Xenopus_tropicalis Locus rpl4
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis rpl4
Xenopus_tropicalis
rpl4
scaffold_363
SNORD18, SNORD16, SNORD18, SNORD18, SNORD18
2662..2731, 2939..3038, 3343..3412, 4756..4824, 5435..5506
7097
actgtctgccccctttctcttcactgccctggtggtgctgacttttgaaacaatgtagc
agaaatcaacatgttaacagacttctgaagcatatacaacagtattctgctacactgctt
caagagtcagaaccagtagcaaataaagggacaactcctactttcagttgtgattacatt
tacaaataactcaaatatcaaaatttgcattaaatgtatgtatcaaaaagctgcttagaa
ttacatttactttcatgaggcaaaattgtattcatgggtttaaaactgatttaagggcta
ctatttttgactggaactcccatttgaactctaataaaaactgtttctagactacaactc
ccatgatcccttcagtctcttagctgatgactgactcggaaccctgggtgctgaagtcca
gacaaaactgcccatgtagaaaaatggtgggacattctccctacgctaccgacctgctaa
gaaattgttgcagctctacagccgcccgatgcctttcagcccacatcacgaacttgtact
tgcaacttccaaatcgcccgcgctacagctgtcactcacgacatggcccaggaagtacta
ttctgctgacaattttaaaaaaataaagcaaactaaaacaaatcaaccttcgaaagctga
tatgagttaaatgttttacatgagctaaaacgtatgcagtttttattttatttgaacatt
tttattcctgtccctcatacgtcatttttatttccggcaacgccatgtgaggtatcgctc
cgcggcacaaatagtccctgtagaaacttgaaaatttcgccccaaaatataagcactgag
tgattatacagcttccgagcgcattttgggttggtttagagatatactagcagggattgg
agaattttgatggacttattcacactttttagctctttaccaatacagtaggcgtaggca
tatagctgaggaacgcggctcctccttccttttctcttcgtGGCCGCTGTGGAGAAGCAG
CGAGGAGATGGCGGTCAGCATGgtgaggccaaatgagatatttattgctaggattactgt
tgcgcatatatgaaaaccaaaatgatctccaacagtccctgccggggagggtggaatcga
catcgagtgtggcggctgtagtgtgcgggacagtccctttagaaccgcgtgtagatctgc
cgggcccggctcgcctagcccatagggacagcatgcgaaggccttaccttgccggttata
atgtagatactatcggagctgtcgtactatgtcctctatccctgccccactaatacatgt
gctgcctgggtggatagtcatcagatgagccgcctgtttaaccatgtgcagagttactcg
cttctccctgtacagacatgtgtatatatacaggagactgctgttaaaggggaacttcga
ccaaaaactgattattttttacttaaaaaaagtccaagcaaattttcaaaatacattaac
tgttatattaacacttaatagttaatgtattttaaaaaatttgctcggcttatttttttt
tttttacaaataaactttaactttgttatattaacactaaattaagttatttgtaaggaa
ctttttttcagaatttttcttctctggttctgacttgggacagtgtagtagaatggggat
tgtggccttcatctgttctacagctcacagcaccctctgggtgccagttcctaggaaatc
taccccagtagcctgtgagctgtaggcctgacatcctactttatggttttgtcagacttg
tcaccaacatgccttttttgttcctagggctgatgtggcttgtaccagttacagttctaa
agtattttctagtgtccagggagaagccactaggccattgtgacatgggaacatttcttt
agaccagggagaaaaaacatttttttctttaaggtctaattcttccattactgtaaaaaa
acaatacattccctcccctgtgcaaacttaatgtgactgaaccagtgcttggaaccattc
cccctaatgctttcaggcttttatactgtgttcaacttagtagatgatgtataaaccgcc
ttattgtgtttgcctttattttatcaccaaatgaatctttattgtgtgagctgtgcaagt
gcgaaagagaagtagttaagcataaagtggggcaaaaactgttcagtaatgaacatatgc
aatgatggtgtaatttgcgtcttacctggtattcagcgacagttgcctgctgtcataaag
ctggtgccaaggggtgacgataatacaagtctgagcattttgatacaccttataaatatt
tggcctgtctttggatcctattttttaacatgtttcttgttttctggtttaaatgtaatc
tgttgcaattttggttttatcccccccaccccagGCCTGCGCCCGTCCGCTAATATCAGT
ATACTCTGAGAAGGGGGAAACATCTGGCAAAAATGTCACCATGCCTGCAGTGTTCAAGGC
ACCTATTCGGCCTGATATAGTCAACTTTGTCCACACAAACCTACGCAAGAATAACCGCCA
GCCATACGCAGTGAGCGAGCTTGCTGgtatgtagtactttgatcatcatagtttacttgg
gtgaacaaaattttatgtcagatgaatatgatgagttccacttcatggtccgtgtttctg
aacccagtgataataatggaagttctgattataaacttttatatcggttgagaggctacc
tatgttgcagtctagtgtaacaagttttatttcccagGTCACCAAACAAGTGCTGAATCA
TGGGGAACTGGTCGAGCTGTTGCCCGTATTCCCCGTGTGCGTGGAGGAGGAACTCACCGT
TCCGGTCAGGGTGCCTTCGGAAACgtatccttttggattaaaatgagtgcgtttttacat
gctatgatgtcgtaatttgcgtcttactccacatcatgcgacagttgcctgctgtcatta
agctggtgtgggtgactgacgaatatcgcgttctgagcaaaaatacttctcaaatcaagt
ttcaaatatgttaatagaaatggcttgccaagaaaaacttctctttagatcagtttttta
ttttttagaaaatttaatttccttaattggatatgtagATGTGTCGTGGAGGGCGTATGT
TTGCCCCAACTAAGACCTGGAGACGCTGGCACCGTAGAGTCAACACAACCCAAAAGCGCT
ATGCAGTCTGCTCTGCACTGGCCGCCTCAGCCCTTCCTGCTCTTGTTATGTCTAAAGgta
atcattttctaagacattgtaaagctggtagtggcacattgttgctttatgatgagttcc
acttctggtccgtgtttctgaagcatcatgatctttgtggaagttctgatcagcaaaatc
tgatggtgttttctgccagtacctataatcatcatgtaggttcagttagtctgtatttta
aaataaaggtatttaacattgttttcagGTCACCGTATTGAGGAGATACCTGAGGTTCCC
CTTGTTGTTGAAGATAAAGTTGAGAGCTATAAGAAAACAAAGGAAGCTGTCCTTCTGCTG
AAAAAGCTCAAAGCCTGGAATGACATAAAGAAGgtgataaaaggtttcccatactatatt
ttgaatgaactcattagtaaattagtgttcttattaatattccactgtgtgattaaagct
gtcggtgattaaaaagctgtaaagcacagcaagtttttatcgtgattatttaatgtttaa
attctcttgtgcagGTTTATGCGTCTCAGCGTATGCGTGCTGGAAAGGGTAAGATGAGGA
ACAGACGTCGCATTCAGCGCAGAGGACCCTGTGTTGTTTACAATGAAAATAACGGCATTG
TAAAAGCCTTCAGAAACATCCCAGgtaagtaaattatgttagagggggtgactgctattg
gtccatgtttccagaactgagctacagtggaatctgaattcttttgtatgacattgattc
ttagaattccctaagtgttaagtttttacctatgtcccaaatgacagcaaagtttaacaa
tttgcatttcagccttaattgttagtataagtgatagtattattggttgcaggagaagca
aagctctgtattaaaccgtaaggtagccatacgcattacaataactttcttgttacccat
atttgactgttcagcactaatgtacagctgtttgggcgcattcaaaggtgcattcaggca
ttcaggccttcccgattgtcgagatgaccgatatccaaagcttttgtagatatctgttgc
ctcctcaactcgccatacatgtcccaaatatcatacaaaaccttgtttcttacgatatca
gtgctgtatgggcttcccttttaagatggcttgacatggctgataagagagactgtcctt
tttagaagtctgcagcttattggcagacttgtggggtttttttttttttttttttttttt
tgcatcttcttgatgtattgaccatcccaattttaattgctagGAATCACCCTCCTGAAT
GTAAGCAAGTTGAACCTTTTAAGGCTTGCTCCTGGTGGTCATGTTGGACGGTTCTGCATT
TGGACAGAAAGCGCCTTCCGCAAATTGGATGACCTCTATGGTACATGGCGCAAATCAGCC
AAGCTGAAGGCAGATTACAAgtaagtatttgttggatcctttagtttttagtggaaactt
gtgtgtgtcctgtttttatacatgatgatctccacttctggtccgtgtttctgaaactca
tgatctttgtggaagttctgacttagccttgcagagctaacattcctacattgtgctgct
gtgtttcttccataacagagtcttataaatggctttccactgagcaaagatttgagaatt
ggcacagcctctaaatcagtgttacttggtgtatttggttgtgcaacaagaggctgcagt
tctaactgcttttgtggtgttttaactatctctggtcttataccttctatttttcagCCT
TCCAATGCACAAGATGACAAACACAGATTTGACCAGAATCCTGAAAAGCCAGGAGATCCA
GAGGGCTTTGCGGGCTCCAAAgtaagtaattcactagaagagtattagatttaatgaacc
cataaacacagcaggtctctaaaaaaacaaacaaaaaaaatcacaaagcttataaagcat
ataaagctttcttatgaaaagacacacttctgctagtatgtgtcattgggtaattctatt
aagcagtgtctgccttttggcttatctaatgcactgtgcttagacatagtatgaaatatg
caagttacatcagtcaatgaatagagttgtcttattcctacacccacttcctgttagcac
ctgcattatttagttacaaaggttttatcccagtgtgttaatgatgagttccacttcatt
ggtccgtgtttctgataccttatgatttcagtggaagttctgatatatatttctcaagcc
ctacagccagtgtaatgggcaagtgtgtgagaccttaattatttagcgctaatgttatct
tgcagCAAAAAGGTGAAGCGAAGGGAGCTCAAGAAGAACCCACTGAAGAACCTGAGAATC
ATGATGAGGCTGAACCCATATGCAAAGACAGCAAGACGTCATGCTATCCTGCAGCAGCTT
GAGAATgtaagtgcctaaaagaaatcgatcccttcctgatctttctaagaaaaggggttt
tgtgtattgcccattggtgtgtgctgaggtgtttggtagtactagtgcttatccaatttt
agaatgcatgtctgtaagactgccagtagtgttaaaatgttgacatctgttaatgtctaa
attttttctacagATTAAAGCTAAAGAAAAGAAGCCAGATGATGGCAAGCCTAAAGCAAA
GAAGCCACTTGATGCAAAAACTAAAATGATCAAGTTGGCCAAAGCAAAGAAGAGGCAAGC
CAGGGCGGAAGCTAAAGCAGCAGAGTCAAAGTAATCCTGGAGTGTTTCCTCCTGTTCAGC
ACTTTGGATTTACTCAATAAATTGTTTCAAACTTTTTAgtgtgtttagtatattttaagt
gctgttaataagtctttcttgtagatatccttttgtgggatatagttagctaccatggtg
gcatttgctgtgtaaaaacaaggtctgcccttctgtctcggcatagttgcatttttttaa
acttgtatggtctgctcttcagctttcccatacagcagccaagtatacttttacacacag
gttcactcagttttactttatgcctttattttttggttacaagagtcccgcgactgcctg
tagtttttttttgaagagagttgtagtaaaactgtgggcttaacattttatgtagatagc
tgtggctgtgtttactgtaatgcagtgacaggccctgtttaattgctttgtgatcttaaa
tcataccttctaaactgcagcatctgtagattgttctccacctgtccgacatatacggta
catacaaattagaaaaaaatgtgtctttagaatgagcttgaggtaagatgaacagtcata
atcgcaaagatgtctgacgcacagagtttcaagttgggggaaaaaacccgtatttgactg
catttatcatttacctttatagggtccgcactatacagctcggtgagaaactaactgatg
cttataagagcagtgctgaaaaatgcttgaaaggcaactttgcaacaaacacatacaact
gacacatacagttcataaatatcgaatgtaacaaattactttccagacatgcaaaatgca
gaggaattgttttgcaacccaccagagggttgtgaggaacatgggtaggaggtctaaagc
agctgtttgtgggtagcctctttatttatatagcaccagcaagttatggaactctttaca
ttaaattataacatacagatcttaaatttaataaatgagttagagttaaaataggttcag
agtttagagtctatagggttagggtacatatcataaatcactgttttttcatattcccta
tattttataagttaatgt
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1041, 2434..2605, 2797..2903, 3158..3296, 3508..3632, 3794..3923, 4543..4699, 5037..5120, 5585..5705, 5893..6097
1027..1041, 2434..2605, 2797..2903, 3158..3296, 3508..3632, 3794..3923, 4543..4699, 5037..5120, 5585..5705, 5893..6033
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved