Xenopus_tropicalis Locus SSR4
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis SSR4
Xenopus_tropicalis
SSR4
scaffold_322
SNORA42
4553..4687
6151
GGGTTACTTACAGTCTGACCTTGGGCAGCACAAAACGTATAACAATGAGTTAAATACAC
CCAGGCAGGGCATTACTACAGAAGAAGAAAACCTGCAACTCCTGGGGGGCTCCCAGTGGG
CCACAAAAATACTGACCTATAAGCAAGTTCAATATAAGTTAATGAACAATATATGTTAAT
AAACAAAGTTTATTAGGCCCTAAAATACTGTAATATTTTAGTCATTCTTAACAGCAAGAG
TCCATTACTGCTGTAACCCCACCAATGATAACTGCCCCTTGGGCACCTTCTCCCTGCCAT
GGGCAGCTCAATTTATCTTACAAATCGGGAGAGCCCCCAAAGTCAACTAATGACAATCCC
AAGTGCGTCCCTTGCTCCGCCCCCCCAGACTGACCGGTTCAATCACAAACCACGCTGTCA
AGTGCCAAGCGTTTCAGCCAATCAGATGTATCGCGTTAATAGCACAAACTCGAAAACATT
TTTTGTTATAAGGCTACCTGCTGCGTTTGTCTGAATCCTGACCGGAGCGGTACGGGTGAG
AGAAGCAAGCGATAAGCTGCAGATATAGAACGAGATGCCATTCTTCAGCCGGGAAATGCG
CAGCCTGACAGCATGAGTTGTGCGCATGTGCAGAAGAGAGGCAATGACACGCACACAAGA
ACACACTCTGCGCATGCGCAACTTTACGTGCACGTAATAGGCGGGGCTTTCACAGACACG
TCATTGAAAACATGGCGGTCAAATTCTGCGAGCACAGACTAGAACTACCTAGTGTTTGAT
ATATACTGAGTTATTGTCATTGCAGTATTGCTATGATATGATATAACGTGGGGGTATACC
CCACGCCTTGCTGAATGATAAGCTACCCAAGGCGAGCTGTGGGTGACGTGGTGACTACTA
CGCATCCCGTCATGCAGTGCGCCTCACGCTGAGGTGGCCCAATCTCTGCCCCGCCTCTTT
TCTGGCCTTTTTCTGCGGGAGGGAGTTGGTGTCGTGTCTCAGTCGGAGCCATGGCAAGGG
TGCAGTGTGTGCTGCTGGCGGTATTGCTGGCCCTGGCGGCCTGTTCTGGTGAGTGTTGGG
CCGTACGTTCACTTATTTGGAGTTGTGCTTTATTAGTCGGCCCTAGCATTTATCTATTTT
GTTTTCATAGAACTATACGGCAGAAGCAATTCTTGCAATAGGTTGTCCGGGCCTGAAACT
GGTGGGAGATTGTGAAAGTTGTAGTTCCAGTGCCTGCAGGTTAGGGGGGCAGCAATGTTA
GTAGTTAGGGGTTTGCGCCTTATGATAGATCAGAAACAAATGGAAGGAGCATGGCAATGG
ATTTATGGGGGGTTTGCACAGTGGCCCCTACATAGTGTACCCCATGCAAAAGTCACATGG
CGCTCTCAACCATTGACTGGGCTTCTTCCCATGGGCCAGATCTCTGAATAGGGTGCTACA
GATGGGCCTCATTCACTGCAGCTCTTCGTGTGGCCTGTTAGCTGGTGGAATGAGCTCTGA
AATATGTTTTGACATTTGGGAGAAGATTTCATGGCAAAGATCCATGTGTGTTATTATATC
ATGGGCCTCATTCTGCCATTCACTTGCCTGTTTTACCCCATATCAGTGGGGTTTTTGTGT
GTGCTATTTGATGCCCAATATTTGGTGCAGGCACCTATAGTCTCTAAGACATTGGCAGTA
AGTTAAACCATATTCAACCAAGCTTTACATGCTTTATTTTGTGATGCTGGGTCAATATTC
AATGTACAGCCCAATTCATACCATTTACATAGGGGTTTGCGGAAAAGCTTGCAGCTTGGC
TAAAGGCCTGTTAGGGTGAAGACACATGGAGCTACTAGTAGCAGCTACTTGTCGTGGCTA
CTAAAACAGACAATGCTGATCATTTACTGATAACTGTCTGTGTTTTAGGAGAGGCAATTC
TCAGCTGCTACTAGTTGCTGTGTGTTTCTTTACTCTTAGGCAATGCCATACCTTGTGATA
AGGACTCCAGATTATGGTTAGGGCTCTGGCACATGGGGAGATTAGTCGCCCGTGACAAAA
CTCCCTGTTCGCGGGCGACTAATCTCCCTGGATTGCCATCCCAACAGCGAAAATGTAAAT
CGCCGGTGGGATGGCATACGCGGCGGTGCGATTTCAGTGATGGCATTTCGTGGGGAGATT
AGTCGCCCGAGACACAGGAGATTTGTTGCGGGTGACCAATCTCCCTGTGTGCCAGAGCCC
TTAACACTTAGAAGCAACAGGTATCCAAAGCAAATAACTGGGTGAGAACCCTCCAAAATC
ATATGTTTTAACTTGCAGAATCCCATAAAATGATCTCATGAGGTATGTAGTAATGTGGTA
TGACAACATCTGGAACTAATGTATGCATGGAACACTGAATCCCTAAAGGCATCACTAGGC
TGCTCTCATCTAAAGCACTGATATTATAAAAACATCTTTCCTTAAAGTAAAGAATCTTTT
TATTTTTGCCAATTATATTATAATCTTATTTTCTGTTTGCAGCGGAAACCTGCACAGAGC
CTGTTATAGTCCCTTCCTATTACACTACCTCAGATGCAGTGATCTCTTCAGAAGTGGTTT
TCATTGTGGAGATTTCCCTGTCTTGCACTAATGGTGCTCAGGTGAGTGTTTAACAGTGTT
ATTAGTATGCCCACTAAAGCACAGTACAGTAGCATGGCAATGGATTTATGATGAGGTCTG
TGAGGTGGCCCCTTCATAGTGTACTCCATGCTAAAGTGAGCTGCAGTTCCTAACCATTGG
CACGCCGGAATGGCCATGGGCTTGACCACTGAAGCGAATTGCACAGTTTTTGCCTGATAC
AATAGTGTAGATTGCTGCTAGCCTTGTTCTCTGCAGCACTAAATGGTGTATATACGCTAT
ATTAAATTTTGTTTTATTGATCTGGATAATTTGTTCCCCCCCTATATAGAATGTTGCTCT
TTACGCTGATGTGAATGGGAAACAGTTCCCTGTGACCAGAGGACAGGATGTTGGGCGCTA
CCAGGTAAGGACACAATCTGTAGATGTAAAATACCATCTAGTAGAACTGATATTATAGGA
GTAAAAATAGTGATGGTCTCCATGTATGAGAGAACCAAATTTCAAAGCTTTACATATATG
ATAGGGTCTGTGTTCTATTCTGTACTCCATGCAGTAAAATAGTACTGCTCCGAACCATTG
GCAGGATGCTTTGACTGTAGACCTGCCCACTGAAGTGAGCAACGCAGCTCATTATTTATT
ATATATTAGAAATCAATACCAAAGAATGATATATATTCTATATTGTGAGCTGCTATTTTG
TTGCTGTTGACCAATGTAAAACAAAGGTAGTCCAGTCATGCTTTAATTTAAATATTTCTT
GCATGCAATAAGGTATTTATGGTCATTAAATTAATCTGCGAGTTGTTTGTGAGGACAATG
ACTTGATTTTAAAGGGATCAGTTGCAGTTAGTATTCTTTTGTCATAGAGTTAATGGAGCA
GGCATTAAACAAACTAGGTAGATGTAGCAGATGACTGGCACTGATATCTTGCGTGTACTT
GACTAGCATCCTAGCTGCTAATGTAATGCCTCCTGTATTTAGGATGCTGGGCCAGGATGA
TTTTTTTTTTTATTATTTTTTTTTTCAGGTCTCATGGAGCCTGGAGCACAAAAATGCCCG
CTCTGGAACATACGAGGTGAAGTTTTTCGATGAGGAGTCCTACAGTCTGCTAAGGAAGGT
CAGTTCAGGAGTTGATATTTTGCTCTGTGCTGGTGAATAGACCTCATGGTTTATATTAAT
AACAGACATAAATATTTCTCTCTCTCAGGCGCAGAGAAACAATGAGGATATCTCCTCTAT
CCAGCCTCTCTTTACTGTCAATGTTGATCATAGGGTAAGTTTAAGCTTATGCTTCATTCT
GGGAATCCTTGTTAAAAATAAACTACTTCAGCACATTTTTGCAATATTTAATAGCATTTG
CATCATGTAACCTCCTTTTCAAATGCATATCTAGTCCTCAGTACCTGTTTTGGGAAGGTT
ATGGCACATACACCCCCCCCTCCTTTTTTTTCTTTTTTTTTTTTTTTTTAATAAGTTTGT
ATTTAAGGTTTTAACAGTTTTAACAACAAGACTGAAAAAGGGAAAGATAGATAACACTTC
AGTGCGCCTGGCTAAGTGCCCCATACTTCATTAAACGGTGCAATAAAGGCTTGGCCTTCC
TCTGGATCAGAGGGCCAACCTGTTTATCAAGCAAACTCTCAATCTGTTTAGCTTCCACCA
TCCACTGACAGCAATATCCTTTCAGAAGGTGCTGGTAGTTATAATCCGGCAGCAGCTGAA
GGGCTGCAAAATAACCATAACAGTAGACAGTTCACTGCCAAATGGGATTTTATGTTCTTC
ATAAAATGGTTGAGAAGTGCTAATGTATGTGCTTTAGATGATAGACCGTTACTACTGAAA
GAAGTAAAGGAGATGCAATGCATTTATTATCTGCACCCATCAGGTATCCGTTCTGTGGAA
ACTTGTCCTAGAGTACACTTTATGGTTTGGTGTAATTGTCAGGGCAAAAGGAAGCATGGT
TATGGATTTATGGTGTGGCCCACACATGGCTACCTCATAGTGTACCCCATGCTAGATCAA
GCTGCTGCTCCGAACCATTGGCAGGTGTATATCTGTGAGCCTGATCCACTGAAGAGAGCT
GTATAGCTGTAACCCTGACAGGCCTGTATAACTGTAGTCCTGATAGGTATTACAAAATAG
GGTTCTTTGTAATGTGTGAGAGACTTCTTACCCTAATGTGATTGTTGGGCTCCCCAAGAG
AAATTCACTAAAAGGATTTTGAGTCTGTGATGTGTGTTCTACCACAGTAAATGTATTTAA
ACTATCACATACTTGTTTATACATTTCTTAAAAAGGAGCTTTTTTTATGTGTTTAAGATC
CTGTCAGTCTTAGCATTGTTTATTCTCCAGTTCTACATCACTTCTCTTTTGTGCTACCTG
ACTAGAATGCAATGTTTAGCTGCTTAAATACTTATCCCATATGACGTGAATTTATTTATT
ATTTCAGGGTGCATGGAACGGTCCTTGGGTATCCACAGAAGTACTGGCAGGATTGATAGG
CATATTGGTATATTATACAGCATATACTGCAAAGAGCAGCATCCAGGCTTAACCAGAGAA
GAGGGTTGGGGAAGGGAACGATGGGTCTCGGTGTACAGATTTGTCTTGTGCTTGTAATAA
AATTTTCTACACACACACTGCCTACATCCTGTCTCTTACATCCTGGTTTCCATAGAAATA
CAGAATCTAGAAGCATAAGTTATTCTATCTTTTCTGCCCTTTTAAATGAGGCTTTTCAGT
TCTTCTGTAATTGCTTTTTGTTTTGCCATGTGTTTTGGGATCCCTTTATTTTTGTCCCCT
CTCCATCCGATGCTTTCATATAATATTCTCCAAAGAATCATATTTCCCTTCCAGAATCAT
TCTTCCAACAAATGATTCCCTCCTGAAAAATATTAACTCACCCCCTTGTTCATTCTGAGC
TGTGCATATACAATCTGCATTTTCCAGAGTGCTCTTTTGTTTATTTCTGTTGCTTTCAAG
TCATAGTCTAATAAAAAAAAATAAACATTCCTGATTCCTCAGGTTTGAAAGGAAACAATA
ATTTATCCTTGACTCATTTAAAAACCCCCATCGGCTTATACAACCCCTCATGGTGAACTG
ATGGATTCGGGGAAGTCTATCTGCTTTTCAGAGAATCTGTACCACCCATTATGGGAAGCC
AGCAAACTTCATATTCTGTCAGTATGTTCCCCTTGTGTATCCTAAATACTGCGAAAACAA
AGGAACTGGTTGTCGATTTTAGGAGAAATAAGACCGACATTGAGCCACTCATTATTGATG
GAACGAATGTGGAGAGGGTTTCGGTGTTTAAATTCCTAGGAATGGAGTTGGAGGACGATC
TGACTTGGAGTGCAAACATCAAGGGGCTGTTAAAGAAAGCGCAGCAGAGGCTGTACTTTC
TGAGGATTTTAAGGAAAAACCATCTTCCTAAAAATCTGCTTCTTGCCTTCTATCATTGTT
CCATTGAAAGCATACTTACATATGGATTATGTGTGTGGTTTGGTGGCTGCACTTCTAAAG
ATGCAAAAGCACTAAATAGGGTTGTTAGGTCG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1067, 2502..2620, 2929..3003, 3628..3717, 3808..3873, 5047..5151
1001..1067, 2502..2620, 2929..3003, 3628..3717, 3808..3873, 5047..5148
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved