Xenopus_tropicalis Locus ENSXETG00000013038
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis ENSXETG00000013038
Xenopus_tropicalis
ENSXETG00000013038
scaffold_298
SNORD14, SNORD14, SNORD14
3161..3256, 3947..4042, 4982..5077
11970
ATGTTGGTTGTTTTGTAAAATAATGTAGTTGGAATTTACCTCTACCAAACCCCGCGTAG
TATTAGATGCAGAGTGTATTCATAGCCGGGTTTGCTGAAGTCCGCACACAACGTAACCGT
GTAATGTTTTGTCCACTTCCATTTCTAGTGTATGATCATGGCTGCCGATTTTGTTATATC
TATTTTTTGTGTGATTTGTAGAAATATATAATTTACGGAAACCCCTTCCCATACGCTTTG
CCGAATCCCTGTAGTCTGTAAATTAATTTGTACGGTTGTTACTATGTTGACGTGCATTAA
CGTATATTGAAAATGCGGGTTGGATTACTGCTTTAAAGCGACAACCTAAGCCCTGTGACT
TACCCGTCGCCATTTACTCATGGCTTCTGCAGTCATGTGCGTTTGTTCTGTCACTTATCA
CGTGTCTGCGTTCCAGCCCAAAATGGCGGATTTCTTCTGCAGTGCGGGACAAAATGGCCT
ACCGCGACCTAAGTGTGGGGGTTGAAGTATATACAACCTTTTGTTCTTTAATGGCTGCTG
ATAAATGCTACTGTTTCTATGGACTCTCGGCAAATGCAGTGGGTGTTAAACTGACTCATG
TTCTGGCAAATGCAACCTTCAGCATCTCCTTACTATTTATAGTGCAGAAATATTGTATTT
GAAAATACATTCTTTTTACCAGTCAGCTATTTGATATGTATGTCAGTTTCTAAAACAAGT
CTGCCATGTCAATTTCCATATAGTGAACCATAAGTAAACCAGGTTCTAAACCTGTGGATT
GTTGGCGTGTAAGATTATGGGGTATCATGTAATAAACATTCTCCTAAATACTGTTGCCTT
TTAAGGAGTTTAAGCGTTGTCCCAAATTAGAGAGCCACTGGGTTAAATTTTTACCTGCAG
ATTGTAACTTGGATCTTTGCTATTGTATCTTTTGCTACTGTGCTTGGTTTAACCTATTGT
GTTTTTGTTTTTTTGTTTTTTTTTTTATAAATACAGCAACAATGTCTAAGGGACCAGCAG
TTGGAATTGATCTTGGCACCACTTACTCATGTGTGGGTGTCTTCCAGCATGGCAAAGTGG
AAATCATTGCCAATGACCAAGGAAACAGGACCACACCTAGTTATGTGGCTTTTACAGATA
CTGAGAGATTGATTGGAGATGCAGCTAAAAATCAAGTTGCCATGAACCCCACAAACACAG
TTTTTGGTAAGGATAATATGAGTCTATAGCAGTGTTAAGTAGTACTGAGACTTTTATAAT
ACATACTACATATGAGCAAGATGCTAAAATATCAAATTAAAGGTCATGCAACCCAAAATA
TTGTGCCTGATAGAACATAATTCTAAGCAACTTTGCAGTGTACAGGTTTGTAGGAGTTTT
AATTTTTATATTGCTATAAAAATCTTTGTACTTCTATTCTCTGGTGGCTCTAAATTTTGA
AACAATGTAACACAAGCCAGCATATTGACAGACCTGTCTTGTTGGAGACTGGCTTTTGCA
ACATTGTTTATAATAAGTCATAACCATAAGGTGAGCAAACGAATAGAATTTCATTTACAA
ATAACATTTAAAGCACTAAACATTTTTTTAACAAAACATTTTTAATGCTAGAAAGCTGCT
TAGAATTCCGTTTCCTTTTATTAGAGAAACATTGTCCTTTAAGGTTACTGGGCAAAAACA
TGAATGGATTACTGGCTATAGGTATAGAGCCATGTCTATTACAAGCATTACATTGTGAAT
ATTGTGACAGTGTAGTTTTGTCACTGACCAGCTTTAATGGTTCCTGTAAAAGGACAATGC
TTCATTAAGTCAGTTTATACTAGCTGAAACAGCTTAGCTTTTAATCAGAATTAGCCTTAG
GCATACCAGTGCCCTTGCAGGAGTAGAGTTCAGCAGATAAATCCTTTTGTGTTGTATTTC
TTTGCACCATGAGGCAACTGACTTTGAAAGGGGTGTGTAGCTGATATTGGATACCTAGGA
TAAAGGCTAAATTTTAACCCTTTTATGATAGGGCTATAAATGCACCACATAGACTTTCTT
AATGCAGTTACATTTTTTTTCAGATGCCAAGAGACTCATTGGCCGCAGATTTGAAGATGC
AGTTGTTCAGTCTGACATGAAGCACTGGCCTTTCAATGTTATCAGTGACAGTGGAAGACC
AAAGGTCCAGGTAGAATATAAAGCAGAGACCAAATCTTTCTATCCAGAGGAAATATCATC
TATGGTCTTAGTTAAGATGAAGGAAATAGCTGAAGCATACCTTGGCAAGGTGAGTGCCTT
TTGGGTTATTTGTAGCTTTGTGCAATACAACTCCTGCATCTAGAAAGCTTGTAGGTTCAG
GACTGCTTTAACCTGATCGTTCACACCTTTTTGACTAAAGGAGTCTTTATCTCCCTGATA
ATTCAAGGTAAAAGAATACTGCCATTGTTTTGATCTGGGTTGGGTAGACTAATGTATTCA
TTGCAGAGTTTTTCTTCTAAAACCATGGTTTTTTAGAACAGTTTATATTGAATTGGTGTT
AGAATGTTTAGTTATAAATTAAGGCCTTTATTTAATATTGAATGTGTTTTTTTTTTTTGT
GTTTTTTCCTTTTACAGACTGTAACAAATGCTGTAATTACTGTCCCAGCATATTTTAATG
ACTCCCAGCGACAGGCTACAAAGGATGCTGGTACTATATCTGGGCTGAATGTACTGCGAA
TCATTAATGAGCCAACTGCTGCTGCCATTGCTTATGGACTTGATAAGAAGGTATAGATCA
CTAAAACCTACTTCCATAGTAAAGGGCTCAAGAATGTGGGAGGGTGGTTTACACTGCTTA
GTGTTAACCTGAGCAGTAACAGCAACAAGCCTGATAGCAATTTAGTTGGCTGCAGGTAGT
GAAACCAAACATTTGGTTGCTGTTGGGTTAGTGCCCAGTGATGTAAATTATTCCCATTTT
TAAATAAACTTACTGTTCCCTGTAGGTAAGAACAGTCCGTAAGCTTGCTTAGGTTCGTTA
ATGTAGCAATAAATCCTTATCTGCTTGGGTGCACATATTTTTAAACAAATGTTGATGTTA
GTGAGATTTGCTACATGAATTTGTCAGCCATACAGAACTGCATTTATTCAAAATGATTTT
TTTCAGAGTTGGGTATGGAGCGCAAGGCTTCCAGTCACTGATCGCTGTGATGAATTTGAT
TCCAAAGCCATTCGTAGTTTCCACCAGATGTCGCAAGACTTATGATGGTTTATTACCTTC
CTTGGATGTCTGAGCGATCATATAGGCGGTGCATTTATGATTGTGCGGTGTCCTGATTTG
AAGCTTATAGTAACTTTTTTTTTTTTTTTTTTTTCTTAAGGTTGGAGCAGAAAGAAACGT
GCTGATCTTTGATCTTGGTGGTGGCACCTTTGATGTCTCCATTCTAACCATTGAAGATGG
CATCTTTGAAGTAAAGTCTACCGCTGGTGACACTCATTTGGGTGGTGAAGACTTTGATAA
TCGTATGGTGAATCACTTTGTTGCAGAATTCAAGAGAAAGCACAAGAAGGACATCATTGA
CAACAAGAGAGCTGTTCGCCGTCTCCGTACTGCTTGTGAGCGTGCAAAGCGTACGCTCTC
CTCCAGCACTCAGGCTAGCATTGAAATTGATTCTCTCTATGAAGGAATCGACTTCTATAC
CTCAATCACCAGAGCACGTTTTGAAGAACTTAATGCTGATCTCTTTAGAGGTACCCTTGA
CCCTGTGGAAAAAGCACTTCGTGATGCTAAGCTTGACAAGTCACAAATACACGATATTGT
ATTGGTTGGTGGATCCACCCGTATACCTAAAATCCAGAAGCTGCTTCAAGACTTCTTCAA
TGGAAAGGAGTTGAACAAGAGCATCAACCCTGATGAAGCTGTGGCCTATGGTGCAGGTAA
AATCCATAGCAACTTTTTTTTTTTTTTTTTCCTCCCCCAGCCGATATTTGCTAAGATGAA
TATGATTCCAAAGCCATTCGTAGTTTCCACCAGATGTCGCAAGACTCATGATGGCTCTTT
ACCTTCCTTGGATGTCTGAGCGAATTTTTTTTAAAGTGCAAAATGTGCCGTCTATATACC
TCCCTTTCTAAATCCACTTTTTTTTTCTTAGCTGTGCAGGCAGCCATCTTATCTGGTGAC
AAGTCAGAGAATGTTCAGGACCTTCTCCTGCTTGATGTTACACCTCTGTCTCTTGGTATT
GAGACAGCCGGTGGTGTCATGACTGTTCTGATCAAGCGAAACACAACCATTCCCACAAAG
CAGACACAGACTTTCACAACTTACTCTGATAACCAGCCTGGAGTGTTAATTCAGGTAAGA
TATTCCTATTTCCACTCAAGGCCTAAGACAGCTATTTATAAAGGGACTGTTCTAGAAGGA
TATAATTTTACAGGCCATCTCTATCTATCTTATAAAATATGCATGGCTGCATAACCCTGA
CAAATCCTGTGAAGGCTTCAAAACTTGTTGCTTTAATCGCCATTTCTGTATGGCATAGCT
TTAACCTAAATAATTTCTGAACTTGTCTTGCAGTAGCAACTCTAAACAAGGCTACTTGTT
TAGCTGTAAATACCTTGACATGTAGGCCTAAAATACTTCTCTGCAGCAGGCAAAAATGTT
CAGCAAATTATTGTGGTAACTTTTATTTAAGGTGAATGACCTGTCCTAAAGGTGTGTGGT
GTTTTTGTTTTTTTTTTCTCTACATGTGCTTTGTATTGTGCACTTCCTGGTTAAAAACTT
ATCGTTCTTCCTGCACAGGTGTATGAGGGTGAAAGAGCAATGACCAAGGATAACAACTTG
TTGGGTAAATTTGAGCTGACTGGCATCCCTCCAGCTCCCCGAGGTGTTCCTCAGATCGAG
GTGACATTTGACATTGATGCCAATGGTATCTTAAATGTGTCTGCTGTTGACAAGAGCACA
GGAAAGGAGAACAAAATCACAATTACCAATGACAAAGGTAACTTCCTAAGCTATAAAGAA
AGTCGCTATGATGAACTTGATTCCAAAGCCATTCGTAGTTTCCACCAGATGCCAAAAGGC
TGATGATGGTCTAGCACCTTCCTTGGATGTCTGAGCGACTGTCGGTTTAGACCAAACTGC
CTCTATGTAGTGCTAACATGTTTGGTTTATCCTGCTGTGTATGGAAAATATATATATATT
TTTTTTTTTAAGGCCGTCTCAGCAAGGAAGATATTGAGCGTATGGTTCAAGAAGCTGAGA
AGTACAAAGCTGAAGATGAGAAGCAAAGGGATAAGGTATCTTCAAAGAATTCCCTTGAGT
CTTACGCATTTAACATGAAGGCTACTGTTGAAGATGAGAAACTTAAAGGAAAAATTAGTG
ATGAAGACAAACAGAAAATCCTGGATAAATGCAATGAAGTTATATCTTGGCTGGACAAAA
ATCAGGTAAGTGAAGACAAGCTGGGGGGGGGGGGGGGCTGAGCAACTTAAATCTGTGGTT
TGACAATATTTCAAATTCTATTTTTGTAGCCTGGATACTTGATGTCTGACTCGTCAAATA
TCGGGTATCCAGGCTACAAAAAATAGAATCCTTCCCTTCCACCCCCCCAAGTCCCCTGTA
GAGCAACCAAAGGACTTCTACAAATGTGGCTAACTCATATCTGCTCTTTCAGACTGCAGA
AAAAGAAGAGTTTGAACATCAACAAAAAGAGCTGGAGAAGGTGTGCAACCCTATTATTAC
AAAGCTATATCAAAGTGCTGGGGGCATGCCAGGTGGTATGCCTGGTGGCTTCCCAGGTGC
TGGTGGTGCCCCATCAGGAGGAGCATCCTCTGGTCCTACTATTGAAGAGGTTGACTAAAT
AAAAGCTGCATTCCACTTTTTTGTCTTGTAACTCCTAGGACACAAATTTCGTACTAGCTG
TTCAAATTTTCTCATGTATGCTGCTGTATGTCAATTTTGGGGCATTAATACTTGAATTAA
CTCCAAAAGTCAGGAAAACCATAGTATCTGTACTGTACAAACAAATTGGGTCCAGACCAA
TAAAATGAATTGAATTGGCTCTCATTTTGATTTTTCTTTATTTCCCCCCCCCCCCCCCCC
CCCCTTAGGTCAGCTTTCCTGGTTTAGGAAGTAAAAGCTATTCTGGTCCTTAAGGTAGAT
AATTGGGTTACAGTGCACAGAAAACAAAGTAGCTTGTGTAGCCCAGAAAACCATAAGAAG
TTTGGTGTTTAAGTTTGTATGTTCCATACAAACCTGGTTCATTGAAACTTTTAGAGATGA
ATCTTGAACGTCTGCAACCCTGTCTCCAGGGTTATCTGGTTAATGCCATATGAAGGATGT
TCTCTGCAAGATGTAAAACACTTGGCAAGAGTACACTCCATGCGGTAAAAATGCCCCTAC
CTGTGCCTGCCTCTGAACAAATTAAATACATTTGGGTGCAGGCATGTGTTGCGATGCCTG
ACGAGAATGTAAAGTCTTGCATTTTATTGCGGATATTGGCTACAAGTTTGCACCAGAGCA
TATTCCATTCAGTTGCAGTCACAAGGTAGGCATGTTTTTACAGTAGTGGGGAGAATTATG
CTCTGTGTGGCATGCCTTCAAGTAACTGAACATTTATTTTTCCTTAGGAAAGTCAAATAC
AGCTTTGATTACTGGGTAAACGAGGTTGCTATTTAGGTGAATTAAAGTCAGGTTGGACAA
ATACCTATTAAAGCCAGAGTGTTTCTCAACAAATTGTGCAATTTATCCAGAGTGACATAC
CATTTCTGTCACTACTTACAGATGCAGTAGCAGGTCACATTGGTTTTTACAGCTTACAGA
AAATGCAATGTGTGACATCTGTATGACTTGGTGGGCTTCCCAAATGCATGACTTGGTGGG
CTTCCCAAATGAAACAAGAAATCCTTTGCATTCATGCCAGTGTGTGTCAGAAATTCCCCC
CAACCCTTAAGGCAGAACCTGGGATTGTTGGTCCAGATATTACAAAATACTTCAAGCTGG
CCAACTATGTCAAAGTAATCCCTGGTCTGCCCAGTCCTACACTTACCCCTCACCCCATGT
AAGTACTTACTGGGATAGCCCCTTCCACCTACTCCCATCAGAAGGACCCTCCCCAAATAT
TTAAAAGACCAACCACACCCACTTACTGGCAACTTTTTGGTCTTTCTGCTTTGCTGCTCC
TAGAAGCAAAAAAAAAAATCTCTTTAACCTCAGGAAAGCATTGGACCTGCCCATAAGGTG
TCCAAGGGACAGGGTTTATTTTTTTTTTTTTATATTCCCTACCATATTACCTCATTATTT
TGGAGTTTTCTGGCCTCTAGCTCCTGGGTCAAGTAGGGCACTGTTGTTCAATGTTGGTAG
CAATGTCTGCCCTCCCCCCTTTTTATTTTTCTTTGTTCCCAAAGTAGGGAATGTGTCTTT
TCAGTGGAGGAAAGGTTCATGGCTAGCTGCTTCTCAACAGACTTTCCTAATGCTAAGGTG
TTCTTTAAAAAAAAAAAAAAATAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTAATAGCCCAA
CCTGGCAACCCAGGCTTTTATTGTCCTGTTTTTTAAGCGACTGGCTCTGCATTATCTTAA
ATATATCTGCGGTTTTGCGTAATGCAGTGCGACTATTTCTTAAAAGTAAAGCTTCCCCCA
AACAAATATGGACAGTTCAATCGAAACGGAATCTTTGTGCCGCTGTGGAACTTTCTAGAA
GATCGTGCTTTCTTCTATCATGTGCTCATGGGGAAGCGCTGTGATTGGCAGGCTACTCCC
TACGTCGACGTTTTACGACATTCTGTTCTGGAACCTTCTAAGCCGGTATATAAAGCAGCC
GGCAGAGGCGTTCGTTCTCATTGCAAGCTTTACAAGCTCGGAGACGGCGAGCAGCTCATT
TAAAACCAGTCGTCCATATCACATTACTGAGAGGTAAAGGATTTATAACTTCATGGCTCT
ATAGTCTTTTTTCCGTTTATTTGAAGGTTAGAATATTAATGTTTAGATACAATGTTAACT
TTTAGTTTTATAAACCCGAAATTTGTTCACGTATTGGACAGTGGTTTTGTGTATGTTGGT
TGTTTTGTAAAATAATGTAGTTTTAATTTACCTCTACCAAACCCCGCGTAGTATTAGATG
CAGAGTGTATTCATAGCCGGGTTTGCTGAGGCCGCACACAACGTAACCGTGTAATGTTTT
GTCACTTGGATAAGTAAATACCTTTTAAATACATTTCTAGTGTATGATCATGGCTGCCGA
TTTTGTTATATCTATTTTTTGTGTGATTTGTAGAAATATATAATTTACGGAAACCCCCTT
CCCATACGCTTTGCCGAATCCCTGTAGTCTGTAAATTAATTTGTACGGTTGTTACTATGT
TGACGTGCATTAACGTATATTGAAAATGCGGGTTGGATTACTGCTTTAAAGCGACAACCT
AAGCCCTGTGACTTACCCGTCGCCATTTATTCATGGCTTCTGCAGTCATGTGCGTTTGTT
CTGTCACTTATCACGTGTCTGCGTTCCAGCCCAAAATGGCGGATTTCTTCTGCAGTGCGG
GACAAAATGGCCTACCGCGACCTAAGTGTGGGGGTTGAAGTATATACAACCTTTTGTTCT
TTAATGGCTGCTGATAAATGCTACTGTTTCTATGGACTCTCGGCAAATGCAGTGGGTGTT
AAACTGACTCATGTTCTGGCAAATGCAACCTTCAGCATCTCCTTACTATTTATAGTGCAG
AAATATTGTATTTGAAAATACATTCTTTTTACCAGTCAGCTATTTGATATGTATGTCANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCCAGGCTAC
AAAAAATAGAATCCTTCCCTTCCACCCCCCCCACCCACCCCAAGTACCCTGTAGAGCAAC
CAAAGGACTTCTACAAATGTGGCTAACTCATATCTGCTCTTTCAGACTGCAGAAAAAGAA
GAGTTTGAACATCAACAAAAAGAGCTGGAGAAGGTGTGCAACCCTATTATTACAAAGCTA
TATCAAAGTGCTGGGGGCATGCCAGGTGGTATGCCTGGTGGCTTCCCAGGTGCTGGTGGT
GCCCCATCAGGAGGAGCATCCTCTGGTCCTACTATTGAAGAGGTTGACTAAATAAAAGCT
GCATTCCACTTTTTTGTCTTGTAACTCCTAGGACACAAATTTCGTACTAGCTGTTCAAAT
TTTCTCATGTATGCTGCTGTATGTCAATTTTGGGGCATTAATACTTGAATTAACTCCAAA
AGTCAGGAAAACCATAGTATCTGTACTGTACAAACAAATTGGGTCCAGACCAATAAAATG
AATTGAATTGGCTCTCATTTTGATTTTTCTTTATTTCCCCCCCCCCCCCTCCCTTAAGTC
AGCTTTCCTGGTTTAGGAAGTTAAAGCTATTCNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNATATTACAAAATACTTCAAGCTGGCCAACTATGTCAA
AGTAATCCCTGGTCTGCCCAGTCCTACACTTACCCCTCACCCCATGTAAGTACTTACTGG
GATAGCCCCTTCCACCTACTCCCATCAGAAGGACCCTCCCCTAATATTTAAAAGACCAAC
CACACCCACTTACTGGCAACTTTTTGGTCTTTCTGCTTTGCTGCTCCTAGAAGCAAAAAA
AAAAATCTCTTTAACCTCAGGAAAGCATTGGACCTGCCCATAAGGTGTCCAAGGGACAGG
GTTTATTTATTTTTTTTTTTTATATTCCCTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1205, 2063..2268, 2597..2749, 3340..3895, 4111..4313, 4758..4956, 5172..5404, 5632..5743, 10885..10970
1001..1205, 2063..2268, 2597..2749, 3340..3895, 4111..4313, 4758..4956, 5172..5404, 5632..5743, 10885..10967
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved