Xenopus_tropicalis Locus ENSXETG00000010241
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis ENSXETG00000010241
Xenopus_tropicalis
ENSXETG00000010241
scaffold_605
SNORA19
13260..13386
19866
AAGGCCACAACACTGGAATTATGAAGAAAACACTGCATTGTGGGTAAGCAACATGGCAA
CTTGAAATTACTACATCTACTACAGTTAAGATAAAGAAAAAAAGAAGAGAAACTAAACCC
TGTGCACCCTGGATCAGACTCCAAACAATAACTCAGGAGTCCCAGCACATTGTTACCGAG
AGAAAATGGCCCCTGATCCCATTAAATTAGCCCCCAACACAGGAGGCACCCTGGACTGAG
TACAGGATCAGGTCACCAGTCACATATTTTCTCCCCTGCACTAGAGGGCGCTGTACGTGC
CGTATCTGTACCTCTATGGGCTGCTAATGCCCTGGCACACAGATCCACACTGTCTCACAA
CTTCACCTCAATAATAGATCCCAAGTGATTAACACAGAAGTGGCATATAGATTTATGTTT
TGCTGAAGGGGGCAATACCAGAATCTTCAATTAAATTCAACACTATGGGGATCACGGGTT
ACTCCTGAGGGGACTGGGGCTAAGACAGTGGGTCAGTGGCACCCTGATTGGTTCTGGGGC
AAGAACAAGGGACCAGGGCTTACTCCTGAGGGGACTGGGTCAAGAACCAGATATCAGGGG
GCAGTCTTGAGAGGCCTAGGGCAAGGACAATGGGAATTGAACCCTTATAAATCCAAATGG
GCTGGGCCAACCCTTATGGGTCCTGAGGCAAGAACTAGGAGAAGGGGGTGATGGGTAACC
CTATTTGGTTGTGGGGCAAGGCATCATGTGACAGTGCTGTGAGAGCTGATGTGAGTAGAG
GGATAAGGGGATACTGCTGAAGGGCCAAGGTAAGGGGTGAGTGTGCCCTACTGGCGGTGC
CCCACAGCGCCCCTTTCCTACAGGGGCCAGTAATACACGGTTCAGCCCCAGTTTGCCTGT
AGCACCCAGTGCGCATGTGCGCACAAAGCGACGTCGGCTCTACGCGCACCGGAAGTGGCC
GTGCGTCGGCTTTCCCTCCCCCTCACTCTCTTTCTCTGGCGTGGCGGACATGCTGCAGCT
GCACTAACCGGGCCCGCCATTACCCGCCGCAATGCCGGCCTACTTCCAGCGCCCAGAGAA
CGCCCTCAAGCGGGCTAACGGTGAGTAGGCAGCCGGGGTCTCTCTGGGCTCCGGGTGTTT
CTGGTCCGGGGCGCCGGGAGGCTCCCCTGGGTACGGCGTGGGGGCGCTATGGCTGTCACT
GCGGGGCCGGGCATATGGGGAGGCCGCAGGGCCTTGTTCCGAACGTACCGCCGGCTATGC
ACTTATTCCCCCGGCCTGCCCCTGTGTGTGCGGCCTTCTCTTTCCCACAAGGCCTAGCGT
AATGCCGGGGCCTCATTGGCCTGGTACAACCCTGTGACTCCGCAACCCCAGGCCCCGTGT
GAGCAGCCCTGCATTGGTCTCTCAGTCCCGGGGATGTGCGAGCAGCCTTTTATGTGACTA
CTACCTCCTGGCCCAGGGCCCTGACCCGGTGCTGCTCTGTTTGGGCTTCCTAAACCCAGG
GCCTGTCCGTGTCTGTATGTGCCCCCCCACCCCAGGGCCTGTGCCAGCTGGTCTGTATGT
GCCCCCCAACCCCAGGGCCTGTGCCAGCTGGTCTGTATGTGCCCCCAACCCCAGGGCCTG
TGCCAGCTGGTCTGTATGTGCCCCCCAACCCCAGGGCCTGTGCCAGCTGGTCTGTATGTG
CCCCCCAACCCCATGGCCTGTGCCAGCTGGTCTGTATGTGCCCCAACCCCATGGCCTGTG
CCAGCTGGTCTGTATGTGCCCCCCAACCCCATGGCCTGTGCCAGCTTCTCTGTATGTGCC
CCCAACCCCAGGGCCTGTGCCAGCTGGTCTGTATGTGCCCCCCAACCCCATGGCCTGTGC
CAGCTGGTCTGTATGTGCCCCCCAACCCCAGGGCCTGTGCCAGCTGGTCTGTATGTGCCC
CCCAACCCCAGGGCCTGTGCCAGCTGCTCTGTATGTGCCCCCCAACCCCAGGGCCTGTGC
CAGCTGGTCTGTATGTGCCCCCCAACCCCAGGGCCTGTGCCAGCTGCTCTGTATGTGCCC
CCCAACCCCAGGGCCTGTGCCAGCTGCTCTGTATGTGCCCCCCAACCCCAGGGCCTGTGC
CAGCTGCTCTGTATGTGCCCCCCAACCCCAGGGCCTGTGCCAGCTGCTCTGTATGTGCCC
CCCAACCCCATGGCCTGTGCCAGCTGGTCTGTATGTGCCCCCCAACCCCATGGCCTGTGC
CAGCTGGTCTGTATGTGCCCCAACCCCATGGCCTGTGCCAGCTGGTCTGTATGTGCCCCC
CAACCCCAGGGCCTGTGCCAGCTGCTCTGTATGTGCCCCCAACCCCAGGGCCTGTGCCAG
CTGGTCTGTATGTGCCCCCCAACCCCATGGCCTGTGCCAGCTTATCTGTATGTGCCCCCC
AACCCCATGGCCTGTGCCAGCTGTTTTGTATGTGCCCCCCAACCCCATGGCCTGTGCCAG
CTGGTCTGTATGTGCCCCCAACCCCATGGCCTGTGCCAGCTGGTCTGTATGTGCCCCCAA
CCCCATGGCCTGTGCCAGCTGCTCTGTATGTGCCCAACCCCATGGCCTGTGCCAGCTGGT
ATGTATGTGCCCCCAACCCCATGGCCTGTGCCAGCTGCTCTGTATGTGCCCCCAACCCCA
GGGCCTGTGCCAGCTGGTCTGTATGTGCCCCCAACCCCATGGCCTGTGCCAGCTGGTCTG
TATGTGCCCCCCAACCCCATGGCCTGTGCCAGCTGGTCTGTATGTGCCCCCAACCCCATG
GCCTGTGCCAGCTGGTCTGTGTCTCTTACCAACCGCTGAACTGACCTGTGCTGCTTTCTG
TGTCGTTCCCAACAATAAGGCCAGTGCCAGCAGATCTCTCCGTGCCCACGGGCCAATGTA
GCGCCTTTTCCTGTGTCACCGGGGAATCATCATTATTATTAAACTCCTATTTATAAAGTG
ATTTCTTGATTACCCCATACCTGTACCATATTGACTGGTATCATAAGGCCTTAGAAACTT
AGCTCAGTAATACTCAGTACTGGCACAGTGGGACATTGGGAGATGCCTGGACCTTGGAAC
TTCTCTCTGCCAGACGTGGAGACTGAGCAAACACATTGGCAGCTAGTTGTGCCCATAGGA
AGGGGGAGTATATTTTTACAAAGGGGATTTATCTCCTCTAGTTTAGTTTTAAACTATTTA
TAAATGATTAAAGGACAAGTCAACCCAAAAAATATTTTGTGCCTAATAACCGAAAACCTC
ATTCCAAGCAACTTTTCAATAAACATACATTACAAAGTTATTTGTATATATATATAATTG
CTATTAGAAGCAGTGTTTGCCTGTCCTTTTCTATTCCCTGCTATTGGAAAGTTGCTTGGC
ATTGTTTTCTTTTATTAGGTAAATATTTCTGGTGTTGACATGGCCTTTAACCCCTGGTGG
ATTTGGTCTTCCTCCCAGTGCCCTAAGTTATAATTAGAAGCTCTTATTAGGGTAGATAGC
ATGCTGTACTGTATGGGGCCAGTAATGCTTTTCTGGAACAATCTGAGCAGCAACTTGTAA
ACAGATCTGCCTTGGGTTATGTTTGCTGCTAGTTGTGACTGCGTACAGACTCCCAGGTAT
GGAGTCATGAGTCGGGCAGTAACTGAGCCAGGCTGGGACTCCATGGTTTGGGCCGATTGG
CCTTCCGGCTTAGTATGGATACAGTGTGGTTGGGCGCATTCTGATGGGGCATTAGTTGGG
TTTGAAACGTGCAGAGTTACCCCTGACTTAAGGTATGGAGATCCGACTTACAGAAAGACC
CCATATCTGTAAAACGACAGGTCTCCAGCATTCTGCATAACAGGTCCCACACCTGTACTG
ATTTGTTGGTTGCTGTTGGAAGTTGCAGTCAGTCTGTGGGTGACTTTCCACCCAATCAAA
CACATCTGCCTGGCCGCCGGGGGGGGGGCTTAGTATTAAGAGAGGTCCCAGGCAAATTTT
CTAATTGTTCTTATAAATAATGTTATTTGTATTGGTACTTCATTCAGTACTGCAACATTA
CCCCCCCCCCCCCCCCCCGTGCTTCTGCTTTGTCCGTCACCCCCCATTCACTGGCCCCTA
TACATATATATTGCTGACTGTGTAGCAGTCACCAGGCCGCTGGTTGGGTTTTTCCTGAGC
TCAGCTTCATATTGTACTTCCCCCATCATAGGCCATTGGCCCCAGCTGTGCTCTCTAGCA
ATGCAGCTGCAATCTTTAAAGGACAAGTCAACACAAAATATACATTTTTGCTTAATAAAA
GAAAACATAATTCTAAGCAACTTTGCAATATACATTTATTAAAATTTGCCAATGTTTTTT
TTTTTTTTTTTTAACTTTAACACAAGGCAGCAGCCTGACAGACCTATGTTGCTGGAGGAG
AACAACCTTTGCAACATTGTTTAAAAAGTAACCGCCAGAAGGTCAGCAAATGCTTTCAAT
AGCAATTGCTATCGAACCCCCATTATCCAGAAAGTTTCGAATTACAGAAAGGCCATCTCC
CATAGATTCCATTGTAATCAAATAATTCACATTTTTAAAAATGATTTGCTTTTCTCTGTA
ATAATAAAACAGTACCTGTACTTGATCCCAACTAAGGTATAATTACCCCTTATTGGGGGC
AGAACAGCCCTATTGGGTTTATTTAATGGTTAAATGATTCCCTTTTCTCTGTAATAATAA
AACATTATCCAGAAAGTTTCCCAACTAAGATAGGCCATCTCCCATTATTGGGGCAGACCA
AATAATTCACATTTTTAAAAATGATTTGCTTTTCTCTGTAATAATAAAACAGTACCTGTA
CTTGATCCCAACTAAGATATAATTACCCCTTATTGGGGGCAGAACAGCCCTATTGGGTTT
ATTTAATGGTTAAATGATTCCCTTTTCTCTGTAATAATAAAACAGTACCTGTACTTGATC
CCAACTAAGATATAATTACCCCTTATTGGGGGCAGAACAGCCCTATTGGGTTTATTTCAT
GGTTAAATGATTCCCTTTTCTCTGTAATAATAAAACAGTACCTGTACTTGATCCCAACTA
AGATATAATTACCCCTTATTGGGGCAGAACAGCCCTATTGGGTTTATTTCATGGTTAAAT
GATTCCCTTTTCTCTGTAATAATAAAACAGTACCTGTACTTGATCCCAACTAATAAGAAA
TTTTCAACATTTTGAATAAATTCACATTGGAAAGTTGCCTGGAATTATGTTTTCTTTTAT
TAGGCAAAAAATTGTTTTAGGGTTGATATGTCCATTAACAAATGAATGACATTTTAAAGG
GGAAACAGGTTTTTGTTTCCACGTTAGCAGCTTTGGCAAAGTATATTTGGTTGCATTATG
CAGCCGGCTACACCCCAGAGGGGAAATTACGGTATCTGCAGTAATGTATGTACCCTTTGG
CTTTCAGCAGAATATTTGTTTGCCCTCTATAGTTTTCATTCCCTCCCCATAGATACAGAG
GGTACCTTACCAAGTGTTTGGACCTAAAGGTCCCCATACACGGGCCGATAGTAGCTGCCG
ATATGGGTCCCTTAAGGTGGCCATACACGAGGCGATTTCGCTCGTTGTGCGATGAACGAT
TATATCGACAAACGATCGTATGGCGATCGAGTTCCCATACGATATGCCATCCACGGGCAA
CGATAATTCGGGAAAGATTTTGTCGCATCATTATCGTAAAATACCTACGATCGTACATCT
ACGTACGATCGATGTCGTTGACTTCCGCTGCTGGCAATCGTGACATGCGCAGAGAACAAT
CGTTGAAAGACAAATGTCTGACACTCACACCAACTGGCAGATTTTATCGTTTAACGACCA
AAATTTTTAAACCTGGCCGATCGATTTTGGGGACGATAATGTCGGCTCGTTTAGTGGGCC
GACGATCGTTCGTACACCACCAACTATACGATAACTTAACGATAGCATCGGATCGTTCGG
GAATCGGTCGTTTGTAAGTAAAAAATCGGTCCGTGTATGGCCACCTTTAGACTGATTCGA
CTGCTTTACACTGGCCCCAAAGGAAAACAATGTGTGTAAACTTTTAAATGTGTTTTTATT
TATTTTTTTGTAATTTGTCTTGTGTCCCCCTACCCCACAGAGTTCCTTGAGGTTGGTAAG
AAGCAACCAGCCCTTGACGTTTTATACGACGTGATAAAGAGCAAAAAGCACCGAACATGG
CAGAAAATTCACGAGCCGATTATGCTCAAGTACCTGGAGCTCTGCGTGGATCTGCGCAAG
AGTCACCTGGCCAAGGAGGGCCTGTACCAGTACAAGAACATCTGCCAGCAGGTATGGGGT
ACCAACCGTACAGAGGGGCCCCGGGGCATTTGGAACCGCACACTGTCAGCCTCTCAGTGA
GCAACACTCCTTTCTGCCCTGTAGGTTAACATCAAGTCATTAGAAGATGTCGTTCGCGCT
TACCTTAAGCTGGCCGAGGAGAGGACGGAAGCGGCGAAAGAGTCTTCTCAGCAGATGGTG
TTGGACATTGAAGATCTTGATAATATTCAGACTCCTGAAAGGTAAATGAGAGTTTTCATA
TCAGTTTGGGGAGCACAGGAAAACTGCTGTAAAGAGCTCCTCCCACTTGGAGGCAGGACA
CACCCACCTATGTAAGGTCAGCTTTCCAGATGGTAAAACAAAGAGGTGTTATTATTGGGG
ATCCCATACCCATTATAAAAGCATTTAAAAGGGGTTCTGTGCAGTCTCAGTGTAAGCAAT
AGGTAGTCATTTGGATCTTTGTTCCTTAGTGTTCTGCTGAGCGCTGTTAGCGGTGAGGAC
ACTCAGGACCGTACGGATCGGCTGCTTCTGACTCCTTGGGTGAAGTTCCTTTGGGAGTCA
TACAGACAGTGCTTGGACCTGCTCAGGAACAACTCCAAAGTAGAGCGTCTTTACCATGAC
ATTGCTCAGCAAGGTAATTGGTTTGTCAGTTATATTTTGATTAAAACAAAAATACTGCCT
CACATTGTTCTGTACCTGCCTCATTGTGAGTCCCTCCCACCCTTCAGAACGTGCTGCCAT
ATAGATATAATGCTTTTCTCCGCAGCCTTCAAGTTCTGTCTGCTCTACACCCGAAAAGCC
GAGTTCCGCAAGCTGTGCGACAATCTCCGGATGCATCTGAGCCAGATCCAGCGCCACCAT
AACCAGAGCACTGCCATTAACCTGAACAACCCCGAGAGCCAGTCCATGCACTTGGAAACC
AGGCTGGTTCAGCTGGACAGTGCCATCAGTATGGAGCTCTGGCAGGTACGTACAGCTGGG
ATTAACTATAAGAATGCTGAGCTCTCATTGGTGCAGTTAATTCTCATTTAAATTCCCCCA
GAGAAATCCATAATCAAACTTTTAAGGCCTCATTTGTTGTGTATCTGCCCAAGGTTAAAT
ACAGGGCCAGCTCTTCTCCAGGCTCTTTCCTTTTTATATTAATTATAGTTACCCGACATA
GGTTCTTACCAGTCTACTTAATTCTCCTTAAAAGAGTCACTGATGGCATTCTTCTATACT
TTGTTGCTAGTATCTGTGACCCTAGCAACCTGATCAGTTTAATGCCATTTGAGAACCTAG
CAATCAAAATGGAATCGGGTGAAAATATGATGCAACGAATCCACTATCCAGGCTGGCCGA
ACCCCAATCCTTTGTGAAAGATTTGGTTGAATACTGAACTGAATGGGAATCCTTCAGAAG
GAAGGGTTAAAGACAACTGTGATATTTTCAATTTCCGAGTTTGTGACAGAAGCTAGAAGC
ATGAATTTGGCCGAACCGTATCCTGAATTCGGTGCAACCCTAATGATTATTTGTAGCTGC
CTTCAACGTGTTACATATTTTTACTTTGAATTGGATTCAATTTTATAGGATGTGGAAGAC
AGTCATTTTTTAAACCACTTTTTAATTTATTTCCTTTGCCCTTTGCTCTTCTTTCTAAAT
AAACATTCATCTACTGAACCAACAACTTGTCTCATTGACCCTTTACAGGAAGCCTTCAAA
GCTGTTGAGGATATACACGGGCTTTTCGCCTTATCTAAGAAGCCTCCAAAACCCCAGCTG
ATGGCAAATTATTACAATAAAGTCTCCACGGTGTTCTGGAAGTCCGGAAACACACTGTTC
CACGCCTCCACCCTGCACCGACTGTATCACCTCTCCCGGGAAATGAGAAAGAATCTGACC
CAAGAGGAAATGCAGAGGTGGGTAACTGTGCTCCAAGCGCAGTTCAGTTAAATCACTGAA
TTAACAAATTAAATGAGCAACTTTTGGCACTCAGTCAATTATTTCTTTTTTCTTTCTGGC
TTTTCTTTAAACTGTCCTGCCTTACTCTGTGCCGCCCTTTTTGGCGGCAGATGGTGCTCT
GTGATTAGCCCTCTGCATGAATTTGCAACTTTTCCCTCCATTCATGCTTTGTGCTGCCCA
TTGATATACACAGACTCTTGCTATCATACTTCATGAAATATTTCCCAAGACATTAAAAAC
TATAGCCATAATGTCAATTGAGGGGGTTTATAGTTAAAGGGTAACTGCACCCAACCACTT
TTCAATAATAAGATATAATTCTCATGTTTCTATTATACTAATATACACTGGTTGAAAGTT
ATTTGTAATAATGGAATTGCCGGTAAAATGTATTGAAATGTTTATATTCTCGGCACTGCC
GGGCTGGTTGTGACCAAGAAGTGAAGTGACATTGGTTTAAGCCCCTAGCTTGTCCCTCTC
GCAGGGAAGTGGCTGTAAGGTTGGGTCTGTGTAACACCAGGAGCATTTTTGGGCCCCAGG
CTACTCTGAGGCAGCCCTCCTGATACATATATATAGATATATAGATAGAGAGAGATATAG
ATAGAGAGAGATATAGATAGAGAGAGATATAGATAGAGAGAGATATAGATAGAGAGAGAT
ATAGATAGAGAGAGATATAGATAGAGAGAGATATAGATAGAGAGAGATATAGATAGAGAG
AGATATAGATAGAGAGAGATTGATACAGAGACAGTTTGCAATTGGTCATCATTTTTTTTT
ATTTTTTATGGTGTATCCGTTATTTAGCTTTTTGTTCAGCAGATCTCCATTTGGTATTTT
AGCAGCTGTCTGGTTGCTAGGGTCTTTTTTTATCCTAGCAGCCAGGCGGGGGTTTAAACA
AGGGATGGCAATATGAATAGTAGAGGACCTGCACTGAAAGAGAAGTAATAAAAAGTAACA
ATAACAATAAAAATGTAGCCATAAAGAGCAATACTTTTTGGCTGCCGGGGTCACTGACAG
CTGGAAAGAGGCAGAAGAGAAAGGCAAATCATTCGAAAACTATAAAAAATAATGAAAACA
AAGTTGCTGGGAATAGGGCATTCTATAACATACTGAAAGATAACGTAAAGGTGAACCACC
CCTTTAAGTGAATGGGTAGGCAGGGAAGAGCCATTTCCCTTTGTGCCCGGCAGGGCAGCT
TTCCATACGGCACTTTTCAATGTCTCTCTGCCATTTGCGGTGGAAGTAGAGATACTTGTT
ATGTGCAACATGAAAAGAGAAGGAAAATTAGCAGCTTGACTTATTAGTGGTCATCGCTGT
CAGTCACCTTCAGACACCATTATGAGTTGCCCATATAGTCGGGTATTCATTTGGCCAAGG
TGCCCAGTTTCATACATTGTGAGCAAAAGTCCCTACGATAATGGTTTGAGGCCAAAGGAC
ACAGGTTGTTTCTCAGGGTGCTGCAGAGTTATATTTATTATAATAATAATAATAATAATA
AAAATATATATATTTTTTAACCCTATAGGATGTCTACGAGGGTCCTGCTGGCTACTCTTT
CCATCCCCATAACCCCCGAGCGCACCGATATCGCTCGTCTCCTGGATATGGACGGTATCA
TTCTAGAGAAACAGCGGCGCTTGGCTACTTTGCTAGGACTGCAAGCTCCTCCCACTCGCG
TCGGACTGATTAACGATATGGTAAGTTCTACTCCCATTGCCACAGGGCAGCTATGGAACA
CTAAAGCCAAAGTGATGAACTTTATTTTACTAATGTTCACTTGCCTCTTTTCAGGTGCGG
TTTAATATGCTGCAGTACGTGGTTCCCGAGGTGAAGGAGTTGTACAACTGGTTGGAAATG
GATTTCCACCCACTCAAACTCTGCACCCGCGTCACCAAGGTGGGGAGGACTTTTTCCAAA
ATATCAGCCTGCTCGTTACTAATTTAAAGATTAGGGCTACGTAACCTTTCTGTTTAGTGT
AATTGCTTTAGAACTAAAAGGCGAGTAAGGGAAAATGCCCTCTGACAGCCACTGCTTGTG
GCACTCAGCCCCTTCCACTAATCAGTTGGGTCTGTTTCAAGGGCATTTGCTGGGCTGTGT
TGCAACAGTTCAGAGAACACAAGCGCCCCTTGTGGTGGACAGTCCATATGTTTGGAACCA
TATTTTTAAGAGCACTTGTTTCATAGACAGCCCCCACACAGAAACCCTTTGTGTAAACAG
GTACAGGTATGGAACCTGTTATCCAGAATGCTCGGGACCTGGTGTTTTCTGGGTAAGGGA
TCTTTCCGAAATTTGGATCTCTATAACTTGTCTGCTAAAAATCATTTAACCATGAAATAA
ACCCAATAGGAGTGTTCTGCCCCCAATAAGGGGTAATTATATCTTAGTTGGGATCAAGTA
CAGGTACTGTTTTATTATTACTGAGAAAAGGGAATCATTTAACCATGAAATAAACCCAAT
AGGGCTGTTCTGCCCCCAATAAGGGGTAATTATATCTTAGTTGGGATCAAGTACAGGTAC
TGTTTTATTATTACAGAGAAAAGGGAATCATTTAACCATTAAATAAACCCAATAGGGCTG
TTCTGCCCCAATAAGGGGTAATTATATCATAGTTGGGATCAAGAACATGCCTTCCGAGCA
AATCCGGAACCAGCTGACTGCAATGTCTTTCCAAGGCTGTAGGCGCCATTAAACATGCTC
ACGTGCTGGTGAGTGTTTGCAGCTGGCATGTGTATTATATCCAAACCCTAGGGATCTGCA
TTGGTTTTGTTGTATAATATGAGCTGCACATTTCATTGACACACTCCCAGTATTGTGATG
AGCCGTGTTATTTCTAATGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGTTGGGATCAAGTACAGGTACTGTTTTATTATTACAGAGAAAAGGGAAT
CATTTAACCATTAAACCCAATAGGGCTGTTCTGCCCCAATAAGGGGTAATTATATCTTAG
TTGGGATCAAGTACAGGTACTGTTTTATTATTACAGAGAAAAGGGAATCATTTAACCATT
AAACCCAATAGGGCTGTTCTGCCCCAATAAGGGGTAATTATATCTTAGTTGGGATCAAGT
ACAGGTACTGTTTTATTATTACAGAGAAAAGGGAATCATTTAACCATTAAATAAACCCAA
TAGGGCTGTTCTGCCCCAATAAGGGGTAATTAGATCTTAGTTGGGATCAAGTACAGATAT
TATAACAGGGAAGAAAGGAAATCATTTTTGTAAAAATTAGAATTATTTGCTTATAATGGT
GTCTATGGGGGATGGCCTTTCTGTAATTTGGAACTTTTTGGATAAAGGCTTTCCAGATAA
GATAACCCCATACCTGTAGTATCTTTTATTATTAAGCTGTTTAATGTTACTTCCCCTTAA
ATGTTTTTAAATGTTAATGGCTTTCTGAATGCCAGTTCTTCAGTTATTAACCCGCACTTG
TAAAATGTTTTATCCGGTTGATAGGTGTTGGACTGGGTAAAAGAACAAGCCGAGAAAGAG
CCTGAGCTGCAGCAGTATGTCCCTCAGCTACAGAGCAACACCATTCTGCGCCTTCTGCAG
CAGGTAACCATCTGCTCACGTGCCCATTCTCTCCAACCATTAAAAAATAAGAGATGGGCA
TAGTGTGTAATATATATATATATATATAATTATGGTAAGTGTGTCTTCGAGTTGGCAGTT
TTCCCATTCTTATTCCTTTGTATCTGACTTTAAGGTGGCACAGCTCTATCAGACCATCGA
GTTCTCCCGGCTCGCCTCCCTCGTGCCCTTTGTGGATGCCTTTTTGCTGGAGCGTGCCAT
TGTGGATGCTGCAAGGCACTGCGATTTGCAAGTAAGTGATTTTATTTTGGCAAGGGGAGT
GACCACTTACAGAATAACAACACTTATTTTCTAATTCATCCTTTTCTTGACCTCCATCAT
GGTGGTTTTATGGTATTGTATGGCCTTATGCATTGAATATTAAAGGGGTTGTTCACCTTT
TTAAAGGTGATCATATGATGTAGACAATATGCAATTGGTCTTCATTTATTTTTCTTCAAT
TATTTAGCTTTTTGTTCAGCAGCTCCCCATTTGGTATTTTAGCAGCTATCTGGTTGCTAG
GGTCTTTGTTACCCTAGCAACCAGGCAGTGGATTAAGCGAGAGATGGGAATATGAATAGT
AGAGTGCCTGCATAGAAAGAGAGGTAACAATAGTACAGTTGTAGCCTCACAGAGCAGTAG
TTTTTGGCTGCCAGGGTCCGTGACCCCCGTTTGATGCTGGAAAGAGGCAAAATAAATGAA
ATCATTTAAAAACGATACAAAAAAAATAATGAAAACCAATTGCAGAGTTGCTAGGAATAG
GGCATTCTATAACATACTAAACTGATGAACCACCCCTTTAAGTGCACATTTCATTGACTT
GCTCCCTGTACTGTGCAGAGTGAAGTTATTTCTTATGTGCTAAATGAAAATGAAGGCTAA
TTAGCAGTGTAACTAAATACAGGTAGTTACTGCTGCCAGTCCCCTTCAGACATGCTCCTG
AAACTCTGTTCCTGGCAGAGCTCTATACGGTTTCTCTGGGTAAGCACACCACATTTATAG
GTTGGGGAAGCCACGTTTAATAGGGTTTATACAATAACAAGCTTGTGATTCCTGGATATG
TGATTGGTCAGTATAATGTACCTGTACATAGTAGTGCGGTTGCTCTAAGTGCCATTGAAT
TTCAACAATATTCACACAAGCCAATGTTTGTTTTTCAGGTGCGTATAGATCACTCTTCTC
GTACGCTAAGCTTCGGGTCGGATTTGAATTATTCCACGCGGGAGGATGCACCCTTCGGGC
CGTTCCTGCAGAACATGCCTTCCGAGCAAATCCGGAACCAGCTGACTGCAATGTCTTGCG
TCCTTTCCAAGGCTGTAGGCGCCATTAAACCTGCTCACGTGCTGGTGAGTGTTTGCGCCT
GGGATGTGTGTTATATCCAAACCCTAGGGATCTCTAGGTTTTGTTGAATAATAATATGAG
CTGCACATTTCATTGACACACTCCTAGAATTGTGATGAGCCGTGTTATTTCTAATGTGCT
AAATCAATAGGAGGCTAATTAGCAGTGTAACGGAATTGTTACCACTGCCAGTCCCCTTCT
CACAGCCGACTATTACTAGCCGGGCAGGTCTGTTATTTGTAGTCTGGTTACCTCCTCAAT
GAGAGCTGCCCTACTGTTTGCCCCTAGCAGCGCTTCTGTGAAAATTCACAGGGGCATAAC
TGCTTTGCTTAGGCACACTGAGGTAGTTTGTGCTCTTAATCTGCTTTCATGCTCTGCTGG
TCCTTATTGCCCACAGAACTGATATTGCAGCCTGCAGTTGGTAAAGAGTACTAGACTGAC
AGTCCGTGGATAAGGAAAGCAATATGGCAGCTATAGATGTCAATAGAAAACTTTATTTGA
AGTTTTCTCTTTCTACCAAATGTCTTATTCTAAAAAAAGATCTCCACTTAATGCGCCTTA
AATATTCTCTTTCAGCAAGAGAAGGAGGAACAGCACCAGATCGCTATCACGGCCTACCAG
AAGAACTCCCGGAAGGAACACCAGCGCATCCTCGCCCGTCGCCAGACTATAGAAGAGCGT
AAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGATC
AGCAGAAAATGGGAAGGGAGCAAGATAGCAGCTCCCAGTAGGTATCAGAATAGCACTCAA
TAGAAAGAAATCCAAGTCCGGCTTTGGACTCCTCCAGTTACATGGGAGTAGGAGAAACAA
TAGGTTAGCTGAAAGCAGTGCTAATGTGTAGCGCTGGCTGAAAGCTCAGACTCAGGCACA
CTTTACTGCTGTGCTGCAAGTTGGAGTGATATCCCCCCCCCCTCACCCCCAGCAGCCGAT
CAGCAGAACAATGGGAAGGGAGCAAGATAGCAGCTCCCAGTAGGTATCAGAATAGCACTC
AATAGTAAGAAATCCAAGTCCGGCTTGGGACTCCTCCAGTTACATGGGAGTAGGAGAAAC
AATAGGTTAGCTGAAAGCAGTTCTAATGTGTAGCGCTGGCTGAAAGCTTAGGCACAATGC
ACTGAGATGGCGCCTACACACCAATATTACAGCTACAAATACATTTATTGGTTCAAGAAT
AAAAGTTTAAATGCTATTTGCTATGTCAACAGTGCAATTTAGAAATAAAAAGTAGCCCAT
AAATATCATGACAGAAGCACAACTCCTCTGGTGCTGAAGGGTCATAGGCCAGGTTATCCT
CCTCCATTTATAGAATGGGTTCTTACAAAGGCTGGGGCCCCATTGTTATTTAACATATCC
CAGTTCTCTGAAGCGGAAACTTCCATTCTCTAAATACCTCTCTTCTCTACAATTTAATTC
TTCACAGAATCTTGAAGAACTGGATCCAGACTTCATTATGGCTAAACAGGTGGAGCAGTT
GGAGAAGGAAAAGAAAGAGTTACAAGAACGTCTGAAGAATCAGGAAAAGAAGGTGGGTTC
CGTTTCACCTTAGTAGGCTAATGTGGATATGCCCACCCCCTTAAAATATTGCTGCGGGCT
TATTGGATTCTCTGGCTTATTCCCACAAAGATAGTTTGATGGTCAGTGTTTCTGCTTTTA
TTATGATCAATGTGTTTGGTCCGGACGTGCCCATGATTAAAGCTGACATAGGGTTGCTAT
GGAGGTTCACCCTGACAGCAGCCCCGTAAAGCTTTTTTTTCCTTATTACCCTGATCCTGC
AATATTGTAGCCAGTGTTGTAAGCCAGTGAGACTCTAGCTGCCCAATGACAAGCAGGCTT
ATTTAACTCCAGGTTGGACTCTCATGTTTCTGCTATAGATTGACTACTTCGAAAGAGCAA
AACGCTTGGAAGAGATTCCCCTGCTGAAGAAAGCTTATGAGGAGCAGAGAATCAATGACA
TGGAGCTGTGGGAACTGCAGGAGGAGGAAAGGGTAAGTCTGCTAATTAGTCAAAGCCTGC
CTTTTCCCACGCACTGTTCGTAATCAGTTGCCATACTCGTTGGCAGTTGGTTCCATTCCG
GTGCTATAGAAACCCCCTTAAGGACAATGCAGGCCGCTCTTGTTGGGCTGATGCTCTTTT
TGGGGAACATCTTGAGAGTGAGCTTTATCCTTGAGGCTTTATGTACCACACAGTATTCAG
TGTGTATTCATTCTGAGACAGTTTCTTTCTGTATTAGTGGTGAATGTTTTAAAAGAATAG
GAAACAGACAAAATGACCAGTTAGCCATCTAACATCAGTTAATATAGTGAATATAGTGCC
CCCTATTGTAACATATAGGGATATTATAAGTCACCGAGGAGTTCCTTATAATATATAGTG
AATAAAGTACCCCCTATTGTAACATATAAGGATATTATAAGCCCCCGAGGAGTTCCTTAT
AATATATAGTGAATAAAGTGCCCCCTATTGTAACATATAGGGATATTATAAGCCCCCGAG
GAGTTCCTTTTAATATGTAGTGAATAAAGTACCCCCTATTGTAACATATAGGGATATTAT
AAGCCCCCGAGGAGTTCCTTATAATATATAGTGAATAAAGTGCCCCCTATTGTAACATAT
AGGGATATTATATGCCCCCGAGGAGTTCCTTTTAATATGTAGTGAATAAAGTACCCCCTA
TTGTAACATATAGGGATATTATAAGCCCCCGAGGAGTTCCTTTTAATATGTAGTGAATAA
AGTACCCCCTATTGTAACATATAGGGATATTATAAGCCCCCGAGGGGTTCCTTATAATAT
AAAGTGAATAAAGTACCCCCTATTGTAACATATAGGGATATTATAAGTCACGAGTTCCAT
GACCGTATAAAGGGATGAGGCCGAAGGCCAAGTGCTTTTATACAGGTCATGGAACTCCGA
TGTGACTTCTAATAGCCTCATATTTTACAACTGGGAGTACTTTATTAATCAAAATATACA
ATTTATAGTGAGTCATGTGACAAATTACATCACTAAGCTCTGATTATAACTGATGACATC
ACTAAGCACCGTTTATAAGGATATAATTTACAGGTTGGTCCCATAGGGAAATGATCCAAC
TGTATATTAGAAAATGATTAGTGCTGATTGGTAGTTTAGGTTATAATTTACATTTTAAGA
CTTTTCCTGCATTGCCAGAAGGAATAGGTTTAGCTCTCTGTTTGCTTTGGTTATGGAGTC
AATGAGAGCTTGTCCTTTAATCCGTGTGTGCTTACAGATCAGCACCTTACTGTTGGAGCG
AGAGAAGGCCGTAGAACACAAGAACAGGATGTCGAGGATGGTGGAGGACAAAGACTCATT
CGTTTCTAAGCTCAAAGCCTCCCGTCAGTCTTTGTATGAGGTAAGTGTTTATTCTCATAG
CGATATAGCAGGGCTCAACTGCCGACACTTGTCCGACCCTGCTACAAAGTGATATAGATA
TATATATGTGTATATATATACACATAATATAATGAACTTACTGTACAATGTGAGCAGTCC
AGCAACCTAATAAAGGTTCCATGCCTTTAATGTTGTCCATATGAGTGTGCCAATCTATTT
TTTTTTTTGTGTCAGTGGCTCTGCACATGCTCAGTGTGCTTTGGGATGTTTCTGGTGGAA
AGGTAAGCTCAGGCATACTGGAAATTGTCATCGGAAAATGTGGTTAATCTGTCATAGAAG
CTGACAGGGCTGATTATCAAGCTCTGATTCAGATTGCACTGATTTCTGAGCGTCATGTAA
TGGGAATGTGAATACATTATTCTGGGATTTATGGTTCCTGCCTTTTCCACGCACTGTTCG
TAATCAGTTGCCATACTCGTTGGTAGTTGGTTCCATTCCGGTGCTATAGAAACCCCCTTA
AGGACAATGCAGGCCGCTCCTGTTGGGCTGATGCTCTTTTTGGGGAACATCTTTAGAGTG
AGCTTTATCCTTGAGGCTTTATGTAACGCACAGTATTCAGTGTGTATTCATTCTGAGATC
TTTCTGTATCAGTGGTGACTGGAAACAGATAAAAATGACCAGTTAGCCATCTAACTGTAT
TAGATCTAATGTATACATGCTGTGTATATGTTACCATCTTGTTAGGCAATCTGTTTTTTT
TTTTTGTGTGTGTGTCAGTGGCTCTGCACATGCTCACGGCTACTGCTGGTGGAAAGGTAA
GCTCGGAAATATTGGAAATCATCATCACAGAAGCTGATGCTACTGGGCTGATTATCAAGC
TCTGATTCAGATTGACATTCCTTTGCACTGCCAGCTAATTGTGTGTGTGTGTGTAGACAG
TATATCTTTTTGGAAATTCATATAGTTTTTATCATTCATAAGCTGAAATGAATACGTGTA
TGTCAAAAGGCGGGTGGAGGTAGGGTATACTTATCCTTTAATATCAGGCAAAACCAGCAA
ACGTTGATGCGGCAACTGAATGGGGCAAACGCAGATAATCATAACCCGTAGTCTCCACCC
TTCCCCAGCTGCATAAGGAGCCCCAAAACTGACTCTGCCCTTTACCCATTTCCAGGCGAA
ACTAAAACAGTTTCAGGAGAGGCTAGCAGAGGAAAAGGCAGCGCGTCTCGAGGAGAGAAA
GAGAGAGCGCAAAGAAGAAAGGAGAGTTAATTATTACAGAGACAAGGAAGAGGAGGAAGA
GAGACTGAGAGAGGAGCAACTTAAACAGGGTAAGTGATAGGGTGCGCTGAGTAATTTAGT
ATGCCGATGAATGTGTTTATTTGGATAAAACTGGATTTGCGGTGCACAAATCCTGCAGGG
TCTTTCTTTCAAGGGGGAACAAATGCCCTGTGCTTCACTGGTATGAGGCAAAATAGGATT
TCTGTGGCTAATTTATTAGGAAATGTCCCCCCAAGATGTTGGCCAGTCCAGTAACATGTT
GCTCTGGCTAATGGCTGGGCATCTAGGGGGAACCCAGCAGTCACTGATGGGTCAGGAGTG
TGCAAGGAGCCCACCCCATTGGGCCTAGACAAGTATTTGCGCAATGGTCGAGTATGCTCT
TCATTTAGTGTGCACTGTTCGTAACTTGCTGCCAGTCTGTTTGGCAGTGGGTTCCATTCC
GGTGCTATATTAACTCCAAGGAGAACAAGAATGGCTAATTATTTAGTCTGAGTTTGACTT
GGAAACAGTCTATTCATTGTAACAGGGAAATAAGGATAAATGTTAATCATTATTACTTTT
AGGTTGGTGGCCTATGGAGAGATTAGTTGCCCATGGATAAACCCCTGCTATGGCAGGCAA
CTATCTCCCTGAAATGGGGTGATTAGTCTCCTGTGGTCGCCAAGATTAACCAAAGGCGAC
TAACCTCCCCGTGGGCCACTGGGTGATATTCTAGCATATTCTTCTCATTCCTTAGCTACC
AGCAGCTCCTTCTGCTCTCATTGGGGTGGAAAATATACACAATGGGAGAGTGTTTTGGTA
ATTGTGAGAGGTCAAGTCAATCTGTTACCTGGAAATTAGAACTTTAATCTGTCTACAGAG
CGAGAAGAGCAAGAGAAAGTCGAGAACGAGAAGAGAGAAGCAGAACAGCGCGACTATCAA
GAGCGACTGAAGAAACTGGAAGAGCAAGAACGCAAGAAGCGCCAGCGAGAGCTCGAAATT
GAAGAGCGGGAAAGGAAGCGCGAGGAGGAAAGGCGGGGCGGGGATGATACTTTCAGGAAG
GTGAGGGAGGCCTCCGTGTTACTGTTGGCCAAGGTTATTCTTAGTAGCGTATAGATGTGC
AAGAGATATTTATAGTAACGCTGTACTGTATTTGAAGGCTTCTGCTCTGTCTTCTCCGTG
GCTCAAAATGTTGCACCTTTTGTCTTGCAGGATTCTTCTCGCTGGGGAGAACGAGAGGAA
AGTGGATGGAGAAGAGGTGCAGACCCAGATGAACGCAAGCAGGTTCCTCCAGAAAGGTAA
CTACACATGTCTTATTCACAGTAATGTGTTTGTACTAAAGATATGGTGTTAAAGTCAAGA
GAGAACACTAACGTGACTAAAGCATTTGTAAAGACCGTCTAAACCTTCTGTCTCTTTCTA
GGGACTGGCGTAGGGGTGGGCCTGATTCGAAGCCGGTAATAAATGAAGATGCCTCAAACA
GAGAGGAAGATGAGAATGCCGCTTTGAGGAAGGATGAAGAACAGGTGTCTAGTCGTGCCT
TTGAAGAAAAGGTTTCACTGCCCGATGCTGATGAAGAAAAAGGAGGTTCTTGGCGAGATG
AAGATCGTGGTCCAAAACGGGGTCTTGAAGAAGATAGAGGACCCAGACGTGGTATTGATG
ATGCAGGCCCTAGGAGAGGATTTGAGGAGGACAGAGGGCCACGCCGTGGAATAGAAGATG
ACAGAGCTCCAAGGAGAGGCTTTGATGATGACAGAGGCCCTAGGAGAGGCTTTGATGATG
ATAGAGGTCCTAGACGCGGCTTTGATGAAGACCGAGGCCCAAGGCGTGGCATCGATGACG
ATCGTGGTCCTAGACGAGGCTTTGATGAAGATAGAACACCACGCCGTGGCTTTGATGATG
ACCGTGGGCCAAGGAGAGGATTTGATGATGACAGAGGCCCTAGGCGTGGCTTTGATGAAG
ATCGTGGTCCAAGGAGGGGCTTTGAGGATGATCGTGGTCCAAGGAGAGGCTTTGAGGATG
ACCGCGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1099, 6100..6290, 6384..6520, 6749..6912, 7045..7244, 7968..8176, 9748..9919, 10014..10118, 11724..11822, 11974..12090, 12998..13183, 13755..13857, 17815..17844, 18727..18866
1051..1099, 6100..6290, 6384..6520, 6749..6912, 7045..7244, 7968..8176, 9748..9919, 10014..10118, 11724..11822, 11974..12090, 12998..13183, 13755..13857, 17815..17844, 18727..18866
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved