Xenopus_tropicalis Locus rps13
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis rps13
Xenopus_tropicalis
rps13
scaffold_707
SNORD14
1894..1984
3233
NNNNNATATGGGCACAGAACCCCTCAGTGACTGCTAATATCCTTATCATTTACAGTAGG
GGGTACATTATCCCTTATAATACATGAGTGATACTCAGAGTTCCCTGTATAACTCAGCCT
GCAGCCTTGTGCCTTTATATGGGGGGCACAGAACCCCTCAGTGACTGCTAATATCCTTAT
CATTTACAGTAGGGGGTACATTATCCCTTATAATACATGAGTGATACTCAGAGTTCCCTG
TATAACTCAGCCTGCAGCCTTGTGCCTTTATATGGGGGGCACAGAACCCCTCAGTGACTG
CTAATATCCTTATCATTTACAGTAGGGGGTACATTATCCCTTATAATACATGAGTGATAC
TCAGAGTTCCCTGTATAACTCAGCCTGCAGCCTTGTGCCTTTATATGGGGGGCACAGAAC
CCCTCAGTGACTGCTAATATCCTTATCATTTACAGTAGGGGGTACATTATCCCTTATAAT
ACATGAGTGATACTCAGAGTTCCCTGTATAACTCAGCCTGCAGCCTTGTGCCTTTATATG
GGGGGCACAGAACCCCTCAGTGACTGCTAATATCCTTATCATTTACAGTAGGGGGTACAT
TATTGACCACATAACACAGAAGGGGAGCCCCATAAAATGAAGCAATATATCTGTTCACTC
AGTAGGAGTCGCACTGATGTGGAACAGAAGGGGGTGGGTGCAGGGAAAGCCACACCCCAC
ATTACCTGACTTCCTGTATAAGTGAGTGGCAGCCGCAGGGACCAATGGGCTTGGGGCACA
GAATGGGTCTAACACTAAGCTGTTCCTTCAGCCCCCCAAGTGCTTTATTGAGCCTATTGG
GCCCTGTCTAACCCAGTCCCATTCCCAGGGGCGCTGGTTCCGCTCACTCAGACATCCAAG
GAAGGTTACAGTCCAACAGCAGGAGAACTTTCTGGTAGAAACTGCGAATGACTGGAAACC
AATCATCACTGTGAGCCGGGGAACTGGGCTTTACCTTTCAGTGGCTGAAACTGACCTCCG
ATGATGTCAAGGAGCAGATCTACAAACTGGCCAAGAAGGGTCTGACCCCCTCCCAGATCG
GTGAGTTCTTTGGTTTTATCTTGCGCTGAACAGTGTCAAATAATTCTTTCCCCGGCTGAG
TTTGGGGCAAGTCTCTCCCCTCCCTGTGGGGCACTGAATATTTATGTAGCTGCACCTATA
CAGCTTGTTATAGGGAATATACCCCCCACTGTGTGACATGTGCTCAGTCAGTTGGGGGGG
GGGGGGGGGTAAGTAGAAAAGGGGCAGAAACACTGCCTGACCTGCCAGATATAAATATAC
CTGCGTTATTGTTACACACAGACCTGAGATTGATACTGACCCCCTTAGGCTCACAGTGTC
ATGCAGCCCTTCCCTCACCTTGTTCTATTGTGTAGTGATGGATTCTGGGAGTTGTAGTTC
CTCTGCTTTCCAGAGCTGCTGTCTTTTACACATTATGGAAACTTGAGGAACTTTAAGTCC
CAGATTCCATTGCTTTACAGTGGAACGAGGGGAGGGGTTGGCTGACGCTGTGAGCCTAAG
GGGGAAGGGAGTTGGTTCCAGTGAGCACAGACAATCTTGGTTTTCTTTCAGTCTGTGTAA
TAAAGACCCATATTTGATGTCAAAGCTGTATAAAGGGAAAATAAACCCTATTTTGAGTCA
GGTGTCCTATACCCTTAATGTATCCACCATTTGCTTCTGGGGGGGCTCGTTCAGCTTCCT
GCCCCCCCTGTAATTAGCCCTTCTCTCTAATCTAAAGGCACGGCCTTGTTTTCCCTGCCC
CCCCCGGGTGGGTATAGTGGGGGGTATCGTTGGGTTTGTACAAAGCACTTTGTGGGTGGA
GTCTCTCGCTTTAGCCCCTCCCCAGTTCTCCAGCTCACAGTGATGATTGGTTTCCAGTCA
TTCGCAGTTTCTACCAGAAAGTTCTCCTGCTGTTGGACTGTAACCTTCCTTGGATGTCTG
AGTGAGCGGAACCAGCGCCCCTGGGAATGTGGACCTGGTACCCCTTAATCCTTCTGACCG
CCCCCCCCATGTTTCTGCCCCCAGGTGTCATCCTCAGGGACTCACATGGTGTTGCCCAAG
TTCGCTTTGTGACTGGTAACAAGATCCTGAGGATCCTGAAGTCCAAGGGGTTGGCGCCCG
ATCTGCCCGAGGATCTGTACCACCTGATCAAGAAAGCCGTAGCCGTGCGTAAGCACCTCG
AGAGGAACAGGAAGGTAATTGGCTGCCGCCGGGCATTATCATTGGCTCCCAGTGTGGGGG
TTGGGTGGGTGTGTATAGTGGGGTGTAACCCCGCCCCCCAGCCCTGGGTGGTTCTGTACA
ATTGCCCCCTGCAGCTGTACTGCCTGCCCCACAGCACAGATACGGACTCCTCCTACTTGG
GAATTGAATCTCTTTCCAATGGGGGTGCACTTTGTGGGTGGAGTCTCTCGCTTTAGCCCC
TCCCCAGTTCCCCGGCTCACAGTGATGATTGGTTTCCAGTCATTCGCAGTTTCTACCAGA
AAGTTCTCCTGCTGTTGGACTGTAACCTTCCTTGGATGTCTGAGTGAGCGGAACCAGCGC
CCCTGGGAATGGGACTGGGTTAGACAGGGCCCAATAGGCTCAATAAAGCACTTGGGGGGC
TGAAGGAACAGCTTAGTGTTAGACCCATTCTGTGCCCCAAGCCCATTGGTCCCTGCGGCT
GCCACTCACTTATACAGGAAGTCAGGTAATGTGGGGTGTGGCTTTCCCTGCACCCACCCC
CTTCTGTTCCACATCAGTGCGACTCCTACTGAGTGAACAGATATATTGCTTCATTTTATG
GGGCTCCCCTTCTGTGTTATGTGGTCAATAATGTACCCCCTACTGTAAATGATAAGGATA
TTAGCAGTCACTGAGGGGTTCTGTGCCCCCCATATAAAGGCACAAGGCTGCAGGCTGAGT
TATACAGGGAACTCTGAGTATCACTCATGTATTATAAGGGATAATGTACCCCCTACTGTA
AATGATAAGGATATTAGCAGTCACTGAGGGGTTCTGTGCCCCCCATATAAAGGCACAAGG
CTGCAGGCTGAGTTATACAGGGAACTCTGAGTATCACTCATGTATTATAAGGGATAATGT
ACCCCCTACTGTAAATGATAAGGATATTAGCAGTCACTGAGGGGTTCTGTGCCCCCCATA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1079, 2064..2233
1001..1079, 2064..2233
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved