggtc
ctctaacagcaaatatgtattgcattagtatagctctggtcattggcagacttctgcagt
tttaaactttgcaaatgatggaaatgttatttggactgaatacattgatgagctcaaagg
aaccactgatgcacagtataactgcagactcttatttatttggccaatgttttgatgtga
gaaattgatgggcttttatatagaccgaagtgtctgcttttagcttaccatgcttaatgt
atctgcaaacctgtcttatgccctgtgtgtgtaattgtacacatgctcctgaggctttat
ggtacacaagggtgccatgtcttaatagaaagcaaagttcatcttaaaataacattataa
taaagcccaccagtcaaccaaactattggggccctagcctaaagctggttacacacgatt
ttgttgcacgaaagatcattcccaccctccacagacgttcagtgctgaatcgtccgatat
ggaggtagaaacagtaggatttctactccttctgccgattcagccctgaaggtagatttt
gctcagacgccttcaatggcgcccaatcaaaattggcgagtcgactgatatccgcagtct
tttgcgatattggtcgcctcgccgacttaccatacacgcaccgaatatcgtaggaaacga
ggcttcgtacgatatcatcgttgcgtgtatggccagcttaacaaggctttatacgccaac
catattatccaagctttgaacttaggatcaatcatttaaatccaatttaacacactgcct
aggttcaaaatcaggcaaagattcacttactggccagttcaggagacgatgaccagcaca
agtcattctgaatgacttataagtaaatatagcttgttatccattaaccgatggagttgg
gtgtgccatcatattaaggttacaaaggattgcactagaatttgttcttgtataatttgc
tgtttctagttcataaatgtgttttcatttttatctttcagATTGGCATCATCTAAACCT
GCATCTTCAAAAAGCTGTACAGAAATAAATGTGTTTTTCTGCCTAtttgtgttgtcggtg
tattgtgtttaacaggggtccccaacctttttaacctgtgagcaacattaaaatataaaa
aaagttgggtagcaacacaagcatgaaaaaagttcctgggatgaccgaaaaatggttatt
ttgtagcccctatgtggattggcaaactgcaggaggctctgtttggtagtacccatagtc
tttttgcctccaaaacttgcctccaagccaagaattcacaaataagcacctgctttgagg
ccactgggagcagcatctaaggggttggagagcaacatgttgctcacgagccacttgttg
gggatcattggtgtataaagtccaagtttttgcagctgcacaacatacagtctacacttg
tgcaatgaaagtgttgcccccactagcttgtaggcatacatcatgcactgcagtgcaaaa
tattaaaggagccgtgcatattctgtataacatgcagttgggcagcttaccccatctatt
gtgacttttttcctgtaactagcagaatgtagtagtgttttcatacatatatgaatttgc
agtggggtaaggaggttctgttttgggccataaagaggcacttgcacctaatgtctggat
taatgttactgttactctatagtatagtaatgaatgggttttttatgggtaaagtttatt
gtatttgcatttaattcagcaacaaagcaagggaaaacatggggggaggctaaagttagg
gtatagtttacatgttggtgcaagatgaagttctacagtacaaataggtaggaagattgt
ttcgcagacattcgacccatgacctcggtccagacttgtgctacctatgggcagtgtcgg
gtcgtatgtaggaagtctacgccgaagtccccatctgtgggaagaagcttccgagttacc
atcccattgctctgagtggcataatatagatttgatatagccatttaaacttgatgcact
catgcatgtttactttcagctgtat
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1038, 2322..2502, 4701..4877, 5085..5154, 6281..6344
1014..1038, 2322..2502, 4701..4877, 5085..5154, 6281..6295
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved