Xenopus_tropicalis Locus ENSXETG00000003912
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis ENSXETG00000003912
Xenopus_tropicalis
ENSXETG00000003912
scaffold_612
SNORA3
1468..1599
5767
CTGAAACTCACAGAGGTGTGAATGCTGTGGAGTTACATTGAAAGGATTACCAAAGTATC
ATGCAACTCTTCAAAACAGGTGTTACTTGTTAGTGGCATGAATGGATGTGTGAATAGTTC
TGAAACTGTCTTCTGTAGTGAAATGTCTTCAATGATTACCTAACAAGCCAAGTTGCTTTA
GATTTATTTATACTAGATATACCATGACCTGGATGAATGAAAATCTTCATAGATGTAATG
GATGGATCTGAGTTTGGTGGTGGAAGCTAGTTAGGTGGCTGCATCAGTAACTGCATCATT
GGTTTAGCCTCCGCCATTAAGTATTCCTTAATTTAATGTGTACTTAAAATGCTGAGACTA
GAGTCACATCTTGGCATTTCTGATTGCCTTGGTGTGCTAGAGTACTCGGAGATAAACTAC
TGGTCTTTATTCACTGTTTGGATGTCATTGTCTTCCAACCAGCCACCTGTTCAGTGACAA
GTTGATGAAGCAAAATGCAAACAAGAGTTTGTAGTAGTGACCACTGGTTGCTTCTTATTA
ATATCAGTGGGAGGTGCAATGAATGGTATTCATGCATATTTGTTGCATGAAGCAGGTAAT
TGCCTTCTGTGGAAGCTGAATAGTGCTACTGAGCTTTTTACATCTGCACTCTATAGATTT
GATGGTACATAACTAAGCACTAATTTAATTGGCTGTTACGCTAGAGTAGCACAATGCCTG
GCTTGGGCCAGGGCACTATTTGCAAGGACTTGTGTGCTCTGGTTTCTTCCTGCATGCCAA
AAACACAGGGCATGGTATCTGGCTCATGGTGAAATGTACCCTATTATATATTATGATTTT
AAGCTCTGATAGGGTGTTATAAGTTTTACATTTAGTGATAGCCTTAAACCTAGTGCTGTT
AATGAACATTGGAGTTACACTTGAAAATAAACGTTTTGCATATAAATGTTTATGCAGTTA
GTAAAATTGAAGTATCTGGGTCTTATTTGTATCTTTAATAGCCTTCCAAACTAAGAAAGA
CCAGGAAGCTACGTGGGCACGTGAGTCACGGCCATGGCCGAATCGGTAAGTAAAACATGT
GTATTATGATGTTCTTGGTTTTGTACAGCTACAGTGGAAAGGCTGAAACTTTGATTGCGG
CAGAGAGAATATTAGCCCCCTCGTTAATAGAATCATAAGGTGTTTTTCCCCTGGCCAGAC
TCTTAAAGGGAATAAAAATGCATCAGCATGGGAAGAATACCACAGCACCATTTACTTAAC
GCTCCAGGCAACAGTAGCACAGACTTAGGCTTGCACATCTGGAGTTAATTCTGCAAATGT
ACCTTTTCTGCCCATGTATGAGTCTGGGAAGGGTGTCCCAGAAATATAAGGAAAATGGTG
GCATTGCTTAAAGCAAAAATCCTTGTAGGGCATGAGTTTAGCTTGTGAACGATCTGCAGT
CCACCCTCCACAGTTGCTACTTTTTGTTCCCGAGACTAGAGTCACATCCTGACATTCCTT
ATTGTTTTGGTGTGCTAGAGTTCTCGGAGAGAAATTACTGATCTTTATTCACTGATTGGT
TCTCTATGTAGCTCAATCAGTCACCGGTTCAGTGACATGTGCCTAATACTTATGTTCTTA
TTCTGACCCATTTTCTCTAACTTTGATCAGCCCACAGAGCATTTCTTTGAATATTAATAT
AACCAGATTGGCCTGATCTAGCTGATAAGTTCTTGTCTTAAACGCCCTCTGTGTCTGAAC
CTGTTGATATCTAATTGAATTTTTTTAATCTGTGCAAAAGTATTTTCTGAATGCTTGTGG
TAAGGTTTAATTGTAGCAAAACTTTATGTAAGCTTAATGTGTTCATTATAAAGTTTAGAT
GTGTAATGGAGTGTCTATTTCCAGGCAAACACAGGAAGCACCCTGGTGGTCGTGGTAATG
CCGGTGGTATGCATCACCACAGAATCAACTTTGATAAATAGTAAGTGTTTTCTTATTTGT
GTGTAGTGGCAGAATGGTTTAGTTTTACAGTAAAAATGTAATGAAGGCTGCTGTTCCCAG
ACTACCTTCATTCACTCTAATGCATGAAGGCTGCTGTTCCCAGACTACCTTCATTCACTC
TAATGCATGGAGTGAACAGGTGCATGCTTATAGACATCCCTAGCCTCAGATCCAGTGATG
CAAAAAAGTGCTTGGCGGAAACTCCATACTCTACCTAGAAGCCATATGATTTTAATGGAA
TACATAAATGCTACTTTTTAGAGGGGGTGGTTCACCTTTAATTTAACTTTTACTATGTTA
TAGAATGACCAGGTCTAAGCAACTTGGTCTTTATTATTTATAGTTTTGTTTATAGATTAG
ATTTCAAATGGGGGTCACTGACCATATCAGTGTCTCATTCAAACCACTCACTGGCTGCTA
ACTTAATTTGAACCCTAGAAGACAGATAAAAGTTACTCCAAACTGGAGAGTTGCTGAACA
ATTATATGAATATTTAAAAAAAAAAAACTACAAATTGAAAATGAAGACCAATTGCAATTA
GCCTTAGAATATTACCTTCTACATCATACTAAAAGTTAACTCAAGGGAAAAAAAACCCTT
AATGGAATAAAGAGTTGCCACCAAGCACTTTTAATTGCCTCGTTAGAGTAAAAATAGCTA
TGGGCTGGCATGGTGTGAATATTAAGTTTTGAACTACAATTTCTAGATTTAATACTGCAT
TCCAATCAAATTAACCGGTTTTTGTTTTTTTTTTAAACTTGAGTAAATGCCCTTCTCTAA
TAAAATGCACCATTAGCATGTTTGACTTGGAAATTGATCTGTATAATCTTCAGATGGCTA
TAGCATGCACTCTGCTTACTGTTACATCTAATTACCTAGGTGATGGATTCCAAATAATTA
AAATTAAAAGGCATATTGACATGATTCAAATCTTACATGTTTTTCAAATTTTGGGAACTA
ATCACTTTGGATGTGGAAGAGGGTCTGCTTTCAGTCCTCTACAAAGGGGATTGTTGGCAA
GAACCCCTTTCTCTGCATTTAAAGTCGGGCTTGGCAGTCTGGACATCTGCTTTGCTAAAA
ATGCTTTGAAATAGTGTCTGGTACCTGATGTCCAAGAATGATATAAATTTAATCCTGCCT
TTGTATAGTTAAAACAATAAACTAAATAAATAAGCAGACCTCTTTTGGAAACCATTATGT
ATTTGGCACATTTGTCTACAATTATGGGGGTACTATAAAAGTTTGCAAGTCCTTTTTTTT
TTTTTTTTTTTCCAACACGCACTTTAAAGGACTACTGACTAGATATTCAGTTAAGGCATT
GTATGGGCCAATGCAAGTTTTTTACAAAAACTACAATATATTGATGCTATTGACACGTCA
CACTGTTCGCTAGGCAGGTAGACTTTTACCGAACCCTTTGTCTTATAATTTGAGCCATTA
AATCAAGTTATACGCAACAAGCAAACATCTGATACTTAACAGCTTGAGTTACTGGTTAGG
GTGGGAAAACAGCCACATACAAATCACTACCTCTACTTTATACTGAAACAGTGCAGCATA
TTTAGTGACGTCTCTTTTCTCACACTATATGATTTTAAGCTATCTAAAGGAGAAAAAGGT
TCCAAAACAGGGTTAGTGTGTTGAGCTGTGTAAAGGTTTTGTTTTGTGCTAAAGTAGAAT
TAACTTTTCTATTTTTACAGCCACCCTGGTTATTTTGGGAAAGTTGGTATGAGACATTAC
CATCTGAAAAAAAATCAATCTTTCTGTCCAACTATCAACTTGGATAAACTGTGGACTCTT
GTTAGTGAACAGACAAGGCTGAACCATGCAAAGAACCCTGAAGGCCCAGCACCAATCATC
AATGCTGTTCATGCTGTAAGAAATATTCCTTTTACATACAGGTTCACATATTATATTAGC
ATGAAATAAAATAGATGGCCATTCACAGCCCAGTCCAGTGCATGCTCTGAGCAATAATTC
AAGAGATGTGGATAAAGAAAAACTCACCAGCACACCCATGCTCCTCCAAAAAAACTTTTG
CCTGGTGCATCGTATCAGGAGGGAACGGCACCCTCCAATCCGAATTCAAACACAGCAAGG
CAGCTATAAGCAGGAAAACCTGCATGTTTATTTAGTGCAACACAGTAATGTTTTGGGGTG
ATGAAGGGGTTCACCCCGAAACGTTACTGTATTGCACTAAATAAACATGCAGGATTTCCT
GCTTATAACTTGCTGTGCCAGTATCCTTGGTGTTTCAATTTTTAGTCTGCTCATTTGTGA
TTTGTGTTCATGGCTAGTTTAAAGGGATACATTATCTGCAGTATTATGTAGACGGTGATA
TTAGAATTTAGCTTTGTTCAGCAGCTATCTGGTTGCTGTGGTCAAATTTACCCTAGCAAC
CAGACAATGGCTTCATAGATGAATATGAATAGTTGGCAGACTAAACTGGAAAAAAAAAAA
ACAAACAAATGTATCCTTACAGCAAGTCTCCACTGGTGTAAATGACACTGTAAGTAACTA
TGGCCTAAGCTACCCTAACTTAACTGTTAGTGGAAGAAGTAGTATTCACCAGATCAAGCT
AACAGCTACTGTAAATATAGTCTCTCAACTTTGTCTGCTTTGTTTGACTTGATTTAAATC
TAATATCCATTTCTTTCAGGGTTATTACAAGGTGTTGGGAAAAGGCAAGCTCCCTAAGCA
GCCAGTGATTGTGAAAGCAAAATTCTTCAGCAGAAAAGCAGAGGAGAAAATAAAGAGTGT
TGGCGGTGCTTGTGTGCTAGTTGCATAAACCTTTGTTCCAACAAAAAAATAAACATTTTG
TTCTTTACAACAATTGGTTTGTCGGCATCATCATTTGGTACAATTTGGTTGTCTGTTTAT
ATCTGAACATGTTTGCAAGGAAAATAAGACTTCAGATTCTCTGCACATTACATGAATATA
ACAGACATCAACATAAGATTCCGTTTATGCTAGGTGGCATTACCTTGTACATTACTTTAC
TCAAAGGTAAAATATCTTAAGCAGTATCTTCAATGCCCTAACAAGTTAAAAGAAAATAAA
TACTTTAAACATCCATAGCCACTGTGTCTATTACTAAATGCATCAATGGATTTTAAGTTA
CCATCAAGTACAAAATACTGTTATTAGAATAGAAGGAAATAAATGTTTTTTTTGCAAAGG
ACTGGGAGTTGGGCTTCTTTAGCTATCTGGGTTAGACAGTCCATAATTATTGCATTCTTT
TCATTATTCAAAGGGTGAACACCAAAAATAGATATGAAAGTATTCTGTTTTATGTAGGAG
TGCATCACATCATGGATGCCTTAGTCTTTCCATGGGCTTTCATTTCTTTGTATATTTCCT
CAGTCCTTGTTATCAGATGTGTCCTCATTGCAAATGTTTTTGCCAAATGTGATCCTGGGG
CAGCATTGCATACCAAATTCAAATAGTTTTGGAGGGCACACAACAATTGCTAAAGCAAAA
ATAGCTGGCTTTAAAACAGACAGCAAAAAGAAAAATGGTGCAAATGAGAATCCCCTTGAC
AAAGGACTGTTCCGAAACGTTGGGGTTTTCTCAATCCACATGTCTGCTTTTTCTGTATAT
TGCATTTTGTCCAACTGGTGGTATGTATATTATGCATTATAATTGTATTTACTGTTCTGT
GGATTTTTTCCATAAAAAGAGCATTATATGTTAATCATACCATTTGCTGCCTTTTGTGGT
AGTAGGTATGCATTGAGTAATTGATTTTGCAGCATTGCATACCTGCCATATAGACAATAT
ATACATTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1064, 1884..1959, 3680..3854, 4639..4767
1001..1064, 1884..1959, 3680..3854, 4639..4764
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved