Xenopus_tropicalis Locus ENSXETG00000010656
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis ENSXETG00000010656
Xenopus_tropicalis
ENSXETG00000010656
scaffold_417
SNORA71
1376..1507
7313
CAGGGTGAACTGTCTGTGTAATGTACACCGTCGGGCCTGCACCCCTTAAGCCCAATACT
GGACATAGTCGCCCGATTGTAGTTCTACATCAGCTGAAAGGCCACAATCGTTTTATTACT
GGAAAATGAGTTGGACTCTTAGTTGCACTCACCCACATATACTTACCAAGTGGGACCTTA
TTGCTATATGTAATTGCTATCTATATGGCTGAGGGTTTGCACAGTGCATATTGAACATGA
CTATTTTAAGTACTTTATTTTTTACAATGTTTGAAAACCTGCATCGAAAGTGATTGTGGC
CTAATTTGTGGCCTGGTCATTGATACTGCAGGAATATCAGCATGTGTCAGTTTTTCCCGT
GTTTGTAGTGTTGCTTGTATACTGACAAACCCTGTAACTTACACACATCACTAACAGGTT
ACTCCACATTGTAGCTTTTGGTGGTTCCCAATGGGGTATTTATTACTGCTGTCATGTAAA
TACAAGGCCAAAATATAATTCAATTCACCCCTGTAAATAAGGATTTTGAACTGATGATAG
ATACAATAATTACACCCTATTTGAGTTAGTTTGGTACCATGCCATGTACCTAGCCCTCTA
TGTAACACTACTCCTGCTGTAAACCTGGGGGGGGGGGGGGATATTTTTACCTATGAGTAG
ATATGCTATGTAGTGGTTTGTTCCTTTAAAAACATGTCTATTCATTTTTACACCATAGGT
GCAATAGAAATACATATAGATCAAACCATTATATTTTCACTGTCCATTACAGGAAGTAAT
GAGTCAAGATCTTTCCTCATGTAGTTTGTGGGTGGCCAGACCTACACCAGTGTATATTAA
AAATTAGAAAGCCTGTATATCGGTGATCATACTGTAGTATCTTGTAAGGTTGATAGAACT
AGATCTAGTATATCTGGTTTGTACTTGTCACACTTGGATTTTTCTTCTTTTTGAGTATCA
GTATTTTGGACCTATTTGTCTTACTATTTTCTTTTCCTATAGGGACGCGTCAGGACAAAG
ACCGTTAAAAAGGCAGCTCGGGTAATAATTGAAAAATATTACACCCGGCTTGGTAATGAC
TTCCACACAAACAAGCGTGTGTGTGAGGAGATCGCCATCATCCCCAGCAAAAAGCTGCGC
AACAAGATCGCTGGGTGAGAGATTTCACATAGGTGGAAACTTTAAGCACAACTTGTATTA
ACAACGTAATTAGAATTGGTATTCAAATTCACATACTTTGAAATAAAGGGGCATTTCTAA
TTGACAAATGTTTCCCAGTTCAGTGATGTGTGATGCTCGCTCAGTACAGGAAGATATGAA
TATTACCTCTACTAAGGACCTATGAATAATTTTTTTTTTTCTTTAACTTCAATCCAACCT
GCATCGAAAGTGATTAGGGTTTCCTTGTGGCCCAGTCATTGATACTGCAGGAAGAGTAAA
ATGTTAAAGCTTATCCCGTGTTTGGCGAGTGTGACTTTGTATTAGCCAAACCCTGTGACT
TTTGCACAGCTCCTTATGAACAGATATGTATATATTTTATATCAAGATTCTTGCTTCTGA
TCAGTTTATTGTCCATCTCACTTGTAGGTATGTCACACATCTTATGAAGCGCATCCAGAG
AGGACCTGTCAGAGGTATCTCCATCAAACTGCAGGAGGAGGAAAGAGAGAGGAGGGATAA
CTATGTCCCTGAGGTAAGTGGATACAAATTCAGGTTGCTTGAAATAACTGCCATCTCATA
TTTAGCCTCTTTGGTTGTTAGCCAGCTACCTAACCCTTGAATATCTTGTACTGCAAGTGC
CAGAATCTGAGTCAACAGCTGGATGACCAGATTTTGGACAATCTTCTTGTAGCCTGAGAT
GTTCCCATAACTTGAGTTTGTAAAAATTCAACCCAAAACTTTCCTAAACTGCATATGAAC
ATGTTTGTCCACTCTTTGCACTTATTACTCCATTCATGGGATTGTGTGCAGTGTTTTGTA
CAGCAATTTTTGGCATATTACCTAATACTTACAGAAAAATGTTATTCTTAACATTATTCC
CAGATCAGTGGGTATTCTGACTGTTTGCTTCATGTGACCTTATCCTTAGGCCTTTCAGGG
CTGTTTTCTTGCTATCCCAGGTGAAATCCCCTGTGTATATGTGAGGAACAAATGTTGATG
TGATAATGCTTTAGTATTGCCCTTGGTAAGCTTAAGATGCCTTAGAGGCCTATTTATTTA
AATATCCCCTAAACTGGTAGAGGAATTGGTTAATGTGTAGCAGTATCTTGACCACATCTC
CTACAAAATTATTTTTAAAATAACTCCCTAAAGGTTTTATTTCTTTGAGTTATTACTTGG
GTGGTCCTTCAAATCATTAAAGAGGGTGACAAAAGCATTCTCTGCTAGTAAAGTGTACAC
TAAAATGCCTTTGTTTGAAAACTGAATGTTTTGTAGCTTAAAATATTAATAATGGAAATT
TGGGTATCGTGCCCTTGGGTCAAATTACCAAGGACTGTCCGTTATTAATATATAGCTTTC
CTACAATAAAATGCCAAACGGGTTCTGCCAAGGACTTGTGCCATGGCTAGTAAGAAGTGC
TTGTTTTAGGCTCGTGAGCATGTAGCTCCTTGACAGTGGGTTTTGCCTGCTCAGATTTTA
CCAAACCTATTTCAGAAATATTTTTATTTTTGCCAGATATTTCTTCACTCTTTTTTAACT
AAAGTTGGTTTCTACCGTGCTGCCAGGCTGCTTTATCATACTAGTTGCCAGATTACTCAA
CGTGCTGTTGAAATTTCATGAAAGTGCAGTTGGTCTATTTTATATTATCATGCACTTATT
CAAAAAATCAAATATTAACACTTATTCTTATGTATTTATCTTTTTAGGTATCTGCCCTGG
ATCAGGAGATCATTGAGGTGGATCCTGACACTAAGGAAATGCTGAAGCTGCTGGTATTTA
TCCATTTTAAAATTTGTGCCTGTTTACTAAACAGTTGGAATAATAAGTGTCCTCACATGG
AGAACAGCAATAGCGATTGATGAATGTCTTACCTGCATCGAAAGTGATTTTGGCACTTCT
AGTGGCCAGGTCATTGATACTGCAGGGAAATTACTGCATGACAGTTTTTCCCGTGTTTGG
AGGTGATTACAGCATACCTACCAAACCCTGTAACTTTCATACATTGTTTTGTACAACACT
GTCCATGTGCAGTTACCTAGCGTGCATACACCGTTATGTATAGAGTTGTATTTTGCACAA
TATCTTTGTTGAAACCGAACCACTGCTATTTTGCATAGTTTGTAAAAAGCGTGCACAAAA
GACAATTTTAAAAATTTTATGGGGCAAAAAAATTTATTGGGCCTGGTTTTTTTTTTTTTT
TTGTACCGTAGCACAGTTGAAATTTATTTAGTATTTAAGATGGGTTCAAAATGCAATAAA
CAGTTAATTGCTGCTTAAAGGATACATATCCTATAAAAATTAAGAATGTAACAGTGAATT
ATACTCCTCTAAATATAGAAGGATTGTGTTTAAAAAAAGTTGTGTTTCAGGCTGATTTAT
TGAGAAATTCCACCAAAACCCCACTAGCCCCGCCCCTCTGTTGCACTTCCTGCATTCTCT
GGATGAGCTGGGGGAGCTGCCGGCTCTCAGTACACTGCACTGTAGGATAGGAACCAATCA
GCAGCTAGGCTGAACTGATAGGGAACTGAAGCCTGTCTGTGCTTGTGTGACTGCAGGGCT
GTGATTGGCTCTCCCCCTCCTACTATGCTTCTGGCTGGGACTGTTGGGACACACCCACTC
TATTTCAAATTTGGTCAGAGAAGAGAGAGGATCTATAGGGAGCTCCAACAAAGGGACCAT
TTTTACAGATAGGATTAATTTTAAGCACAAAGTGAAACCAGCACCATATATTATTCATAA
TTGCCTACAATATTAGGGTTTTCCCATTTATCCAATATGTCTCCTTTAAGGCTCTGGCCT
CTCGAGGCAACTTTGGCAAATTGCGCCGCCACGTATGCCATGCCACCGGCAATTTACATT
CTCCCCGGTGGGATGTCATATCGGGGAGATCATTCACCCGCAACAAGGGAGATTTGTCGC
AGGCAAGTAATCTCCCTTGTGTGCCAGAGCCCTAAGGGTGAAGACACACTTGTCATGGCT
ACTAAAACAGACAATGCTGATCATTTACTGATAAATGTCTCTACATGTGTTTTAAGTAGA
AGCAATTTTCAGTATTGTCTAGGCAGGGTGTTTTCTGGAGTGAAGTAGCCGCTACTAGTA
GCTCGGTGTGTCTTCACCCTTACACCTATTTCCCACCCATTTCATTTAATTTCTTCTATG
ACACGTATTATGGGAACTTAATCTAGGTAGAGAGACACTTGGATATTAACCTAAGTAAAT
CCAGCCTCCTTTCATGGTAATTGATGGCAGATAATGTATATAAACATATGAATGTTGTCT
TGGATGCTTTTTGAATATTGTTGCCTGTTACCTTTCAATTTCCCATTGTTTACAGTGGGA
AGTGATGGCTGATTAACAGTGGAGTTTTGACTACTGTAGTTCTCTTTAGGATCACCTTGG
CCAAAAGTGCCATAGTCTTAAACTAAAACTTCCATTTTGTTAGGATGTTTAACTGCCCCT
GCGTATACATCTGTGACTTGTGGATTTGAACATCAAACCATCAAAAATGCATATTTTAAA
AGGGATAAAAATGTTCTAACCACAGACATAGGGTTGCTTTCTTAAACATGTCTACTTACT
TACCATGCACTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTGAATTTTCTGTATGTGCAGGGGAGCTAGGCTGACCTATGACTGCAGTGTTGTGATT
GGGTATATCCCTCCTGCAGTGCTTCTGTCAAAGCCTGCTAGGACACACCCACCCTTCATT
TGAAACACTGACAGAGACTAGAGATGATCTATAAGGAGCCATTTTAGCAGACAGTATTCA
AATTTAGCCCAAAGTGAAACCAGCATCATTTATTCATTGTCTCCTTTAAGACATCAGTGC
ATGTTTATGCACATGTAGAAACATTAGTTTCCACAGCATTTATAGTGTGGATTTAAAGGT
GTAATGTATGCTTTACTGACATCTGTGGGTGAAGTTTAGTTATGTTTTTTACTTGTAGTT
ATGATTAACAGTACAGCACCTACCTCTTCCTCCACATTTGTTGTTTGCCTGGCTGTCATA
TGTAGGGTGTACATTACTATAGGAATAAATGTTTTGAGATCAGACTCACAAAAAAATTAA
ATGTTGCTTTGTATAACTACCACTACAAAATATCGATTGATAGTTTAATGGGGCAGTTCA
CCTTACCAAAAATTGTTTTCATAATGATTATCGCTTTGCTATATTTAGTGTATTTTATTG
GTTTTCTAAAGTAAAGGGGAATGCTAGCCAAATCATGGTTTTTACAGTGTACTTTTTATT
TCTAAATTACTCTGTTTGCATAGCACATAATTCACTCTACCATTTCAAATTTTATTTTTT
GTAATTTTGGTGTGTAGGCAGCCTTCTGAGCCTTCAGAAGGAGCTGGGACTACACATTAG
AACTGCTTTTAACCAGCTATTTAAACAAGCTATTGTTTCTCCTACTCCATGAAACTGGAG
GAGTCAAAAGCTGCATTTCTTACTATTGAGTGCTATTCTGCTATACTGCTACCTTCCGAT
TGTTCTGCTGAGGCTCCTGGGAGGGGGGTGATATCACTCCAACTTGCAGCACAGCAGTAA
AGTGTGACTGAAGTTTATCAGAGCACAGGTTACATGGCTGTGACACCCTGGGAAATTAAT
ATGGCTAGCCCCATTTGAAATTTCAAAATTAAGTATTTAAAAAAAAAAAAATGTGTTGTG
AAAAACAGATTTCAGTGCAGGATTCTGCTTCCTAAGCTCTATTAACTGAAACATGTTTTC
CCATGACAGTATTTCTTTGTGTCTTTCTGGTATAAAGTTTGTGTTTTTAAGGTTATTTAT
AAATGTAATTTCCTTTAAAAGCCATACCTATCCCTTTCTATGCTACTTTCTGCACTGCTG
CTGCTATTCTATAGCATTGTCAGGACCTGTATCACTGCACTGTTTGAAGTAAAAGGGAGC
AGGTCCAAAACATTTTTTGTATAACATTTTATATGCATGTTAACTAACTCTCCTCCACTT
CATTTTATAGGACTTTGGCAGCCTTTCCAACCTGCAAGTTACCCAGCCGACTGTGGGCAT
GAACTTCAAAACACCAAGGGGCGCAGTTTAAATGTTTGTATCATACAGTCTCCAATAAAT
TTGTTAAAACAAAACCTGTGTCAATATATTGGATTGAAAGGAGCTGAGGTGGTGGTGCAA
ATAGCTTGAGTAAAATGGGTCCTTTTATTTATTTACTCTTGGCTCCTGTTCATGTAGTAT
TAGGCCAATGTCCCACTGAAAGATTGTCGCCCACAATGCCTTTCCACTGGCATCAAAGGG
AATCCCTGGCAGAAAGGCCTACGTGTCGCTTCGGCCTTCCAAAGTCGTTCGAAGTTGCCT
GCAGGAGCAAACTTCACACGACTTCTGAAAGCCGAAGCGTGCCTTTCCGACAGTAAATCT
GTGTTTTTAGAGAGATTAGTCGTATACGATAGCAGATATATATCACTGGCAACTAAGTCT
CTCCGTGGGATGTTGAACCTTACAGGGTTAGGAATACATGGCCTTCACTACATGAATATA
CAGCTGAGGGCAACTGTCAAACAAAAATATTAAATGGAAACATGTTTGTGTGTTTAAGTG
AGAATTGCATAATTACCAGGAATAGGGGGTTTATGGCGAAAAATAACAGGATGCAAAATG
TCTAAAGTTGCTTAAGCTTTAAAGCAGTGAACCCCAACCAGTGGCTGTTGAGCAACATGT
TGCTTTCCAACCCCTTGTATCTTGCTACAAGCGGCTTCAAAGCAGGTGCTTATTTTTGAA
TTCTTTGCTTGGAGGGAAGTTTTGGTCTTATAAATACAAGGTGTACTGCCAAACAAAACC
TGTCTGCTGCCAGTCCATATATGGGGCTACCAAATAGCCAATAACAGTCCTTANNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCCCCCCCCCCCCCC
CCCCCCAAACGATGTAGGTCTCTATAAAAATATATTGCATGAACAAGCTCATATGTAAAA
CCCTGCTTAATCTAAATAAACCATCTTAATAAAAAAAATTAGTATGTGCTATTGGGTTAT
CCTAAATAGAAAATAGCCATTTTAAGAATCAAGGGCTGCCTCCTGGGATCATAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1153, 1587..1692, 2867..2932, 6190..6313
1002..1153, 1587..1692, 2867..2932, 6190..6267
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved