Xenopus_tropicalis Locus rpl23
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis rpl23
Xenopus_tropicalis
rpl23
scaffold_571
SNORA21
1617..1749
6291
ctgtgtgtcttcacccttatgcagactttacgcttgtgtggccaatgtgccaaattcca
tagtttcatatactgatcatgctcaagtataagggactaggtagcaagactcggggcagg
agtgtgagagtaataaggggtgcaatgttttcccttaggaaagtataaagttagtattag
acctgtcactcataatctaactcccacatgaagaaagacatgctgagagagggataggaa
agagtagctttttacttattatttcagaaacagtacacaatttttagatgaaatgtcatt
ttcatgatagcccccctttaatagaagcagcgcttcccccagcagtcacactgcactacc
tagcttgtgttcccaggcagtatattatagagactttttgttagtataatatacttggaa
tatatttggaattttgttatccatatttttagagggttgggggaatattactatactaag
tataataacattccccaaccctccaaaaatataggtaacaaaattccctaagcctagaaa
cctcctataatggctcatctgccaaaggcccctgagtgtccgcactttacggctgccctg
gttacaacgcttcaaagctacctttataccccatgggctccgcagccctaacctctttaa
accctactttccaggttgctatatgcaggcatttcaccgtacgccacaacaattgtacat
ttaaacctcctgcggacacacaggaatcgcctttacctgggcagtcacggcgtgttatgg
cgtaaacaaacccacaaatggcgcaggcgcagtctccaccactttaggccccgcccttcc
tcgtatatcttggtcacatggctatgccgtcatccgtctgttccggcgcctccaatccgc
aggcgatgtcacgtgatctcgcccccttctccctcccttgcctgacttgctgctatatcc
cagcatcctttgcgcccgcctctttctctttccggtaaccaAGATGTCTAAGAGAGgtga
gggctgtgggcctgtgacttaaatccgttgtcatctaccgacttgttgtcgttgtcggtg
cctgtaacttgcggagggcgcttgctgatccctgttcttttcccggctgtcagtatggcc
gatgctgaaaggcagagagggctgtggagatgtcttatatacagcgggaagctatagctg
acgtcccgggaagccatgtttagagtacgctgggcttagcccctctctctgtagttttct
aattagtgcaatagtatatagagtatattatgaatgtatatatttataggtcgcaatcat
ttctttcctcttctatgtaatcagccaggctgtaccattactgtacatttgggggggggg
gggatatagtataaggagagagtgcttggtatgtccctgtacccacctctgtctctactg
cccaaggcccattacccccagcctttatctgcatgtgtatgggactcccacagatacccc
ttcccattagccttaccatttgttttttcatttttaaaccctgggagtacattgttgatg
ttgaactagaacttggcacacatatatatatatatataacagggggaacaggaagcccct
cttcttaaagcacttgcagtgtctgctcggtggcacgatgagttgtcgtggaagaggata
gaaagacattgcttttgggtgaagaggcagctacatgtgctgttctgcttcaatcagtga
tgtgacacaaactgagcttttatagctgctgtgtttctctcaaatatttcctcatttttt
cttattttagttggttggtttcactgttaatctaatcattattaaggacgttgttgtgaa
actactaaatgtccatatcctacccatgtatatgttatattactggcagtacagtgtcgc
tattctgactgcggtcaaactgcaatgcctctttactaaggcacagttaatggaacagta
tccaaaaaaaaacctgatctgtttgcttcagaaatgttactgtagtttatataaacaagc
tgctttgtatcaatggaggcagttaaaatagggctgaatggcacaggttacatagcagat
tgaagataaactctatacaatataatggtattctacagagctcatctgcaatctgctgtg
taacctgggccttttggctgcccccatggctacacagcaaggtaaataccttgctgtgta
gccatggggtacaaagactcctttgtagtcacattgggctttaggcaatgcaatccttgc
atgggccggagtactgatttaatgtgcctgtagaaggatcgtcacccctagcccagcatg
accacaggaagttttgttctaatatctgtccacttctgctaagctggtaccactgggctg
ggtgtggttttggggcacttctggcggaaatattttggtactgcaactctaataataatg
acacaattctatggatttttatagggaattgtctctccctctctcacctgcattcctgga
aatgtgctgctgcctttcctaatgttgctaatgactttctcctagGTGCAAAGAATTTGT
ACATAATCTCTGTGAAAGGCATCAAGGGTCGCCTGAACAGACTGCCGGCTGCTGGTGTTG
GAGACATGGTGATGGCCACAGTAAAAAAAGGAAAACCTGAGCTGAGGAAGAAGGgtaggt
ggagtgcgcatacagggggcaatagtcatctctgggagcagttgcctttaaatttaatag
atacagaagactacagagacactgtttatctgtgggggattgggggggatgtggtctctt
taggctgatagcccatggggagataaatcttggttacctgaaatgccttcccaccgacag
taaaggtaatcaccggtgggaaggcatacatgttgctttttttcccttagtccctcagtt
tcctcccgtggggcaactaatctccccgtgttacttttataaaccaacttcaattccccc
agtaactgtgtattctctcccgcagTGCATCCGGCAGTGGTAATACGGCAGCGGAAGTCG
TACCGGAGAAAAGACGGGGTGTTCTTGTATTTTGAAGACAATGCGGGGGTGATAGTAAAC
AACAAGGGGGAGATGAAAGgtaagaggatttcgctgcatacagaagtgatattataatag
tcctgatgttatgtagtggtaactggggtgattctacccaaacacatacatttttgcagc
tggaaatgtctgtttgcctccccaaatggaaccctgaatccactgtgtttgatcaccatg
aaggagaatactcagctgaactagtgtattaaaggggcgccctgctctcaaatggtccct
cttcttaaagcacttgcagtgtctgctcggtggcacgatgagttgtcgtggaagaggata
gaaagacattgcttttgggtgaagaggcagctacatgtgctgttctgcttcaatcagtga
tgtgacaagtggatgtcttcccattatctctccttcagtggagtatatactctatagggt
ctcccattcatctaaatgttagcaggaatgtctggtcactggcagatgttggttgtacaa
attcacatctgtagagaacaaaatctaaacccaaagctatgttgcttgctaaaatctggt
attaatattaaccccgttaataccacggatggcagaatatacggcacctgcattcagagg
ccgtgggtttgacgttctggtcattattgatctacgctgcaccaatgtttacactgtaac
acacagcatggatcaaagagctgaccatctgcactaaaaggcttattgaaatttccaact
tgagaaatgggagctcagcacatgtgcagatcccagaaaaacaaacttttccataagggg
agatttcaggcattttgccttctgtttttttttttcctctacattcccagatctgtggaa
agttaaaatggcaaaatgtcaccttccgctgcccacattgcccctgtgcttgtgagaatt
ctcccctgaaaacacagctgccatttcaagttttaaaacatctcatagtgggcaatggag
ggtgatttggagggtttcatacccaggtgtctttgaacaaggaaacttgatgggcaggtg
ttaaaatctcccttgttgttggcctaagaatgtaaattaaaaatgttttatttaaggggt
tcattctgttggattcattccaggaaaccttggtcactgattttttttataggaaatctc
ctggtccaaatctgctttaatttatacattagagcaggggatccccaaccttttgtttac
cctgagccacattcaaatgtcagaagttggggagcaacacaagcatgcagaagttcctgg
ggtgccaaatatgggctgtgattggctattagtagcccctatgtggcctggcagcacaca
ggctatgtggcagtacatctgttttaagcttgcctccaagccaggaattataaaataagc
accagcattgggagctacattcactgataggggatcgctgcattagcggtagctgccata
ttgcttgtcttatgtgtttttcatagaccgtaacggcaataactctacctggctgataca
aggacagtatgagccttgctgatatttactaatacaatttattgtaaataaatgctaacc
tgtaagcaattaaaggctgtatttagagaatattctcctagaatggagattgcctggatg
agttcttgatcaatcagaatatccaaggctattgtgatactaatatgtacagttagtatt
agtggttgtatttatagtttatgtatgtgagtgtatagataggtaagtataggttgtggg
tgatggggaaacttggaagggttgaacttgatggactctggtcttttttcaaccctatgt
aactagaagaaagtgtttttctcaattggcagatgctgagcccctccatgtttgactgct
caatgcagcatatggggcccaacctgaacttcagttactgtaaaatacaggctgaatgct
catttggtataaagataacaataagctgtgtcctaatgctgaaaaggaagatgcaccttt
ggtggtgcaattaaataacatgtgttttcaagaacttgaaagaattttttttttctctct
gcttttagGCTCAGCTATCACAGGCCCCGTGGCGAAAGAGTGTGCAGATCTGTGGCCCAG
GATTGCTTCCAACGCAGGCAGCATCGCATGAACACACCCTCTCTTTGTAAAATAAAAAAA
AGTTGGAACAAAcatggagtctggtggtggtgttactaaaagctgtacatgattcctcaa
tggcagatctgtatcggcctgatctgatgggattttaactctttccatgcccagcggtct
tgatcactggtaattggctattgtaaagcaaactctcccctacccctgtattccctcact
tgtactgagagctatctcccctacccctgtattccctcacttgtactgagagctatcccc
cctacccctgtattccctcacttgtactgagagctatctcccatacccctgtattccctc
acttgtactgagagatatctaccccttcttgaagctatataatgtatcagccagtaccac
tgattctgggagggaatttcacatatttctgaagcaaacaaggcaggacatcaatatttt
atgttgtctgtcttttcttagatgttactgttcctttaaatacataatctggaagagcac
aaaatgtcatccccactatttgccacttgtgtctcctcatatacactgcaaaggcctttg
cacacatcccctccatataggccagtaatgaagtacgtgtattttatttcatacagactt
ctgcactcctagtagtaagctttaccagttttgtttttatttttcagtgtaactaatttg
tatttattgtacagaagacaatctggttaaaaaaaaaaaggtaaatcctactacacactc
attatagtatgtaaatattttactcagagggagggggcaatgagttaagtgccactgcac
catataaatgcacatatggaagcaactgataattctagacctaataaaacaagcagtaat
taaggtccaatatgaatcaagcaagtacaattgtctttattataaggcacagaagggtca
gttctgtaaagtggccagcagatggagctgtaaagaaaaatccctaaatgcaggaaagct
gggtgcaaagtaccaaaaaaggcaacaatctgcctctctaaataatatgcta
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 2565..2693, 3025..3138, 5168..5291
1003..1015, 2565..2693, 3025..3138, 5168..5250
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved