Xenopus_tropicalis Locus BC075328.1
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis BC075328.1
Xenopus_tropicalis
BC075328.1
scaffold_757
SNORA5
1954..2090
6845
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGCACAAGGCT
GCAGGCTGAGTTATACAGGGAACTCTGAGTATCACTCATGTATTATAAGGGATAATGTAC
CCCCTACTGTAAATGATAAGGATATTAGCAGTCACTGAGGGGTTCTGTGCCCATATAAAG
GCACAAGGCTGCAGGCTGAGTTATACAGGCGAGGGAACCTGCTATTTTAAGTAAATGAAG
ATATGTACAGATACTACTGTAATACAATGGTCATTTTGTAATTATCACCACTGTATTAAG
AGAATGTGGGTGCTGTGTGCTAATGTGTGTGGCTTTAATCTTAGCAGCCAAGTCAAATTC
AGTACTGCCTGCCCCCAGGCTACTACTGGCCCAAATGGCTGCAACATTAACTGTGGCTCA
TGGGCCTCGATTTCCTTTTTAATGTGGAAGTTGAGGATAATATGTGCTACAGACATGTAT
GTTTGTATCTAGGAACTGTACTGTTCTGCTACACAGGGAGTCTTGACCTGACCAATAGGC
ACTAGGGTGCCCGACATGCTGCACTATATGAAGGTGAAACAGGTCATGTTGGCCTTAAAT
TTATTCTGAAATAAAAATAAATGTTTCTCTCTCACTTGCCAGGAAAGCTGAACTTCCACC
AGACACAGGTTTTTCAGAAGATGGCCAGTGACCTTCTGCCCAAGGTGCCAGAAATGAGTG
CCAATGACATTGCCCGCTGCGTCAAGTCATTTGCCTACCTCAAGTGGTCCAACCTGCCTC
TGTTTGAAGCCTTTGCACAGGTGAGTCCTACCTGGGGCCTTGTTAGCATAGCCCTTATTC
TCTAACAAGTTAATATGGCACCCATTGCTGTATGAAACCATATTAAGTACAGATGCATAG
CCTCCCAGAATGTGCTTAGCCTGGACATATGCCTATGTTGGTATAGTTTTTGGCATCTCT
GTACAGGCTATGAGCAAACTTAGGGGGCTGTTCCTGCTGAATTGTGCTTAGTACAGGGGA
ATCCCTATGTTGCCATATTTTTATGGTATCTCTCTGTACAGGGTATGAGCAAACTTAGGA
GGCTGTTCCTGCTGAATTGTGCTTAGTACAGGGGAATCCCTATGCTGCCATAGTTATATG
GTATCTCTCTGTACAGGCTATGAGCAAACTTAGGGGGCTGTTCCTGCTGAATTGTGCTTA
GTACAGGGGAATCCCTATGCTGCCATAGTTTTATGGTATCTCTCTGTACAGGCTATGAGC
AAACTTAGGGGGCTGTTCCTGCTGAATTGTGCTTAGTACAGGGGAATCCCTATGCTGCCA
TAGTTTTATGGTATCTCTCTGTACAGGCTATGAGCAAACTTAGGGGGCTGTTCCTGCTGA
ATTGTGCTTTGTACATTACAATACATATGTTGGAAATGTTTTGCAGGCAAGCATCGACCA
GTCGGAGAAGTTTACTGTACCTCAGCTGTGTAACCTTGTCCTGGCATTTGGCCGCCTGAA
CTTCCAGCCCAGCAAGCGGGAGGAGTTTTACAGCATGGTAACTGTCTCTCTTGTTATGAA
TGGGACCTGGGGATTGGGCCTTTCACGTTAGCTCTGCAGCCATGTCAAATTCAGCGTTGC
CTTATCCCTGGCAGCTACTGGCCCAAGTGGCTGCAACAGCAACATGGTAGCTCATGGGCC
TCGCTTTCCCTTGTAGCGGAATTCGAGGATAAAATTGTGCTACGGACAGATGTTTGTGTT
GTGTTAGAGCCGCGTTTTAAAGGGTCAGTCCAGTTGGACTCATTTTCTCCTCACTTCTCT
AGATGCACCAGAAGCTTCACGCCGAGCTGGACCTGCTGGATCCCTACCTCCTAGTGGACA
TCGTATGGTCCCTGTGTGTCCTGCGACAGGTCGACTCCTCCTATATAAGCAAAGTGCTAG
AGCCGGGACTGTACAGCAGGTTCTTCAGTAAGTTTTATTGGATCTGCACTCCAGATGCCA
GGGCTGGGTAATTAAAGGGAAAAAAATATGCTCCATATATAAGCAGGACTTTATGTTCTG
GGTACCTGCACGTAGGAGACATTCTAATGTTGTTTATTTCTCTTTCCCATAGCCGACAGT
TCCCCTAGATCTGCTAATTACAGGCTGAAGCTGGCGCACATTAATGCCACGGCGCTTCTG
GAGCATCCGGAGTACACAGGCCCTCACCTCCCCAATGAGTCGATAAGCACAACCCATGCG
GTTACTGCCAACAGGAAGTTGTCCCCTCTGCAGAGCGGCCTGCAGGAAGTGCTCCGAGAA
CTGTTCCCTGTGGAGGGGACGTGCCGCTGCGGAGTGAATACAGTGTATGGCTGGTATATT
GGTGAGAGTCCTTGATACGTCTGTCAGTAGGTCTCAGCATGATGGGTGAACTGCGGGCAA
AAATGCCAGCTTTGCAGGGGAGCACACAAATGCGCCAAACAGCTTTAATACTCAACCCTC
ATAATTTATTTGGCAATTATATGGTTTTAACTATAATGATTCAATGCAGCCTTGTCAAAT
TCAGCATCCCCTGAACAGTGGGCGATGCTGGCCAAAATGGCTGCTACAGAATCCCTTCAG
CTCATGGGCCTCACTCCTTGATCAGGAGGCTGTGGGGATAAGTTTGCGCTGAAGACACTA
TGTGCTGTGAGTATGGTGCCCGTACTGACCTGGGCAGAACAGACACTGTGTGCTGTGAGT
ATGGTGCCCGTACTGACCTGGGCAGAACAGACACTATATGTGCTGTGAGTATGGTGCCCG
TACTGACCTGGGCAGAACAGACACTATATGTGCTGTGAGTATGGTGCCCGTATTGACCTG
GGCAGAACAGACACTATATGTGCTGTGAGTATGGTGCCCGTACTGACCTGGGCAGAACAG
ACACTATGTGCTGTGAGTATGGTGCCCGGACTGACCTGCGCAGAACAGACACTGTGTGCT
GTGAGTATGGTGCCCGTACTGACCTGGGCAGAACAGACACTATATGTGCTGTGAGTATGG
TGCCCGTACTGACCTGGGCAGAACAGACACTATATGTGCTGTGAGTATGGTGCCCGTATT
GACCTGGGCAGAACAGACACTATATGTGCTGTGAGTATGGTGCCCGTACTGACCTGGGCA
GAACAGACACTATATGTGCTGTGAGTATGGTGCCCGTACTGACCTGGGCAGAACAGACAC
TGTGTGCTGTGAGTATGGTGCCTGTACTGACCTGGGCAGAACAGACACTATATGTGCTGT
GAGTATGGTGCCCATACTGACCTGGGCAGAACAGACACTATATGTGCTGTGAGTATGGTG
CCCGTACTGACCTGGGCAGAACAGACACTATATGTGCTGTGAGTATGGTGCCCGTACTGA
CCTGGGCAGAACAGACACTATATGTGCTGTGAGTATGGTGCCCATACTGACCTAAAAGTT
GCCCTTTAGTCGCCCCTAAACTATGCCAATAGTTACTTGGGACTGCTGGGAGTAGTAGTT
GTGCAGCCCCATAGAACTTCTGTATAGTCTCACATTGATTTTTTACTTGTATTCAGTGGT
TGCTATAGGCCACTAAATTCCTGGATATGTTTGTTCTTCCCCCAGACGGTGAGGTTGTTC
TAGACAGTGACAACAAACCCCTATCCCTAATGGATCTAGAAGCACCGCACCTTCCGCACT
CGCAGGGGAAGAAGCCTTTGCCGGAAGGAACCCGGAGGTACGTTGTTATGGATGGGAAAT
CAACTGCCCCTGTGTATTGCTGGCAGGGTGACGCCCACCCACAGAGGGGTATTAGTGAGG
TACCAAATGGGCCCATTAGTCAGAAAACCTTGTGTCAATGTATAAAAGTCAACTGAAGGT
GACTGAAACAGACACCCTATCTCTAGCATCATGTGACGCCCCCCCACCAATCAGCAAAGC
AGGGAACAGCAGCACAGACCTCTCTAGGAATAAGTGTTTGCTGATTTGCATCATTTGAAA
TCATGGGGGATCATTTATAAACACAGGGCACCTAGCTAGTAATCCATAGCGACCAATCAA
TGATTAGCTTTTTTCAGCCAGCCGCAGGAAGAACAATGAAAGCAGGCATCTGATTGGTTG
GCATGGGTTTCTGCCTAGAAACAAATTTGCCCAGTTTTATAAGTGCCCCCCACAGTTTCC
CTGCATTTTTTTCCAGATATGTTAAACCAAACCAATATCTGCCAGCAGTGATAGAACATT
CCAAATGGGCAGAATTTCCATAATTCCAGCCTATATTTGCCACAACCTTCATCCACCCCA
GAAATCTACTTACCTGTTACATCACCAAGGGCAGTTGTTGTTACGCGGCTGCAGCACAGG
ATGTAAGGATTGCCGGCTTAGCTCCTTATATCTGCAGATTAGTCCCTGCGCCGCTCAGAC
GGGTCTCCTTGTTACTAACATCCTGCCCTGATTCTTGCTGCAGGCTGCACTGCGCAGTTT
GTCTCACCCTCTGGCCTTTTCTATGTTGCTAGGTTTGCCTTTGTGGCCTGGGATTTCCCC
AATTTTAACTCTCGCAGTAAAGATCTGCTGGGCCGCTTTGTGCTGACCCGACGACACCTG
CAGGCTGCTGGCTTCTTGGTGGTGGAGGTGAGTACTGCTCTTGGTTCTGCTGCAGGGAAA
TTGTCCAACCCTGCAGCATCTCTTGACGCTTCTCTGCTCAGGTGTAGCCCCCACAGCTGA
AGAACTGAGCAGACAAGTGCCTGGAGATGCTTCCTGCATCTGTAACTTGAGCTTTCTCCA
TTCAGCCTCTGCCAGGACAAAATGGGGCACTCCGGTTACACATTCATGCTATAAGCAGTG
TATAGCGTACCCCTTTAAATAATGGCCGTACATTGAGCATCATTATTTAAGACTGATGCC
AACTTTCAGTTTTGTCTCCATCTCTCTGTGCCATGCCTTACCCATCTGTACTTCTTGCCC
CTGGGCTGCTCTCTCACCCAGTGGGCCCCACCGACCCAGACCCGAGATCCCGCCTGTCGC
TTCCCTGTTGCCAGCACTCTGCTGCAGCCTTCTCTGGGGGCGGGGGTGGTCTGGGTTAGC
AGCCTTGGTGGCCCCACTGCTAAAAAGATAGTCAAGAAGTTTATCTGTAGCATTGCGTTA
CATACACTTTATAGAGATACATGTGGTGGCACAACAGCACTTTCAATACAGGCCAAGCCA
CACCCTTTTTGTAACCATGGGAAAGAGAGCAGCCAGACAACTGTGATCAAGGGAAAGAGA
GCAGCCCAACACCAGAGTATGTTGAATTTAGAGCTCGGTACTTTGGGGTAGGTTCCAGGT
GGGCCCAATAAATGTTCCCAGGCTACATGCCAAACCCATGAGGGGAAATGGTTTTTAACC
CTTTGAGTATCCAGCAGTATTTGATGACTCTCTGCCTCCCACAGGTGCCTTACTATGAAT
GGCTGGATCTGAAATCCGAGTGGCAGAAGTCGGCCTACTTGAAGGACAAGATAAACAAAG
TGGTGGCTGAGGAGATGGCCAGATGAGCCCCACACAGGCCAGGAAGGATGTATTGTGTAA
ATATGGATGCCCTTGTACTGCCGGACACATTGGCCCCTTTCTGCCAGAGAGGCCCCCAAG
GACTGGGACTGAAGGGCTGTATATATTTTAGCAGATTCTGTATTTTATTTGAGAGAGATT
GTTGGTTCCTTTGTGGGAACGCGCGGCTGCCTGACATTCACAGCAGCTATGTACTAAAAA
GAAAAAAAATACAAAAACGGTAAAAGAAAACAACTGCCCATTGGAGTCTTTACCTTCAAC
TGTTGTTGGGGGGGGGGGGGGAAGCTTGGAGCCAGAAGAGAGTGAAATCAATGTAAAGTG
CAGAGCTGATTGCACGGCCTTGGGTTATGTGTAATGTACCCTGATAGGCCATTCACATCC
CTGCTATGGGACCCCTCTCTGTGTGACTACTAATTGCTCCCTAATGCTAGCCCAGGGTTA
ATACTAGTAGCCCTGTCTCTTTCCCACTTGCTAAACAGGCAACCAGCCCTTCCTTGAAAG
TGTCTTTTGTATCTGCCAACATCACTGCTTTTAAGATTTGTGGGGCCTGGGCTTTACCTG
GTGGGCTTGGGGTATATTTGTACCCATAACCGTGCAAGATTGGGCAGCTGGGCACTAGGT
ACATACAGGTGCGGGGGCAGAATCTCCCCATTCAGACTGGCTCAGCACAGAGGCATCAGG
CAGTACATAAGCAGGATAATATTGCACATATACGGTATGTATCTTCTATAAAGAAGCTCC
CCATCAAGGTGCACCAGTTTTGGGGTGCCCAACATCAGTAGCAGCATGATCCCACTCTGG
TTCTAAGGAAAGCAACATGGCAGCTCCTACTATCTCCTCCTACTGTGCTGTCAAAGGGAA
ATCATATGGCAGCTCCCAAAGGAAGCAAATGTTTTTAGAGATAACTTTCCCTTTAATAAA
GGAATTGAATGCTCCATTTCACACAGCAGAGGTAGCGTCCCGCCCAGAACCGCTATTCTG
AAGCCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1159, 1786..1896, 2162..2306, 2452..2700, 3945..4056, 4832..4946, 5744..5845
1001..1159, 1786..1896, 2162..2306, 2452..2700, 3945..4056, 4832..4946, 5744..5842
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved