Xenopus_tropicalis Locus EIF4A2
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis EIF4A2
Xenopus_tropicalis
EIF4A2
scaffold_319
SNORD96, SNORA63
5057..5126, 8787..8917
10552
GATTATACTAGGTAACTGTTTTGCACAAGTTATTGAACGAGGATTTTTAGGTAGCCCTA
AAAGAGGGAGGGGGTGGTAGAGACTATAACATTTAGTGGCAATATATATTTGTTAGGGGC
TGAGTGTAAGGCCTTCTTGGTCGGCTTTACACGCGGGCTTCTTCAGGGCTCTGCGAATTC
CCGGAATCTTGTGCCAAATGCTGCAGGGTGTTGTAGTTGGGTAGTAACTAGAAGCGGTAT
GGCGAGGTGTTCCTGACCGTAACGATGCCCTGCTCTGCACATGAGTAAGCTTTGGGAATG
CGGCTATGTCTTTTGGTTGCGGACCTACGCACAATTTTAGAGCGAAACGGTTTGGATTCA
CCTAAGGGCTGTGGCTCTCATCCGCAGGGTGGGGAGGGGGGGAAGATGGCGCCGGCAGAA
CATGGCGCCATGAATTGTGAGCACTGTGCGAACGGCGCAAGAGCTTGGCTGTATGCTTCG
CTACGGTTACTAATTAATTTGATAGGTAATTGTTATCCTGTGATAGATATATACTTTATT
GGGTACAGATGTTAAGTAAGCAACTGTCCCATCACTGTTAAATGTAAGCAGGATACTGTA
GCAGCTGCAACATCTTGTTATGCCTGTTAAATGAATGTAACTGCAGCAGCTGCCTTCTTT
AGGCTGTGTGCCTCTTATACATCAACTTGTATATATGCATGTGCCAATATAGCTGCTGCT
CTGTAGCTTGGGTGGTGGTGTATGTCCGTTTGCTTAAGGCAAAGACATGACTTGAAGTGC
ACTTGTGTTATTCTTCTCAGAGACCATGGAGGCCCTGATGGTATGGACCCCGATGGTGTC
ATTGAGGTGAGCATAATGCTTATTTCTCCTTTTATGTTAAATTCTGCTTCTCACTGATAA
ATAACTGGTTAACTTGCCATTGCAGAGCAACTGGAATGAAATTGTTGACAATTTTGATGA
CATGAATCTTAAAGAATCTCTTCTGAGAGGCATTTATGCTTATGGTTTTGAAAAACCATC
AGCCATACAACAAAGGGCAATCATTCCCTGTATCAAAGGTAAGAAAAGTTCACATCTGAG
TAGGTAGAATAAAAAGCTTCCCTTAATACAAGTGAGATGATGGCATACCATCTTTCGGGA
CTGAGTTGATGTGAAGAGTTTTTCTGTTTTGCTGATCACTTGTATATTATGTGACTAATA
GTTAAAGTGCCAAAATAAAATGTGGGAACATTGAATGTGTATCCTACTTTTTTTAGGGTA
TGATGTGATTGCTCAAGCTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTATTTCCAT
CCTGCAGCAGCTGGAGATTGATCTCAAGGAGACCCAAGCTCTAGTATTGGCCCCTACAAG
AGAACTCGCTCAACAGGTATTGATAGGCTAGTATGTGCTGCACAGGCTTCAGTTTAATAA
CTAAACACACTAGCGAACGCTTAATGATAAAATACTGAATATCTAAAGGGAAACTATCTG
TTTCTTTAACTGATGTAGCTAGTGGTGCATAAATTTGTTGCAGTATTATGGCAGGGAAAT
TAAGTTAAACCTAAAGCAAAGTGTTTTCATTTAACCGTACTGCTGATTATCACTAATAAG
CCGCCATACTGTGTCCACCCCCCGTTTTTGTGTAGTAGTAGTATAATGAGCAGTGATTCT
TAAATGTCATTATCTGTGCTACTTACTTATTAAAATATACTACTAAGTAACTTCACAGCA
AAGGATTTTTTTTAACTCTTCTTCCTACCATTATGGTGTTTACTTTAGTTTTCTTAGGCC
CTTGGGTTATAATGACTAAAGGCATGATCTAAGCAGTCATGTATCTGGCTATTTAAAATA
TCCTTAAGGCTGCAGTTGCCAACAATGGCAGACTGGTCCAAAAGGCCAGGCGACACCTGA
TTTAATATTGCTTCCTAAGGGGCATACTAATTTGAAACCATAGTGACCTTTGTAGTAAGA
CTTGCACATTTGTTTAATGTGCTAAATAGGTGTGGGTAAATGTGTATATAAAGTCTCTAA
GAAACATGGCTTTCTGTGGGAAGATTACCCAGCCTCCATTAAAGAATGTTTACTCCATTG
ATTAACTGTAATCTAATGAAGCTAATGAAGATGTGCTAAACTAAATTTAGTGCATTAGCC
CATAGCAACCATTTGGCAGTGACCATTTTCTAACAAATTAGAACATCAGATCTATTTGCT
GACTGGCTTCTATGGCTAATCGCACTGATGTGGTTTGAACAGCTAGCAGATCCTTAGGGC
CACATTTACTAGTCTGTGCTGAAGTGCTGTACCTGGCTTCTTGAGTTGGTTAGGCCTAGA
ATTCATGAACCTTTGTAATATGGCTTGAACATACTACACATGCATTAAGGGTGTGGTTTG
CCAGCCAAGCTGATGGCATCAACCATATTTGAACTGTTCTACGACAAGGGCTTTGGAGTG
CAGTACTTATGCGTATCATTTTAGAATCAAACATGACTTTTTTTTTTTTTTTTTATAAAA
ATTCTTGTATCCCTGTCAGCAATTACTAACCATGCACTCTACTCTCCCTTTCACAAAAGA
CTTTAATGAAGCCCCACAGCAATTATTTTTACAGTACTTTAAATCCTCTTTAAAGACCCT
TAGATTATTATTTGTGCACCTCTTTCTACATATTAAAATATTGACTTAAGTGTCCTGTAG
TGTAGCATATCTGCACTGTAAGTTCCTCCTGTGGCATGGAAAAGCTTTTAATCTTTGTGC
ATATTTGACATATAGCCTATTTTCTGGTACATATGCACAGGACAATCTATGCAGCTCTGG
AATTAATGTTGACGCAACATATTCATTATGGCTTTTAAACTCAAATTACAGAATGTGGTA
GTTTCCCTTTAAAGGACTCCTTCCCCACAAACTCCTGTATGAAAATGCAGTTTTAAGAAT
TTTAAAATCCTTTTGTTTTAAATGTAGTCTTGTTTATACCTTTATGTTATCAGGTTCTGG
CACTTGAAGCAGCGTAGAAGTCATTATGCTATATTGTTTAAAGACAGATTTTAGATTCTT
GATAGACACAAAGGGGTTCCAAGCTTAAAGTGAAACTTTCTGCATAGTCCCACCATATTT
TCAGATGTTTCAAATTTCCCCCCAGTGAGCATGTGCAGATCTATGTAGTGACATTGTGAT
GGGGTGAAAAGTACAGGGAATATCTGGGAAATCTTATAAATTGTCACTCAACAAAAAGTA
CCTCATACACCTGCCTAGTGACTTGGCTTTCATTGTCCTGGAATACATTGAAAGGATGCT
TAGTACTGTTCATTAATTCTATCCAAATATCTTTTGGTTAGAGGACCCCTTTAAGGTACA
TCACCATGGGTGTTTTTGCTGCTTCGTTTTACAGTGTGGATAAAAATGGGTTGCAGTTGC
AAGCTTAATGTCAGTGTGCAAAGCAGTAAGGCAGTGTTACGGATAACTATATTCCTGTTT
TCATAACCCATAGCAACCAAGAGAGCTGTTAGCTCTGTATGGTTAACCCTAAACTGTCAA
TTTGTGCTTTTTCTTTTCTATCCATTTAAATGAAACAAGCTCATTCAGTTGGGTCTTCTG
AAAAGTGCATAAATAGCTTCTCTCCATGCTGCAAGAACCAGCTCCCCATTCGCCTTAAGC
TGGCCATACACGCGCCAATCGACGAAAGACTCGCGAGGCTTTTTCGCCGTTTTCCCAAAA
TCGCCCCGCCGCGTCTGCCATCCCGCCGGCGACTTGCATGTTCGCCGGTGGGATGGCAGG
GGAAAGCAACTCGGGGAGATTAGTCGCCCGCGAGCAGGGAGTTTTGCCGCGGGCGACTAA
TCTCCCCGTGTACCAGAGCCCTAAAAGATCTTTATTGGGAGCCTGAGCAAAATCTGCCTT
CAGAGCTTAATCGCCAGAAGGAGGTAGAAATCCTATTGTTTCTACCTCCATATCTGCCGT
TTCAGCCCTGAACGTTAGTGGCCGATTGGAACAATCCGTGTACCACCCACTATGGAAGGT
AAAGGACTTAAATCCATCACTGGAATAAGGCGAGAAAGGGCTTGCATTGCACTTTCCCGC
TAAGGGAAAATTTGGCAATGATTTGCCCATGTAATCATGAAACCAGCCTGAAGTCTTGTC
GTGGTTAAAATCACAAATCTTTGGTTGCCTTTGGCTATTAGAACTGGAGTACTGTCATGC
ACAGACCTTGTGTCCTGCTTTGCTTAGTAAGATTCTTACTAAAGCAAATTCTGATGCTGG
CAAAACCCTCTGCAACACTGGTGCAACAAAATTCCCATGGAGATATTAAAGTGGAAAACT
AAAGGGTGCACTACATGCATTCTCTGCAGTTCTGAAGAGAGCTGCAGTGCATATAGTATC
CAGACTGAAATGTATTGCTACATGTGACATTTATTGTAAATGTGTTTTGATCACTTGTTA
AATTGTGGCAATAAATATTAGATTAAAATCAGGTGACTACAGTTAATAGCTGTAACAAAT
ATTCCTTTAGACTGATATACATATTTCCCTTTTAAAGCTTATTGGTCCATCTAGACACCA
AGTCAACTGGAAAGGAAAAAGTGACAGACAAATGTGTCATGTGAAGCAGTGCAGTATAAA
CAGTTTGCAATCAGACCTTTAAGATATGGCAGGGACAAATTGCCTGTATATAAGACCCTC
ACTTTGCATATTCAGAATTCCTACCCTAATTCTTGACAAAGGCTGCTGACCTGAAAAATG
TCATCCTATATAACAGAAATTTAAGAAAACTATTCCTGCCTTTCCTTTTGTCATCAGTAT
TGTACACTTGTTCTGAACAGAGTTCATAAAGAAACTAAAGTTTTGTTTTTTTTTTCTCTC
CTAAGATACAGAAAGTTATTTTGGCATTGGGTGACTATATGGGCGCGACTTGTCATGCTT
GCATTGGAGGCACAAATGTTCGAAATGAGATGCAGAAGCTGCAGGCAGAGGCACCTCACA
TTGTTGTTGGCACACCAGGGCGTGTGTTCGACATGTTAAATCGAAGATATCTTTGTAAGT
CACTAATATAATCTCTAGAGCGAAGTGATGGTATACCATCTTTCGGGACTGAATCCCCTG
ATGACATCTTAATAAAACTGATCGCTCAAAATGTTACTTATTATTGGTACACACTTATCC
TTGTGTAAAGGAAAAATGTATCTTTTTTGCTTAATTTTATGATCATTAACCAATAAGAGC
ATCCCTTCCTAGAAACTTTCTAACTACATATTTGTATTATCAGGGCTGGCTGACTTTTGT
TAACAATATAACATTTGCTAGACTGAAACTGGATGGTGAATATCGGTTTCCTAGGCTTGC
CAATGTGGGAGGATAATGGTCACTGCCTGTAGATGGCTAGAAGTGGCTTTATTTACCTGA
TGGGCAGATTCTGTTATGCTGTACAGCAGTGCTGTCCAGATTCAGGCTGTAAACCCCCTG
TATTGTTTAAAAATGTAATCCCCCTGTGGTTTTCACACCTGTTCACCCCCTGGGTTGTTC
ACACCTCGGGTTCAGGCTGTAATCACCCACATTGTTCACCTGTTCACACCTCAGACTGTA
GGAGCAGTAGAAACCCAAAAATAAACCCTGCACACTAAAAAAAAAGAACATATACTGAGG
TGGTACTGCAATTAAAGTTTTTTAATATAGTAGTAATGCTGGCACTGCTTCTACAGTCTG
CAGTCACTGTAGGCTCTGTGTGTGATACTCTGCCTGCCCTATGCTGCCTGTGTGTGCCAC
AGAAGTTGGACAGCACTGCTGTACAGGATACGTTAATGATTCTGGATGGCTTTAAAATGG
TCACAATGCCCAACCATAATTTGTACCTCCATTACTGGGACATGGTCAATAAAATCCCAT
AGTAAGTGTCTGCTCAGTCCCTCTAATGCAGGGTTTCTAAGAAATAGCCAGTAATGCAGA
TCAAACAAGAACATTTTGACTTAAAATGTTTTAGTTGTGCCCTCCCATTGATACCTTTTT
CCTTTCAAACTCCTTGTGTTAATGTTTGAGCAAACTTTCTTTTTATACAAGTCATGTATG
ATTTGTGATTCTTTGTGTTACAGCTCCCAAATGGATCAAAATGTTTGTTTTAGATGAGGC
AGATGAAATGTTGAGTCGTGGGTTCAAGGATCAGATCTATGAAATTTTTCAGAAGTTAAG
CACAAACATACAGGTTGGTTTTGCTCTGCTTCTGCAACTGATAAATTTTGCATCTTTAAA
AGTAACTAGTACACAGGGCACTGACATTTCCTTAAGTGAATAAAGAGATGCAAAGGTGGA
GGGGCATGCTTGTGCAGAATGCGGTCTGTATTGAAAGCTGGCCATGAACATGATAAATAA
AATATCTCTGCAGCCTACTGGCTGAGTTGTTATGGAGCATCAGCTGGTGTATGGCTAAAT
TTGTGTAATAAAACAAGGCTGAACGGTTTTGAGAAAACAGATATGTAAGCAGTGGCTACA
TCTACTTCCACATAAATCCTATACAGAGTATATGCATTCAAATGCATATAGATGGGGGCA
AGATTTATATAGCAGGAAGTGGTTTTTTTTTTTCTACATTTAATTTTAGTGCTTATGCAT
CTCATCGTGGAATTTCTGGTGGCTGTCTTTAGTGGTAGAAAGTAGATTAAGGCTGGATTT
ATGATCTTTGGGGCATCTCGAATTTTTCAGTCTAATTCATATCATTGCCTGTTGCTAGGT
TCAGGGACCTTTGCCAGACTGCTTCCTGAATTACTAATGGGGATCTACTGAGCAAAATGA
AAAGCTATAAATGAAGACCAGTTAGAAGTTGTCATTGCATATTCTGGCCTTTGTCTGCAT
CATGGAAGTTTAAAGGTGATTAAACTTGACTGAAACTTTAGCTAAACTGCACTATCCTGA
AATTTTTTTTCTCTTGATGCAGCTTTTTAACATAGGTGACCAGTAGTGTCTAGTTTGGAT
TGCATTGCATACGATGTGTGCCTTTCTTGAAGCAGAGGTTCTGGTGCTTATTGCACTTTT
GTATGGCGGAACCTCCTTTTGTCCTTTGGCCCATTCTGTACAGATTAGTGAAACATAATG
TCATTGCTTTGCTATTTTTTAGCTTGGAAGAGCTTTTATTTTTGGTGCACTAATATATAT
TTTAAAATTGGTGCTTTATCAACATGGCTGGAAGCTTGCCTAACTTAGCCTAATTTTAAT
TTAAGGCTTTGTAAAGTTAAGTCCCACATGCTGCCAAGGGCTGTGGTCAGAACTGTAAGG
TACAGGATACTTGATGTAGAGTATTTAATTTCTAGCATTCTTCCTGTTCAAGCATTCTGC
TGTAACTGCATTTCTTGGATTTGTTCTAGGTCTTGCAGTGATGCCAGCAGAGTAACTACA
GGAAGTAGAATATATGCACTGGTTTTTGGGATGCTGATGAACCTCTTTCTGAATGTTCAG
TATCTTCTGTCCCAGAGATTTAGTGCTACAGATTATTTAAATACTGTTTTTGTGCACTTA
GGTTAGCGCAAGTGTTTGTTAATCCCATTTTTCTTAAATTTAGGTGGTCCTGCTTTCTGC
CACAATGCCAACTGATGTGTTGGAAGTGACCAAGAAATTCATGAGGGATCCAATTCGCAT
CTTGGTGAAAAAAGAGGAATTAACCCTGGAGGGTATTAAACAGTTCTACATTAATGTCGA
ACGAGAGGTGAGATATTTCCTATGGGAGAACACTAAAGCTGGCCATACATGCACGATATC
ATCGTACGATTCATTTCGTACGATATTCGGTGCATGTATGGCGAGTCGACCGATATCGCA
GGAGGCTGCTGATATCGGTCGACTTGCCAGTCGGGCAGGTTAAAAGACTTTGATCAGGCA
CCTGAGCAAAATCTGCCGTCGGGCCTGAATCGGTAGGAGGTAGAAATCCTATTTCTACCT
CATCTGTTTCAGCACCTGAAGGTTAGTGGTGGATTTAAAGGAACAGTAACACCAAAAAAT
GAAAGTGTTTTAAAGTAATTAAAATGTACAGTTGCCCTGCACAGGTAAAACTGGTAAGTT
TGCAACAGAAATGCTACTATAGTTTATATAAATGAGCTGCTGTGTCAACAAGGGGGCAGC
CATTGAAGCTGGGAAAAAGGAGAAAAGGCACAGGCACAAAGCAGATAACAGAAGCTTTGT
AGAATATAATGGGGTTTTATTTGTTATCTGCTAAGTAACCTGCCTTTTCTCCTGTAAATG
GCTGTCCCCGTGGCTACACAGAAGCTTTATTATATAAACTATAGTAGTCTTTCTAAGGGA
AACACACCAGTTGTACCAGTACAGGGCAGCATTACATTATATAGTAATTACTTTTATACA
CCATTTTTTGGTGTTACTGTCCCTTTAACAATCTTTCGTGGTCACACGAAAGATCGCAAG
TCACCACGTGTGTGGCCCACCTTTTTAGATCTGTAAGCTTTGGTGTATGTGAAGTCCTTG
TAATAAGGGTATAAGTAGAAAGTGGAGCGCAAATGCACTTGTATCTGATCTGTGGGGAGC
AACATTACTTTTATTGAAAAGATAAGCTCTTTTCAGTCCAACTTACAAAATTTGTCACTG
CACACTAAAAACTTGTCATTTCATTACAGGAATGGAAGCTGGACACCCTCTGTGACTTAT
ATGAAACATTAACTATTACACAGGCTGTAATTTTCCTTAATACTAGAAGAAAAGTTGACT
GGCTTACTGAGAAAATGCATGCAAGAGACTTTACAGTTTCTGCTCTGGTAAGACTTTAAA
CATTTGCTATGGCTGGGCTGCTTATAAATGCAGGATAAGTTACAATATAGCTGGGCAGTG
CTGTGTTGTCGTTCCCCCTGCAAAAAATAAACTGCTTCCTACTATCCCTGTCTGTTTTGA
CACTACCTCAGCAGACAGGGACGCTTGGTCTCAAACAGTGATTTTTTTTTTCCAATATAA
ATATAGTAATGTACTTCAATCTGTTACAGCATGGTGACATGGACCAGAAAGAGAGGGATG
TTATTATGAGAGAGTTTCGTTCTGGATCCAGTCGTGTATTAATCACCACAGACTTGCTGG
TAGGTGTTTAAATTACATGCAAACCTTCCTTGGTAAGTCTGCACAAAGTTATGCTTTGCT
GAAATAGGCTACAGGTGAGACACAAATGTGCACTATTTAAGTTGTGGGCAGAGATAACTG
AATGCAGCATATTACAGTAATGAACATTCCTTTAAATCATCTGTTAATCATTTTCCAAAG
ACTTAAAACATTTTCATGATGGTTCCTCATACCAGATGGAAAAAAGTCATTTGGTATATT
AAGACCCACATTCCACAGTGGATTACAGTGTTGTAATCCACCACTATATTGTGGCTGACA
AACCTTTTCTCCTCAAGCCAGTGTGAAATGGCAATTTGTGCCTTTCAACAGGCTTTATAA
AATACATGAAATCGCAAGTAGTGTAAGTTAATGCATTTTATTATACCATTAGGCTCGTGG
CATAGATGTGCAGCAAGTTTCCCTGGTTATAAATTACGACTTGCCTACCAATCGTGAAAA
CTACATTCACAGGTCAGTGACTATTTGAAATCTAAACTTCTGCTGTTCTGCCTCAAATGT
TTGTACGAATTTAACTAGTAACAATGCACCCTTTCCTATAACACCATAGGATTAGCTGGT
GCCAAAGCATTAAATACCCTTCCAAAGTTACATTATGGCTGCTTTGTGATGTAAATTTGT
CTTTTGGAAGCTGCAATTTCTGCAGGATTAGTTACAATACATCTGTGCAGTGCTGTGTTG
TCGTTCCCCCTGCAAAAAATAAACTGCTTCCTACTATCCCTGTCTGTTTTGACACTACCT
CAGCCGACAGGGACGCTTGGTCTCAAACATTCATGCCATACTATTGGCAGTTGAACTGTA
GTCATCCACAAAATTTTTACAAACAATTTTATGTTTAAATAGTTAAGGAGCAGAATACAG
CTGCTCCCGGACACAGCTGAGAATGGGCCTATGGAAGTGGCGTCTTTCTCTTGATCAGAG
AACACACACTTCCGGTCGTGGTCTGATGGCAGCCAGTGGAGCATGGATCAAATCTTTGTA
AAGGTAAAACATTTTGCTTATTTGAAAATGTGCACTTCAAGCACAGTACCTAGAGGTATT
AATGCCTTGGCCTTTATCAAAATGGCAAAGTTTTGACTTGTTTATGCATTTAAACACTTG
AGAATTTACACTAGAATTTTGCCTTTGTTTACATTTATACCTGGTGGGGTCTCTTCCAAA
ACGCTTCCTGCCACTTGGGTCTTAACTCAACAAATCCTACACTTCATTACATAATGAGGA
CAGGTTTTAGAGGGTAAATGGAGGTAGCTTTGATAAAGCCATAAGGTAAAATCTCATGTA
TGCTTTGCATAAGAAACTGCAAACATGTAGTGTAATTTTGCAGTCTTCCTTTAAAATCAT
TAAATTTGAATATCCATTCTAGCTCAGTATTAGTATGTTGACCTGTTAACAATGTTTAGC
TGTAGTAAGCTTTGTAAGTGTATAGTCCTTACACTTCCAAGACATTCTGATAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1057, 4865..5033, 6083..6192, 7543..7686, 8609..8746, 8969..9058, 9472..9552
1001..1057, 4865..5033, 6083..6192, 7543..7686, 8609..8746, 8969..9058, 9472..9552
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved