Xenopus_tropicalis Locus TGas012o17.1
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis TGas012o17.1
Xenopus_tropicalis
TGas012o17.1
scaffold_285
SNORD20, SNORA75
9606..9682, 10257..10393
12745
GTTCTTATAACACAATAACAAATGGTGTTGATATAACACATGCACATATACATATATTC
TTTTTCTTTACTGACATTAAGAGGCAGATTTATCACCATGTGAGTTTATAGTTTAATACA
TAAAAACTCACATTCTATTTAATCCTATGAAACTTTTAGAAGCGTATGTATCAATGTGTG
AATGTTAGAACTCACCATTTGACAAATACATTTTTAGGAACCCTATAGGAATGAACAGAA
CTTGACTGAGTTTGTAAGTATAACGCTCAAAACGCACATGTTGATAAATCTGCCCCTATG
AAGGCGGTCCCTGACCCGCAGAGCTTACAGTCCACACAAGAGTACTTAGTCTCTGCATGG
TAGGTAACAATACCAAACACGAGTCAATAAGAACTGCTTATTTAAAGTGGACTATGAAAC
AAGTATTTCTTAAAATAGCACAAGCAAGGTAATAAGCCCCCGCAACCCCCGCGGGTTCAG
ATAGATAAGTTAGAAAAACAGAATGTATCTCGCGTTGGGTCTTACTCGCCCAGTTATTTA
CCAATAGAAACATAAGTCACTATATAAAACGTACACGATTACGGATTTCACTATACAAAA
CACATGAGCAACAATATGAGTCGCGCACACACTCTGTGTGAAACACGTGGGACGTGTACG
CTTTACCCACCATCTTGGTAGAATTTACCAAAGCACATGGTAAGCTTACTCAAAATGGCC
ACGAAACCCCACAAGTGAACGCCGATTGGTTACAGAGATCGCGACCCTGATCACGGATTG
GTTCGCCCGCTCTGGGGGGGACAGAACACTCAAGAATTTGCGTTCCAACTTAATTTTTTA
GCTCGTGGTTGGTCAGATCGTGGCACGTACTACGATTGGCTGCTGGGTAAGGGCGGACCT
CATACTTTCTTAGCTTTGCGTGGATTGGTTGCTCACTAGCACGTGATAAGAAGTCTTTAT
TAGCACCTTCGCCAAAGATTTGCGTTCAGTCGGTTCCTTGTTGCAGGGGCATCGTGTCGT
CTGGATCCTAGACACGTGAATTACCATTCTCTCCCAAACACAACACCGGCCACCATGGTG
AAATTAGCTAAGGTAAGGATATTTTTATGTTTTTTAGTTCGATCGCTCTTGTCACAATTC
CAATATATGATCAATCTGTGCCTGGAATCATTCCGCCTTTTTTCATTACAATACACTAAA
CAGTCACACCGAAAATATGCGGACATTGATAAAAGGTCCGCATTTATTTTACATCGATAA
CCCCCCGTGGCACTCGAGTAAGTAATAATGCCATATAGGGTACCTGTCGCGATAAGCCGG
GTTAGCCGTAAGTATGGAACGAAGACGAGAAAGGCGGTGGGTTGCAGGATGACGCATGCG
CAGTGGCTACCTTTGAGGCGCGCTTAGGCGATTTTGCTTTACGTAACTACAACACGTGAT
AGTCGTGGGGCGGGTAAAATGGAGGTGTGTAAGTAATTGAACGTATAAGTTCGTCTTTCG
CGTTATATAGATTAGCTAGTATGTTGCTACCAAGTTTATCGAACCATAGTAATTGGTTGT
AGTTTCCTGTGGGTCTGATTGTGCTTGCCAGCGTGACGGCGCCATTTTGGTTCAGGTGAA
AAGGCGTGAGACGTGGCCTGACTTCCGGAGCCCACACGTGGGCCCTGACCCGTCTGGCAC
ATGCACGTGGTACCGTGGGGTTGGGGGGAAGTGTTCAGGGCAGGCGGCTGCGTGTGGCGT
GTCTAGCGATACTTGCTGCCATTCTGTGAGAAGGCTCCTGTAGCAAGCTGTGTGTGTGGG
CGCCATACGCGGGGAATTCGGCCGGGAGACTATAAAAGGGCACGTGTGGGTTATGCTACA
CGTGGGGCAGGGTGTCTGTCTGCTCTCCCGGGGGAGTGGCCACAACCGCTGTGTCAGGGG
AACTTTGCCACACGCTGATCAGTTTATCTGCTAAATGGTAGAATGCTTGTTCAGCTCTGC
CAAGCAATATCTTTTAGAATCAAACCTGTTGCTTTTTGAATGCATAATTGTTTAGCATAA
TGTTCCTTTGTTAATGCGTCTGATTTTGTTACACAAAGGCTGTGCTTAATGTCTGCGTAC
CCACTGTTGCTCTAAACTTCACGGTTAAGACCGATATGCTGTGAAATATACAAAAATTAT
TCAAATGTTTATTACAATTTTTTTTTTCCTTCTTTCTATCCAGGGTGCAAAGACACAGGC
TAAGCCCAAGAAGGCGGCACCACCACCCCCAAAAGATATGGAAGACAGTGAGGAAGAGGA
GGACATGGAAGAAGAGGACAGCAGTGATGAGGAGGTGATACAATTGTAGAGAAATTAAAT
GAGTTGTAAAAGACTACACTTCAAACAAAGAACAAAGTATTTGCTGTGTAAAGCTTTAGG
CTTAATTATATATTGTAAATGCATTAATAATACTTCATCAGCCATGCTAGTGGCAGTAAC
AAAATATATAATATATATATATTGATCTGTCATCCCAGGGACCAAGCATGGCATAGGGTT
AATTTCCATATTTTAACTCTAGAAATAACAATCCATAGCAGCCAAGCAGTTTGGACATTT
GTTGGTAGTTCACAAAGTGGTTTATTTTTCTAATTGGATTATCATATAATGAACAAAACT
GTTTTAGTATATACTCACTCTAGCTCAATGATCCCTAATCAGTGGCTCGCAAGCCACATG
TTGCTTGCCACCCCTTTTGATGTGCCTCCAAAATATGTGCCCATTCTGGCTTTGCGGCAA
GTTTCGAAAGCAGTTTTCTGTAGGCTAGCATTCCACAAGCGAATACCAATTTGCCATCGG
TCCTTATTTGGCATCAGATGTGTAGCTCATCAAACATTTTTTACACGTGCATGTGGCTCA
AGCGTTAAAAAGGTTGGGGGATCCCCTGCTCTAGATCGTTTCTGCTCACCCTGGTGATGG
GCCTGCATCTGTTTCCCTAATGCTGCTTCTAACTTGTATGTAAGGAGTTCTGTGAGTGCT
TGGAACATCACAAAATGGTTGTTCAAGGTAAAGCATGTACAAGAGTTGCAAAAAGAACCT
TATCACCTAGGAAACCTTGGCATTGCACAGTAGAGCTTATCGTGTGCAACATTGGTACAC
TAAAGCTGCTGTTCTGCACTTGTATGCATCTTACATTAATTAATTACATTGACCCTAATC
TAACTACCTTTCTTGCTTTGGGTCCATTTGTCTGTGTAGATGGAACTGCCTGTAAAGAAG
ACACCAGCCAAAAAGGCAGCCACTCCAGCCAAAGCAACATCTGCAAAGGCAGCCACTCCA
GCTAAAGCTACAGTCACACCAGGAAAGAAGGGAGCAACTCCAGCAGGAGCCAAGAATGGA
AAGCAGGCAAAGAAACAAGAGAGTGAAGATGAGGAAGATGACTCTGGTATGATTCTACAG
AGTTGAGCAAGTGTATAGTTCTCTACTAGGGCAGTTTTACCTGAATGGCATGTTTATTGC
AGATGACGAAGCTGAAGACCCGACACCTATTACAAACAAACCAGTTGCTAAGAAAGCTGT
AGCAAAAAAAGAGGAATCTGAGGATGATGAAGAGGATGATGAAGGTAAAGATTTAGTGGC
CAGGAAGGACCTTATTTAAAGGTGCAATTCATTGCTTGGTCCTTTTCATAGTTTTTGGAT
GCTTTATTCAGTGGCTGTTTTCAACTAGGCAGTGGTTTGAATGACATTGTTTCATTAATA
AAAGAGCTATAATTAAATATACGTTAACTATAAAATAGTTGCCCCAGCAAAGAGGGAATT
TGAGAACTATAAAATTAAAACATTCTAATAAAACCTTCTATACGTGCAGTACACCTGTGG
TTACGGAATGCTATGCAATATCCCCTTAAATGTTTGGTGTAAAACCCTTCTCTTAATTCA
GGTTTTGGATTATTTCCTAACAAATTTTAAGTGCTTGTTTGATGCTCAGTGTTGTAAAAA
CAGTTATTTTGTTTTTTAAAGATGAGTCTGAGGAGGAAAAGCCAGTTTCCAAGAAGCCCC
TTGCCAAGAACCCTCCAGCTAAAGTTACACCTGCAAAGAAACCTACTGGGAAGAAACAGG
AATCTGAAGATGAAGAAGGTAGTCTCTATTTTGAAAGTTATAGGTTTTTATGCTCTGTCA
TAATGCTTGATTGTCTAATGTGCAATTTTTTTTATAGATGAGTCTGAGGAAGAAAAGCCT
GTTGCCAAGAACCCTCCTGCAAAGAAACCTGCAGGCAAAAAACAAGAATCTGATGATGAA
GGTATGTGTTGTGATAACCTAATACATGCTCAAAGTAATTCTTTCTGGCATATGTGATGA
GCATTATGGGACTTAATTCTGAAAACTTTGATGTCTTACACTTGCTGATATGCATTTAAA
ATTTGGAGTTATTGCTTTATTTTTGTTAGACAATACTGGCCACATAATTGGTAATTTAGT
CGTGACCAAATTGTACCCACTTTCTTGATAGAATCTGAAGATGATGAAGACGAGCCTATG
GAAGTTGCACCAGCTCTAAAGGGGAAGAAAACTGTCCCTGCCAAAGCAGATGAGGATGAC
GATGATGATGATGATGAGGACGACGACGAGGATGACGACGACGATGATGATGAGGAGGAT
GAGGATGACGAAGAACAACAAGGTGGGTTTTTCAGTCAATGTGGTTTCCCATGCAATGTG
GTTTCCCCACCACTAAGGAACTTTCAATGTATTTTTGTTTACTTTACTGTGCAGTGTCTG
CAAAACGCAAAAAAGAAATGCCAAAGACTAAAAATATTCCTGAGGCAAAAAAAGCAAAGA
CAGACACATCAGAAGGTATGTACAGTTTTATTTTTTTTTTTTTTTTTTTGCAGCAGTTAT
ACAGCAAAAGTTTTAAAATTGCAGTGCAGATATATATGCCTTAAGGTTACTTTTTTTTTT
TTTTTCAGGATTGTCCATTTTTATTGGCAACTTAAACGCCTCAAAAGATTTTGATGAGCT
TAAAGATGCTCTGAGGGAGTTCTTTTCCAAGAAGAACCTAACTGTGCAGGATGTAAGGAT
TGGAAACTCAAAGTGAGTATCTTCAGATTGGGTTTTTTTTTTTAATCTTTGCATGTGTTT
TCAAAGTGATTCATACTAGCTTGCCTGTTTAGAACATAGATTGAACATAATGTGAGGGTC
AGCCCCAACGCTGCAATTAGTTTTCCATTCGTTTTGACAATGGTTCCAGGTGCAAGCACA
CGCTGCAGATATCTGCTGCAAACTCGTGTTTGAGTGGTTCCAGATGCATCTGTTACTGTC
TTGCAAAGATGGTTATTTTATGCCCTACTATATATTTCTATTTGCTCAGTCTTTTTTTTG
GGCTGATGCTGTATAAAAATGGTTAGTGTTGGAACAATTGTGCATATTTGCATAAATACA
CAGAAGCCACAAGTTTATTATGCTGAAGATTTATAGAAAAATATCAGTTTCCCTTTAAAA
AAAAAATCTTTTATCACAGGAAGTTTGGTTATGTGGATTTCTCATCTGAAGAAGAGGTTG
AGCAGGCTTTAAAGCTGAGTGGGAAAAAGATACTTGGTTCAGAGGTGAAGATTGAGAAGG
CTATGGCTTTTGACAAAAACAAAAATGCTGAAAATAAGAAGGGTATGTAGTATGTTCTCT
TACAATATCTTATTGATGTCTGACTGCCACTGTTAACTAATCTTTTGGTGTTTGTAGTAA
TCCTTTTGTGCAATGTTTACTTTGACCTGAGAAGACTTTGAATTTCTTTGTAAAGGTGTT
AGTTTTAGAAAGTTTCTCTTTCCTCTGTTTTCCAGCAAATCTTAAGTCACCCCCTATGCA
GAAAAGGGGGTTTTTGGGTACCAGTATAGAATAGTGATCTCACAATTCAGAAGTAGACTT
AAGTTTGCTTATATAAAAAAAAAATCTCAGGTTTTCCACCTAAGGGTTTTTTTTTATTCA
TGCTCCATGCTTAGTCTACTACGCACCAGAAATCCAGTGGGTTTGTTTTGCCACAAATTT
AGTTAGTGCATTTTACGATGACTTTGATACTGAAAACATATACATTTTCTTTGCAGAGAG
GGACTCTAGAACTCTGTTTGTGAAGAACATCCCCTATAGCACAACTGCTGAGGAGTTGCA
GGAGATATTTGAAAATGCTAAAGATATTAGAATTCCTACTGGCAAAGATGGAGCCAATAA
AGGGTAAGACTGAAATTCACCTGACATACAGAGGAACAGTCAAAGCTGAGTCATATTTTG
CCTTTGGTTATGTAAGAGAATTGGGACGCCCCCCAGCCTTTCCTCGGGGGGACTTTTAGT
TACCCAGGAAAACAATATATCTCATTTTTCAGGGCAAACTAAGCTTTCAAAATTTTTGGT
AGAATTTTGGTGTAATTCCAATTCTGTAACAAGATATAGGCTTCTAAATGCAACTTATTT
GGAAAGTCCCATGTCTCCTGAACGCGCCAATACCAAATATATAGTTTTATGGAGGCTTCT
CACTTGTATAGGTCAAAAACTCCCAACAGTACACTACCAAATTTCCAAAGCACTGCTCCA
GAAAGCTGCATACTTAACATTTCAAGGCCAAAAAATCCCACTAACAGAAGGTTTATCCCA
GAAAATTACACACTTCTGGAAAGAACAGATTCTGGGGAATCCAGAATAGGCACAATTGTC
TCTACTCCAAACTGCCAAGCTGCAATGCTTTTCTAAATTTATTGTTTATCAAAATTTGGG
ACCTTTGAAGCAATTTAAAAATATCAGTCTATAGTATCTTATAGGTCCTAAAGTATAGGT
CATAAAGGAACCAAATAAAACACCCTGAATATGAACACCAGGGGTCCACTGAACAGTTTG
ATGCCCAATATGTATAGGTTTACCCAAGTATGTGGCATGTAGGGGCCCCAAAGTGAACAT
ATCCCCGTTTGATCCATCATTACGGTCATTTCAGCTTCTGCAAAATCAACACGTTTACAT
TTATGTTCAATAAAGCTAGAAAAAAGTACGCTCACCCCAGAAAGTCATATATTTTTGGAA
AGTACACATTCCCCCTAATTTATAATGGGTACGCTTTTTGGACACTTTCTGATGAATTCA
AAATAGTTATTTTTCTACACCAAAGTTACACGTGGCAAAGCTGTGTTATAAACAGATCAG
GAATACTAATACAGGGATAAAAATGCAGTAAAACCACAAATTGTGCAAATTGGTGAAACG
ACAAAATAAGTCACACGACTTAATGTAATTAGTGGTCTGAATATCTAAGCCAATTGTCAG
TGTCCAAATGGTTTTTAGGGAAAAGGAACTAAAAACAAAGTGGTAAAAAAAAGTGTGTAC
ATGTGTAAAAGTTGTGTGACAGTGTGTCTATAGGTGTAGGTAAGTGTGCAATAACAAAAA
ACTGCAAAATAATTTTTGCATTTATACACTTACATATCAGCCTTGCCTGTCCTGAAGCTT
GCCTGCTTGTCCTTGTTGCTGCAGTCCTGGATCAGGAAGTCCCCCCCCCCCCAGGCAGTG
GGCCGGTGCTGGGCGAGGAAGCGGGACCAAGCAGCAGGCGCAATGCGATCGCATCTGTTG
CTTGGGGGTCGGCCCTGCGACAATGCAGGACTGACATTACAGCCCCCCTGGCTCGTTGCC
CAGGGCACTGTCATCGCTAAAAACTTGCACGTGCCGCTTCTGCAGAGTAAACTTATCTGC
CAAACAACATACGGCGCATGTCGTTGGCAGTTAAAGGTGTGTTTTTGTTTTAAAAAAAAA
AAAAAAAAAAAACCTCAAACAGGTACATCATTGAGCACTGAACCTCCCAATAAAAGTAAG
TCAGAGGAAGCTATATTAAGAGCGGAATGTGTCAAATCATGCCTATTTGAGGATTCAGAT
TCTGCTAAATCATTAATTGGCCGACGTATGTCCAACCTTTTTAATGTTTTGTGATTTTCT
TGACATCCGAATGACTTTTTGATAAGAAAATATTTTCTCTTTGGGTTTGGCAGGGTTTTT
TATGAAGGTTATTGCACCCTTACTGAACGTTAATTTACATATTTGAATTTTTTTTTACAT
ATTTGAGTTTTATGTAAAATGTGAATTTTGATCTGTTCCAGGATTGCGTATGTCGAGTTT
AGCAATGAAACTGAGGCAACCAAAGCTCTTGAAGAAAAGCAAGGAGCTGAGATTGAAGGA
CGTTCTATTTTTGTTGATTTCACTGGCGAAAAGAGCCAGAATTCTGGAAGCAGGAGAGTG
CAAGGAGGTATGTATGTAATCAGATTTCATGTTAATCTGTAATAGCCTGTAGTTGAGGCT
GGAAATTAAGTTTATTTCAAAACCGGCTTATGTGGCAGATAAGTGCTGTGCTTGAGTAGT
GATTTCAGTCAACTCAGATGTGTCCTTTTTAATACCTCTCTAAACTAGAAGTTGACTGAA
AGGGCCTTATGGATCTGATCTGAAATTTTTTTTTATACAAAATAAGGAAATTCATTATTT
AATGTACCTTAGATGCTGATTTCTACACTTTTTTTTTTTTTTTTTTTTTTTTTGTGTTGT
AGGTGATTCAAAGGTGCTTGTTGTAAACAACCTGTCATATAGTGCAACAGAAGACAGTCT
GCGTGAAGTCTTTGAAAAAGCAACGTCTATAAGGATACCGCAGAACCAGGGACGAGCTAA
GGGGTGAGTAATGGAAGGATTTGTGCACCCTGGTGCCATTAACCACTTTAGCCTAAGGTA
CATGTGTATGTAAAATGCCACTTTTGTCCTTATGTTGGCTATATTACGTGCCATGTTAAC
TGATGCATATTGAGGTGGGTTGTTGGCTGTTGGACTAACTTTGCATAGATTTACATTCTA
AGTGTGATTTTAATAAGTTGTGTAAGATTTTAATTGTGGTGTTAATGTGTTAATGCTTTA
TCCTTGTTTTTTTTAGTTTTGCCTTCATTGAATTCTCCTCTGTGGAAGATGCAAAAGAGG
CAATGGATTCTTGTAACAACACAGAAATTGAGGGGAGGTCAATACGGCTTGAGTTTAGCC
AAGGAAGTGGACCTCAAGGTGGAAGGGGAGGTAGGTCAAATCCCTCGCTTAATATTTTCA
GCTTTGGTTTGATTGAACTTTATTTATTTTATGGAGGGCATGACTTATTTGGTAGGGGAA
CTGAGAATCTGTTGTGTATTAAGAGTTCTGCATGTTTAAAGGAGAAGGAAAGTGATTTTG
GCATTTTACTGCCAAAAGATTCACCACATTAGTGCCACCTTGAACAATATATTTAATCTG
CAGAAAGCATTGCCCTAGAAGCTTTCTCTGTTTGCTTAAGACAGCAGCTGGCATTTTAAG
TAGCTTCTTGTCTGCAGCTAGCTGTTGGTAGCTCAGATCACCTATTCCTAAGGGAGTTGA
GTGGGAGAGCTTATCATTCTTCTGGGAGAGAGCTGTGTAGACTCTGGCCAGGGAATGAAG
AATCTTTCTGAGAGGAAGTCATATACCCAAAAATGTTTTCAAAAAAGGAAACCAGATATC
CTGTTCCTTTTGATAGAGGACTTGGTGCAGGTTTTGGAGTGCTTATGGCTGTATTTACAT
AGACCTTTCTGATTTTTACTTTTCCTTTAATAATCCAGTGGTTTTTACTGGTAGAGAATC
AGGTGCTGGAAGTGATGAGCTGTTATCTGAGAATTTTGTGATGAAAATTAACAATTTCTC
TAGATAGTCAAGTACTGATCCAGCATTTAACTTTTCTTAACTGAAACCGTTCCCTAGAAA
GCAAATTGCATAAGGGTTTTTGGATATATTAACTAAATTTTTTTTTTTAACTTAAAAGTG
CATACTGGAGCTACTCCATGTTTGTGGCTTCCTGAATCTTGTGCAGTAGCCAATCACATT
TACTACTAGTAATTAGATGAGGGAAATGTCAATAGAGATTTCTAAACGCTTCTCATTGTA
TGCCATTTTTTTTTATCTGCAAAATTTATTAAGCAGAAGGTTTGTTACTTGTTTAGAAGC
TGTGGACAAAATCTAATTTTTAGCCAATAAATGCATTTGATTTTAATTGCATGCTTTTAG
TTTGGCAATGAGAGAATCTTATGGAACAAAATCTACACCACCTTCAATTTTCTAGGTTCA
GCACAATCAAAAACCCTCTTTGTTAGAGGTCTTTCTGAAGACACCACTGAGGAAACATTA
AAGGAAGCATTTGATGGTTCTGTTAATGCCAGGATAGTGACAGACAGAGATACTGGAGCA
TCCAAGGGGTAAGCTAGAATATAGGCCATTCTGTGGAAAGCATAAGTAAATATTTAAATC
TTCCCATTGAGCTCTTTCCTGCCGGCAATTTATGGCAGTAGATGGATTCGCACGGGAAGA
ATATTAAAGGCACTTGCGACCTGTATCTCTTGCCTCTAAATAAACTGGCATGAAATGGTC
TCTGTGCAATATGTCTTTCTGCCTGGTAAAGCATTTATCTGCAAACTTTCTTGAACTTGC
CAGACTTAACAGTTTGCTCTGGTTTTTAGGTTTGGATTTGTAGACTTCTCCACTGCTGAA
GATGCCAAAGCTGCCAAAGAAGCTATGGAGGATGGGGAAATTGATGGAAGTAAAGTGACT
CTAGACTTTGCAAAACCTAAAGGAGATTCCCAGCGTGGAGGACGTGGGGGCTTTGGCAGA
GGAGGTGGCTTTAGAGGTGGACGAGGTGGCAGAGGAGGAGGAGGTGGGCGTGGAGGTTTT
GGTGGCAGAGGAGGAGGACGGGGAAGAGGAGGATTTGGAGGTAAATCATGCAGGATTTCA
GGCTATTAACATCTGCTTGCCATAAACTGTGCCAACTGAAACTGATGGTACTGGTATCTG
TTATGTTGGTATTGGTGGCGTTTGATCCCAGGTTCTTTGTCTATAAACTGAAGCTGTGTA
GAAATATACTGCAGGCTAAACAGTGGAGGGTTAACTATACTTATGTGCCCTGTAGACCAA
TTTTGCCTTAGTCCCTGCTCTTGTAGTGCTTTATGAGCAGGCACAATTTTTATCAGTGCA
GGATAACTTAAAGCATACAAACTCACTTTGGCGTTACTAAGATATTTTGTATGCGTTTAA
ATGAACTTGTTGCATTTTGCTTTAGAAACGTTAATATAGCTTATATAAACTGCTGTTTAG
CTGTAAAGTCTGCCATTAAATATTTGGGCAAAATTGCACAAGCTTACGTAGCGATTAACA
TCTCTGTAGAATACAATGAGTTTAGTTATTGCACAGATGTGGGTTAATTTGTCATTTATG
GTTTTCTATGGGTTTGAAGCAGTACATTAAAATTTAAAATCTTGTCAAATACAAGGTGCT
ATTTTATAACAAAAGGGCAATTTGTGGAATAAATCCAATATAGAGGGTCTAAGTGGGCTT
TGAGGATCAGTTGCTGGAAGTGATGAGCTTTTAGATGATGAGCTCTCTAGATAGTCAAGT
ACCAGCATTTAAATCTGCTTAAGCGTAATTGCATGAACTTCTCTAGGGCAAATTAAAAAC
AAATTGTAGAAGGGTTTCTGGAGGTGTTAAGCAAGGTAAGCACTTAAGTATGGTACATTT
TAACTTGGGCCAAATATAGATATAAACAAGCATGACCACTGGACTGTTAATGCGGCTTTA
GCCGTTAAATGTAAATTTTTGGTCCCCCCTACCCATTTCCTAATGTGTATGCTTTTGAGT
TGACTGACTTAAATATGCAATACTCTTGTTTTATCTAGGAAGAGGAGGTGGAGGATTCAG
AGGTGGAAACCAGGGTCAGGGAAAGAAGATAAGGTTTGATGACTGAGCAGTTTTTTCATC
TCCCCTTTAAACCTCAAGCCATCTCCCTGAAAGGACTCTGGGGCAGAAAGGGAGAACTGG
GTTCCCTACCCCAACAAGTCTAGCCTTGACGGAGCCTTCTGTGTGGACATTCCAATGTGG
AAATACATTTTTCCTGTTATCACCTGGATTCCAAGTCATTTCATGGAAGATGGGACTGCT
CGACTGTCCTTATACAGACTTTTTTTTAAAGAGTGTGAGAAGAAACCCTGCTGGGACTTG
GCAAATTCTTATGTTTTATCCACTGTACAAAAGATTGAGTTTTTTTTTCTTATTAATTCC
TCTAGTATTTTGCTCAAAGTGCAGAATGTTAATGGTTTGTGCTTCAGCAGCTTGTCTTGT
TCAGATTAAAGAACCTCATCTGGTTACCTGTTTTTAGTATAACTGTTTCCCGAATTCTCT
GCAGTTGTATGCTGGCTTGTTCTACTGCAGCTTTGGTGCTCACATCTTAGCCAGAAATAA
GATGTATGGTGCCCATTGCAAAGGTATAGGTAGTAAGGCAATAGAAAGTGGACATAGCAG
AGCTACTAAAGTGTTAAGTGTTATTAGATTTTTTAGAATGGTACTTGCCTTTACATTGAA
ATCATTTAGACTATTGCCATAGCTGTGTCTTGCGCAGTCTTATTCTGTGGTGGGTTGCTT
ACATATTGTAAAGTTTTTGCACTAATACCTTGAAAGTTAAATTTGTGGTATAATACAAGC
AGAAGTGTCTGCTGAAGCACGACTTCCCAACCTGAATTAAAGGAGCACTATACTCCCTGG
GCTATAAAAGCCCCCTTAACTATCACTGCCTTGGCCCCCCCACCCCCTCACTTCTCCATT
ATTCCATAGTTTCTAACTTTTAAAACTGTCACTATAACCCCAACCTAAAAGAGCAAAGAA
ATGCAGCTGCGTACCTGGCTGACTTCTTCCATGCAACTGAACAGTCTTTAGGTCTCTCCA
CCAACACATACCCTGCTTGCACGTGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1091, 2203..2313, 3219..3311, 3330..3405, 3482..3583, 4177..4260, 4471..4532, 4554..4641, 4734..4814, 4928..5051, 5479..5621, 6056..6182, 8081..8226, 8522..8642, 8896..9029, 10075..10207, 10469..10719, 11678..11745
1074..1091, 2203..2313, 3219..3311, 3330..3405, 3482..3583, 4177..4260, 4471..4532, 4554..4641, 4734..4814, 4928..5051, 5479..5621, 6056..6182, 8081..8226, 8522..8642, 8896..9029, 10075..10207, 10469..10719, 11678..11742
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved