Xenopus_tropicalis Locus BC090356.1
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis BC090356.1
Xenopus_tropicalis
BC090356.1
scaffold_280
SNORD94, SNORD94
8752..8892, 14088..14227
16186
TGAGAAGGCTTTGGGCACAGAAATCACTCACTGCGCTGAGTTAGAAAGTACAATTAACA
CTGAGGTGACAGGGCAGAAAGGGGCAACATTGGCTCCCTCACCCCCTTGCGGCGCATAGA
GTCGCAGTTTAACCTGCCGAGGGGCCAGAACAGGCAGTGATGTTGTGGGATAAAATGGCT
GTTATTCTGCTGAGAAGTCATTAACTGCTCATATCATGTAAGTGTAATAGTAATGTACCT
CAGGCACCAGTGTATGTGGTATAAGAACCTATTTGCACCCCCAAAATGAGCTAGGGGATC
ATAGGAGTTTGATTTGGATTCTCCTGCTTCACCCGTCCCTCCCTCCTCCCCCCCCCCTGG
TAAAGTTTAATGGAAAAGGGTCTATTTCTGGATTCTGTGTTTTGTTTTGTTTTTGTTTAT
TTCTCTTCTCAAATCTGCTCCTTGGTTGCTAGGATAATTAAACCTTAGTAACCAGTTTGC
AGTTTAAATTCCAAGCCTGAGAGCAGCAGAACACAAATGTATATAAATCAACACATAACA
ATCATTCCTGCAATTTGTCTTAAAATTCGGCCGCCTATTTCCCTTGCACCCAAAGTGCTG
CGACGTGGGCCTCACTGACAGGAGAGTGTTTCAGTGAAACAATTCTTGTTTATTGGTGCT
GCACAGAATGGTTCGGCCCAACCCCAGGATCCCCCCCTCTGAACAGGGAAGAATGAGACA
ACCTTGTCACGTGGTACCACTTTACCCTCCCAAGGGCAGTACGCGGAACTGGAAATGGAA
CGTACCATTCGGCCTCCATCAAGTGGGGGAAATGTTTATACACTTAAAAAATACCCATTG
CCCTGTGCATCTAGTACTACCGTAATATGGCGTTTGTCCTGTCATGCCATACACAGAAGT
AACTAAAAGGCAGCAGGAAAGCGGTTATGGCACCGAGGCACATAGCGGCTGTGTTTGCGA
ATGGTTCGGTCCTGGCGCTGAAGCTTCTGGCTGTCATGGCGGCGCCCTGTGTGCGGCTGG
GCTCGGTGCGCTGTACAGGGACGCTTCTCAGGTAGCAGGGAGTGTTGGCACAGGGTGCAG
GGGGAGGGTTTCATAGAGTTGTAGTTCTGCAGCTGGTTCTTGTGGCTCCCAAGCCCTGCG
CCCAATGGCTCCTTTGCACATAGCACAATGTCCTGCCTTGGGAGACTGATGCTGCTGAAC
TACAAGTCTCAGTGTCTGTGTTCCGTGTGATTTACTCAGTGAGCAGATTAAACCCTTCTG
GTGGTAGAAGGAATTCTGAGAAGGAACTAAATTTCCCATTCACATGGTGTAGGCTTGAGG
CTAAGCCTCTCACTGGGTTTTATAGCTCAGACATTCACTGATGCAGAACAGGGGGGGGTT
GTACTATGTACTAGACATGTTGTACCAAAGAGTTAGTGTATAACTGGTGAAACATCTTTT
TTCCCCCCCTTTCCCATTCAGGTATTTCTGTGGAAGTGCCAGACACCGAGCTGCTGCTGC
TAGTAAGTGTGGCTTCCCTTGCTGATACCTCCTCATTATATTACTATTATCACATTATAG
GAGAATTCCCATCAGCCCATCCTCGATTTCACCAAGGGCCTATAAAGTCCTTATCATGGC
TTCCTATTAAAGGAACCGTAACGCCAAAAATTAAAGTGTATTAAAGTATTTAAAAATATA
ATGTACTGTTACCCTGCACAGGTAAAGTTGTGTATTTGCTAGAGTAACATTACTATAGCT
TATATAAATAAGCTGCTGTGTAGCCCCGGGGGCAGCCATGCAACCTGGAAAAAAGGAGAA
AAGGCACAGGTTACATAGCAGATAACAGATAAGCTCTGTAGAATACAATGGGGCTTTATC
GGTTATCTGCTATGTGCCTGTGCCTTTTCTCTTTTGAATGGCTGCCCCCATGGCTACATA
GCAGCTTATTTATATAAATTATAGTAGGCTTTCTGAGGCAAACACCCCAGCTGTACCAGT
GCAGGGCAACAGTACATAATATTTTATACACTTTCATTTTTTGGTGTTACTGTTCCTTTA
AACAAAGAATATTTTACAAACTCCTTCTCTTAACCTTCAAAGCTCCTCATTCCTCTTCTC
CTCACTACATCTCTTCCCTTGTGTCTCCGTATGTTCCTGGCCGACTCCTTCGTTCCTCAC
AGAGCAAGCGTTTGGTTGCGCCCCCCACTACTACTGCTGTTTCCCGCCTTAACCCTTTAA
GCCTTGCTGCCCCTGACATTGGGAATGCCCTCCCTGATTTCCTCCGGAGAGAATCCTCCC
TCAGTCTTTATAAAACTAAACGTAAAGACTCCCTATTGGGGCCCTCACCCAGCACCTGAT
CTGGGAACTGGCACTTATATTGTAATGTCACCCACTGTGTCCTACAGCACTTATATTTGC
CTATTTGTGTCTGTTAGTTACCCCTCCCATATAGATTGTAAGCTCTACGGGGCAGGGACC
TCCATCCTCTTGTGTCTTTGACTCTTAACTTATTGCAACTGTATCTTGTATTTATTTGTA
TTTATTGTTATACTTTGTATTTATCTATTATTATCTTAATAACCCCCTGTGTGTATTAAT
GTATTCTACTGAACAGCGATGCGTACATAAGTAGCTCTTTATAAATAAAGATATACATAC
ATATAGAAACCTATACCATTTGGTCTGTATCTAATTGCTGTAAATGATGGCCCACAGAGC
TTCTGCCTAACTTTTTACTAAATACAATTCAGCAGGAAATATTTATAGTATTGTATTTGT
AATGTGTGTTGTATAATCCCGGCATACTCAGTGTAGTTACATATTTATTTCAGCCCTTTG
ATTGGCTCTTACTAATATCAGTGTGTCATTGTTTGTTTTAAGGTCATGAAGAAATAGACA
TTCCAAGAAGAAAATCCTGGTGGGTTTCATGGTTGATGTGCGGCTGTATCGGTTCTGTTA
CATAAAGTCTATACATTTCCCTTAGGGTCATTCTTCTAATGTAGAGATGCCCAGACTTCC
AGTCAAGTTGTACCATCAGCATCTACCACTTATTTAAACTGGCATGGAAACCGCAACTTC
ACTGAATGACAATGGGGGGAGTGTGAGCCATTTTAATTCTGCTCAGAGGGGTTCCTTGCA
CAGGTTAGGGGTGGGCAGTACTCTGCATCTTCCAAGAATTGCTATACGCTTATGTGCCCA
CCTAAGGGCAGGAGAAAAATGGCGCAGTTGTGGTCCCTAGCAAAGTACTGGCCTGTTTGG
TGTTACCTATGTTGTTGGTACCTATAGAGGCCCATGAGGGGTACCATAATATAATGTCCT
GTTCCTGTTTACATTTGAAAATGATTCACTTCCAATTCTGGATGATATTTACTACTTCAA
TATTATTTTATCCTTCGTGTCTAGGGACAAAACCGCTGTCCTGCAAGCTCTAGCCTACAC
AGTCAGCCATGTAAGTGACATTTTTTCCCGCAGCTTTAAAAGTACCCTGTGTGGGTCTGG
ATTAGCTTTTTATCAATCAGTATTTCCTTTTATAGGACCCTACAGCTGCGCATTACATGT
TTCAAGATGAACCCTTTCTGGCGCCGAAAACATCCTCCGAGTTTGTAAGCACTTCCTATA
TAAAATCTATTGTGGTATTTGATCTTGCGTATTTCTGCTTTTGTCTTTTAACACATTGGG
GGAAGAGTAAAGTGTGGTGGGGCTCCCATTGTTTTGTTTCAGGGGTCTTTAAGCTATGGG
TGTGATTGGTCACTGTTTAACATGGGGCACCATAAACCACCTTTTACCCTTTGCATGCCA
GCTGATTTCTGCCAAGTGGGATTTCACATTAAATAAACAGGAACCATGAAAAAGCTAAGG
GCCGTGGCAGACAGGGAGATTAGTCGCGGGCAACTAATGTCCCCGAAATGCCATCCCACC
AGCGAGATTGTAAATCGTCGGTGGGATGGCATACACGGCGCCGAAGTATCCTTCTCAAGG
CGATTTTGGCAAATCGCTGCATATGCCATCCCACCGGCAATTTACATTCTGGCCGGTGGG
ATGGCATTTCGGGGAGATTAGTCGCCCGCGACAAGAGATTTGTCGCGGACGACTAATCTC
CCCGTCTGTCACAGCCCTAAAGCTCTGACATCGTGTAACTGAGAGTGCCAGGGCTATAGA
TTCCAGGGCTGTGGAGTCGGAAGCAATTTTGGGTACCTGGAGTCTGAGTTGGCGGTACCA
TAAACTGAGGAGTTGGAGTCGAAGGCTTTATGAACTGACTCCACAGCCCTGATAGATTCT
GTGATCTGTAGAATGCAAAAAGTGCAGTTTTCTGCTTACATGTATAAATGCTGAATGCCT
GACATATTTGCTAAATGTAACCCCCGATTATATGAATGTCTCCTACTAAAATCATATGGT
AAAGGGGTTGTAAAGCTGAGCTCCCATAGTTATAACGGAAGCCGCTTCTTATGTCTGAAC
CGTTTTTTTCTTCTCTCCTCCTGGGTAGCGTTTATATTCATTATCCAAGGAGTCTGGCCG
AAATGCAGCCAAGTACATAATCGGCACTTACCCCAACCTCTTTCAGAATGACGTAGCCGA
GCCGCACATTCCGGTGAGTGAATTACAAGCCACTCTGTACCTTTAAACTAGGTAGGAAGG
AAAACCATACCCCAAACAATGTAGGTCTCTATAAAAAGTATATTGCATAAACAAGCTCGT
ATGTAAAACCCTGCTTCATCTAAATAAAGCTTGTTTACTTTTGAGTTTCTCCATTTTTCC
TTGGTAAAACCCCCATGCTATCTTTTCAGTGTTTGATGCCTGAGAATCTCCAGCCCCAGG
TTGAAGGTGTTAGCGAGGAGGCATTAAAGGAGCGCATTCAGCTGAGGAGGGTCAAGGAGT
CTGTGGATCTGTTTGACCAGCTCCTACAAGGAGGTATATTGATATATTATATTTGATTCC
TTCATTTCACACACCGGTTCCACATTTACTGGGATTGCAGGTAGGTATTGTGTCTCCTAG
AATAAGGAATCCTTCCAGCAAAAACTTACCTGTAATGTCACCTGACTGCCACCTCTCTGT
AGTATTTTTGTACCAAATGGGGTTAATTCTCTCTTCTTGCATTTCTTAGATTTTAGTAAA
TGGAAGCTTTTATCCAAATGAGTATTATATTTCCAAAACCCCTCTATGCCCACCCTTTGT
CTATCTGCTTTCAGTTGATCTTTTAAAGTGCATAGATTTGTTATTATGGGAATGGGATTG
GGTATTTACAGATGGGATTTGGGTATTTACAGATAACATGGAGCTGGCTGCCTGAAGTCG
CTTTCCATGAACTACAATCTGCTGATCCTGCAAATTGTTGCCATTTATAGTGGAATAAAA
AAATGTTTCTTTATTTTGCCCGCCCAAAGGAACAGCACCTTCCCTAGAGACAACAAACAA
GCTCCTGGATCTCATTTCGTTCTATGGGGACCGAGAGCCTGTTCGGGACATTCAGACATC
AGAACAAGAGCAGCAAGAAGTTCAAGATCAGCAAGTGAGTCTCTGCCTTTTTCCCTCCCC
CATGTAACCTGGCTAATTCTTGAGGAGGAAAAACCCCTCAGTGTTACGGTGTTGTCCTAG
TGTCACAGGGGCCATTTTTGTCCCTACTTATTACAACTAACCATTCCGTTACGCTGTAGG
AAACCGAAGACCCCAAGAAGAGACCAAGGCAGTACCGAAAAGCCTCTGAAATTCTTGGTT
CTTGGAGGTAAAACATTTTACTTCAGATGGCGCCATTTTCATGTCTAATGACCATTTGTG
TTTGTGTGTAGTCCTCGGCTCCATACTGAGTGATGATGAAAGAGACAATAACCCTTTCAA
AAGCCTTTACAAAACTGCTTAGTGTTATAACTCTAAAGTGCTATTTGGGAATACTGACTT
TTGTGGTAAAAAGGCATCCAATCGTCATTCATAACCATTTCTCTCGATTGTCAGACTGTA
ACCCTTCCTTTGCTGATGGTGAAATTTCCTTCCCTGTATTCTAAATGGGTGTCTTCAGTA
TCTCATAATAAGATTTCAAAGGTGGCTAATTTTCAATTTAGAGAGAGATCAACTATTTAA
CAGAATGGTCTGTCAGAACTGACCCCCCAAGGTTGGCGTACATGTCCTGATGGTTAGGCA
GAATGGTCAGCCAAACCGTCCAACCAAATGGGATCATGTTAGGCCATCTTCAGCAGTATG
GAACGCAGAGCTTGTAACGTCTGTCCTTAATGTCATGTCTGTACCTTTGCACTTGAGCAG
AGTGTTAGACTTGTGTGTTTCATTGTTCTTCCTCCCAGAGAGAACAACAATGCTGAGAGG
ATATTCAATTTGATGCCTGAGAGGAACGCTCATTCATTCTGCACCCTGATCCAGGGCATG
GCGAAGGTAACACAGAGTTGCTTGCAGAGAATTACCCAGCAGCTGCTGTTGGACACACAA
CCTTTAACCATCTCTCTACTTTCCAGTATGGATCTTCTAGCAAAGCCTTTAACATTTACA
CTGACCTGATGAACAATAGATTGACAGGTAAGTCTACAGGTCCGACAAATTTCCAGTTTG
TATCTATCATGTACAGTTTAGAAGATCATGGCTGCAGTGCTCCCAAATGAGGACCCTAAT
CCAATCCTCTAGAAATTGGTCACTCTGTTTCCTCTGCAGCCAAAGCTGCCACTGCCTTCA
TTGCAGGCACAAGGGCTTCTTTGATTCTCTAGAAATCAATTAGTTGGGGCTGGGAGCACT
TGAGCCATTATATACTCAACATTACAATAACAATGCATTCTAATAGAAACATCTTAGGAA
GCCTTTGCTTACTGTAAGTTTACCATATACACTCATTATCTATCTTTTTCTTACTGTTGC
AAAGATAAAGGATCCGGTCTCCTCCAATCTAATAGGCAGCCTTAAGGTGCCCATACACGT
GAAGATCCACTAGCTTGGCGAGGTCGCCAAGCGAGCGGATCTTCACACGATATCCCCACC
TACAGGTGGGCGATATCGGGGAACATGTAGGCTTTGTAGGGCCAAACGATCGAATTATAA
TGGCGGCAACGGGGCAGTCGGTTCGGGGACCGCATCAACGAGCCAATGCGGTCCCCGATC
CGACTAAATCTTTTAACCTGCCTGATTGATATCTGGCCAATTTCAGGTCAGATATGGGTC
GGGCATTCCCCTCGTTCCTGCCCCTACACGGGACAATAAGNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTATGTTGTTGGTACCTATAGAGGCCCATG
AGGGGTACCATAATATAATGTCCTGTTCCTGTTTACGTTTGAAAATGATTCACTTCCAAT
TCTGGATGATATTTACTACTTCAATATTATTTTATCCTTCGTGTCTAGGGACAAAACCGC
TGTCCTGCAAGCTCTAGCCTACACAGTCAGCCATGTAAGTGACATTTTTTCCCGCAGCTT
TAAAAGTACCCTGTGTGGGTCTGGATTAGCTTTTTATCAATCAGTATTTCCTTTTATAGG
ACCCTACAGCTGCGCATTACATGTTTCAAGATGAACCCTTTCTGGCGCCGAAAACATCCT
CCGAGTTTGTAAGCACTTCCTATATAAAATCTATTGTGGTATTTGATCTTGCGTATTTCT
GCTTTTGTCTTTTAACACATTGGGGGAAGAGTAAAGTGTGGTGGGGCTCCCATTGTTTTG
TTTCAGGGGTCTTTAAGCTATGGGTGTGATTGGTCACTGTTTAACATGGGGCACCATAAA
CCACCTTTTACCCTTTGCATGCCAGCTGATTTCTGCCAAGTGGGATTTCACATTAAATAA
ACAGGAACCATGAAAAAGCTAAGGGCCGTGGCAGACAGGGAGATTAGTCGCGGGCAACTA
ATGTCCCCGAAATGCCATCCCACCAGCGAGATTGTAAATCGTCGGTGGGATGGCATACAC
GGCGCCGAAGTATCCTTCTCAAGGCGATTTTGGCAAATCGCTGCATATGCCATCCCACCG
GCAATTTACATTCTGGCCGGTGGGATGGCATTTCGGGGACATTAGTTGCCCGCGACTAAT
CTCCCTGTCTGCCACGGCCCTTAGCTTTTTCATGGTTCCTGTTTATTTAATGTGAAATCC
CACTTGGCAGAAATCAGCTGGCATGCAAAGGGTAAAAGGTGGTTTATGGTGCCCCATGTT
AAACAGTGACCAATCACACCCATAGCTTAAAGACCCCTGAAACAAAACAGTGGGAGCCCC
ACCACACTTTACTCTTCCCCCAATGTGTTAAAAGACAAAANNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTCTGTGTCTTCCCTCCAGGAGCTGCTGA
AGCACATGGTGCAGCAAAACGTCCGGCCAAACCTGCTGACCTTCAACTCTGTCCTGAAGA
GCTTACGGAAGTGCGGCCCAATGGCCAAAGGGTTGGCGCTGCAGACTATAAATGAAATGA
AAGCACTTAACATAGGTGAGGGGGTTAGGGGGTCTTGTTCATTAATTTCCCATTTCCTAA
CATAAGCTATATTTGAGTTAGTGAGTGAGTGAGTATCTACAGTGTATATATGTTTGTATT
GCTATTGTGCAATTCCCCTTTGGACCATTGGTGGCAGTAATGAGTACACCATAAGTAAAC
AGCTCTGACCTGAAATGTGCAGCTGTTCCAGTGGCTGAGTGGATAGGCAGGCGTGCTGCA
AACAGTGCGGCAAGGGTTCAAGTCCCACTGGTTCTTCATACATCAATCTCTCTTTGCAAT
GATGATTGGCGCAGGGGTACCGACCTCAGCTGGATAATGGGAGCTGAGTGCAGAGCCGTG
TCTGTCTGGTTATCCGACGTGTGGTTGGTGGCCAGGAGACTCTCTGCATGATACAGCCGC
CATACTGAGCAACAATCTGAGAAAAAAAAAACTTATCTTTTGATATCATCAATGTTTAAT
TATGATACCAACATAAAACAATAGCTAAGTTACATTTTTCCTCAGGCTGGGAATCTGATT
TCTACAGGTTCTTATCCAATGTGATGGCAGCTTTTATTTTTTTTTTACCTGCAATAGACT
GTAAAAGCTAACGATTGGTCACTGAAGGTGGCCCCTGTACTACATTACTCCTGTATATAT
TTGTATTCCCTTTATTAGTGGCTATTGCCCAATAGCTACTGCCATGTATAACAGGGGTGC
TTTTTATTTATCCTTAGAACCAAGTCTGGCCACTTACAACCACCTCCTGGGAGTCTTTTA
CAAAGGAGGTAAGTTTTTTTTTTTTTTTTTTTTTTCTATGTAATTTTTTGCTTGAAATGC
AGGAGCACCCATGGTTTTATCCAACTGCCCCTTGTGTTCTGGGGTTGTGCTCAGTTTGAT
GAAGCCATGTTTTGCTCCTAAAGCAGCCGACATGGATTCCTGCGATGGTTCTGATTCGCT
TAGAGGGGCACCGGGCATTCAGCCTCTCCTCTCGGTGCTGCAGACCCCGAGGGTGTAGCT
TATTGTTTGTGTAGGACATTGCTTCCATGCATATGTACATTGGGGTAACCCTTTTGATTC
ATTAGCAAAGTTAGATTCAAATGAAAGGAACTGTAACAAAAGGCAGCGCATGTAGGCAAA
ATAGAAATGTTTTTATTTGGACCTGGAAGTGTTGGCTTGTGTGGGAGGGCAATGTTCAAT
ACACATAAAACAATGATGGTGCTGGAAAGCCATGCCCTGAAGAAGCTGTCTTCTATAGAA
AAATGCTTTGGGCGGGCATAGGTTAAATGGGAAGTATGTTATAGAAAGTGCTATTCCTAA
CAACTTTGCAATTAGTCTTTATAGTTTTTCATGATATACATCTTTCCAGCTATCAAATGG
GGGTCACTGACCCCGGCAGCTGAAAAACTATTGCTCTGTGAGGCTATAGTTTTATTGTTA
CTTTTTGTTCCTTGCTGTTCAGTCCCTCTCCTATTCATATTCCAGTCTCTCATTCAAACC
ACTTCCTGGTTGCTAAGACCCTAGCAACCTGAGAGTTGCTGAAATTCCAAACCGGAGAGC
TGCTGATCAAAAAGCCAAATTACTGAAACAAAACAGTTGCAAATAGTCTTAGAATATTCT
TGTCTATATCATCGTAAAAGTTAAGGTGAACAACCCTTACTCAGCTGCCATAAGAACTAG
TCCCCCTGGGGCCAATACAATATACCTGTATATAAAGCTATTATCAGCCATGTTTTGAAT
TCATATTGAATATCTGTGGGGCCAACACAAGCTGACGGGTCCTATTGCACCCAGGGTATC
AGTCCCCTCTCCTTGTCACATAATAGTTATGAGCCAATAGGGAAGTGAGGCAGGAATCCA
TATAAAGCAGTGTTCCATCTGTGTATGTGCTGCTATAGCAATAGCCACTAACTGACTCCG
CCTACTTTGTACTATAAATAGGGAATAATACGAGTTCTATTGGGGACTTGAGAACTGCAA
TAGCTCCACCTCTTCTGAGTTTATTACATGTATAGATTGCCAAAGTTGTATTTAATTATA
AGCAATCTTGTGACTGTATGTACTTGTAATAAATACAAATCATAATAAATATTCTAATAA
CTATCCAAGGGCCATGAAAGGGGCAGTAGCTCCTGCCCAGGCCAGACTACATGAAAGCTA
TTACATGTATGAGTTACCTTATAGTATGATGTAGAGAGTGCTATCCCGAGACAGTTGGTC
TTCGTTTTTTTTATTGCCCCTGAGCAAGGTGCTGTGTGTAGTATCCCTCAGCTGTGAGAC
CATCTACATGCACTGGTTTGTATAGGAGAGAAGGGAAATAATGGGCACAGATCTGCCACA
CACCTACAATCTACCGGCCTTTGTTGTTTTTCAGCTTTATCTCCAAGGGGCCAGACTGAA
ATCCTTTCTGAGGTGCTGGATGAGATCGAAGGCAGAAGCTTTACCCTGCGGGACCCGGAT
GATGGTAAATACTGACCCTTTTGTGTCTACTGTAATGTGACCTGATATTTCCCCATTGTA
TGGAACCCCTGTGCCTCTCTTGGTACTACACTAACTAACTGCATTCCTATAAGCCCAGTG
TGGCTTCTGATTGGCCCCGTTATTATTAATATACGTAGGACAGCACTGTACAGATTATAC
ATTTTTCCCATCAGTCCCTGCCCATAGACAGGCCCGGATTTGTGGAGAGGCCACAAAGGC
CTGGGCCTAGGGCAGCACAAATCTGGGGGCGCCCCGCTGCACCCAAATCTTTTTGTTCCC
ATACGGAGCAATAGGAACGTCTCCCCACTGCTCCGTATGCAAGTGTGGCCTTCCGCGCAT
GCGCACTCCAGGGGGGTGGGGTTGCGACCGGGGGCGGCCAGTTTGGAAATCCGGCCCTGG
CCATAGACAGTACTGAGAATTGCCTCTGCTAAAACACAGACAATTATCAGTAAATTATCA
GCAGTGCCTATATTTGTAGCCATGACATGTAGCTCTGTGTGTCTTCAGCCTTATAGTTGA
CTGTGTCAGAATGCCACCAATACGATTTAGAGCTGTGGAGTCTGATATGTTCCGACTCCA
GAGCCCTGAATACAATGTCTGTAGCTCATGTAGGCAACTTTCTTACTATGTGTTTTAATA
AACTATGATCCCCAGCCAGCGTTGGCTGCTGCCTGGTGGCCCCCACACCTCATTCACAAG
CTCTCCCCCCCACAGGAGTACATAGTTCTGGACTGCCAGGGTGCGGGGGGAGCCAGCTGG
GCTGGCACTGCCCGTAGAGCCCCCCAGGTTTTTTCCCAGTGTTCTGCCGACCTTGTCCCC
AGCAGTAGGGGGCCCAATTGAAATGGCTCCCTGCAATCCTTGGGAATACCCACTGTATCT
TTCCTATCCATTGATTGGTGCATTTAACCCCTGCACTTACTGTACATTCCTGGTCACCAA
TGCTATGTTTCTCTTTTTTTCTTTCCAGTGTATTTTTTCACAAATGCGATGAGAGTGGTA
AGTAGAGATAAGGCACAATTAGTCACATTATGTGGTTATCATAGTTCCTTACAGAGTCGG
ACAGGTTGCCCAGGCTGGTTGCTTTTCTGGAGTAGCATTGACGCCTTGTATGAATGATTG
TGGGTGCTGATATAACCATAGGGTGAGAAATACTGTTACTGAGCAATATCCACTTTAGTA
AGGTGGCACGAGGGGCATGAGAGGGGGCAGGAAGGCTTATTGCTGGGCATACACATAATA
ATTTCCTTGCACGCTGTGGAGTAGGGTATAATTACTGTGTTGTGGCTGGTAGATGCATAG
AAAAGAGCAGAGCAGTGAAAATTAAGTGACCCTTTTGTTTGTTTTTTTTAAATTCAGTGT
TTGGACCTGAAGGACATTGAGCTGGCCTACCGGCTGCACACACTGCAACAGACTGCTGAT
AACAGAGGGCTAATGGGAGACTTCTACCTGCAGAGCACATACTAGTGAGTTGCATTGTCT
GTATGTCCCCAGGTTGTGCATAATCTGTAAGATGCCCGTAGCTATAAAGTACCAATATCC
ATAGTTAGATAGATAGATGTGCAGAGTCAGCCAGTTATTTTGGCCCTTGTCTGTTCCGCT
TAATAGCCCATTAGGTAAAAATAGGACTGATTAGTGTCTACCAGGTGCAGGTTCTTTTCC
TGAGAAGCTCCAGTGGTCTAATTGCATTAGTGGATTTTTTAGCATTGTATGGCGGCTACT
TGCTAAAAGGCTACAGTTTATATCTATGTGTACTCGGGGCCACCACCATTGGTGGCTAAC
AGCCCCCCGGCCACTGATCAATCCAGCACAGGCCTTCCACTTCCGCTGCAGGCAGGACAA
GTTGGTGGGAGGGAAGCCAGCAGGACCAGGCCCACAGGGATTTTTTTCTGGCATTCAGCG
GGCTTTCCTGGCTTCTTTAATAGCATCTCCCATTGTGCTTTGTGAGCTTGGTGCAGACTG
TACTGCTGCTCACCCGGTGCGCTCCCTGCTTAGTGCAACAATGATGCTTCTAACACTCAT
TCTGTTTTACAGTGGCAGGTTCTTTAACCTCCTGTGCATGATGGAGAGCATCGATATCAT
CCTGAAGTGGTACCGAGAGCTTATCCCCTCGGTAGGTCCATGTTATGACTAGTACCGCTC
ACCATTTTGAATAAAATTGCCTCAAATCCTCTTTTGTTAGTAATGATAACATGTTCCTTT
CTAGCTGTATTACCCAAACTCCAGAGGCATGCTGGACCTTCTGCAGGCACTTGACATGGA
CAATCGCTTGGACTTGATTCCTCAGATCTGGAAAGGTAAGTACAAACACTCTTGGTCACT
GTGGTTTATTTGCCATGATGAGCACACAGTGAGCATCCAGAAGAGAAAGTCAGAATCCAT
TCCCAAATGTTACCCTGATCGGTCGTTTGGAGCTCCTCAAGGGCGTGGCTTTCTTACAGT
TCGGGAGCCTGAGCCGTACATGATTATGATGTGATCTTTCTTTCATCAGATATAAAACAG
ATCGGACACAGTAACAAAGTTGAATTGGTGGAGGAAGTGTTGAACTTGATGGCCAGAGAC
ATACAGCCACCAGAGGTGAGACCTGAACATGTTCCTGTCTGGGAATCCATGACAGTGTTA
CCTGGAGGACCCTGCAGTGTTGCTCAGGCCCCCGTATCCTCTATCTTGCACTAACCCTGA
GCCTTCATGCTTCTTTATTTTGCAGTTTTAAATTGGACTTCGTATCTCAATAGCTCATGT
GATATAACTCCTCCCCTTCCTCCCTCCCACACTTAGCTTCAGGCAGCCTTTGGTGACACC
GCTCTGGATATAAAGTCTTTGTATGAAGTGAAGGACCGCGTACGGGTAGCCTTGGAGTGG
TCTGCTGGCTCCCTGGGAAACGTATCAGCCCTGCTGGCAAGGGCTGGGAAAACAGTGGAG
GCTTGGTAAGGATCCGTGCGCAGTATAGCAACTATTAAGCAATGGGAAAGAATCCAGTAG
TTGTGAGTTGTGAGGGTGATTTATTCAGCCCAAATACAAAGCCCTTTGCTTCTGGAATTT
TGCCCATTGCTATTATTAACCATTCTGCAGGAGAGGGGTCTTCTGCATCAGCACCCAACA
CACACACAGAATGCTGAGCTCTATATCGCTGTGCATAATAAATATTAAACGACTGTGATG
ATTGGCACAGGGGTACGGACCTCAGCTGGATCATGGGAGCTGAATGTGAACTTCCCCCTG
AGGTTCCTGCATGTGGTGGGATACCCGGGGGGGCGTTCATATGAGAACAGAGCCTTAATC
TGAGCCGCTTCTTTCAAAAAACGTCTTCATATTCCCTTTCTGAACATTCTCCAACCCAAC
TGAAAGTTCTGGTATATGACACTGTCAGTACCACGAGCTGATTCCGTATTTATTGTCTTT
GCAGGAAGATGCTACAGCTTTTCAAAAAAAGCCACCGAGTGCCCAGGTACGCTAGGGCCC
CCCCAGTCCAACCCAATGTCCATTACCCAATGGTATATCCTGTTTCCCAATGGCATCAGT
GTGGCTAATGGTATAACAACTCTGGGGCTATGACTATTTGTGGACTCATTGTATATGTTT
GTTTTGTCAGCACCGAGGTCCTCGACGAGTTCTTGAGCAGAGCCAAGGTGGATGCCAATA
CCAACCTGGCCATTAGTCTGGTGCAGCTGGCAGTTGGGTTCTGCCTCCCCAACACAGCAA
AGCTGGCACAGCGCGTCATGGAGGAATTCACCGTCTCTGAGGAGCAGAGGTGAGAAACCA
CTACTTTTATATGTTTTGTTAATATGTTCTCCAGGAACAAAGATCAAAATACTGGTAGAG
GCATCCATCTCTAGTTTTAAGGATATTAGTTTTAGTTATAGTTTTTACACTAATGATAGA
ATGAGTTTGAGACAATGTTCCCACCTGCTGTTTATTTCCGCCTCTTGGACACAGTAGAGA
ACGATGTTAGTGGGAAAAGGAGAGTCTTGTCAGTGAGCAGAGACTGAGACACTCAATGTC
TCTTTGGTCAGTTCTTGGCACAGCAACATCACAAGCCTTTTCCCCTTTTCTCACTAACTT
GTTTTTCTGCCGTGGCTGGTCGGACGATTTCACTGCTGCTTTTAATGTACTTTTACACTG
GGAAAGAAAATTCTGACTCTAATGAAGTTATCCATTCAGGCTGACCCTGGAAGACTTGCA
GAAATCTCACAGCAGCAGCAGCAGCAGTAGTAGCAGCAGCGAGAGCAGCGACAGTGACCG
CGAGTGAGATGAGCCAATCGCTTCCAAGAGGATTATCATTCAGTTTATTCCTGCGGGCAA
CTGGGATCCAATCCTGGGCTACTGACCTCGTCTCGCTGACTGTGTCCAGAGTCTGAACTC
ACAAACAGACTGTAACTGCAGAAGGCGGATTGCTAGGAATGTTTCTGTTACAGACACCAC
TGCAGAACATTATTATGTAAAAATTGTATTAAATGTAATATCTTTCCAGGGTTTGAAGAT
GCCATTTTTTTTTTGGGCAGAGATGGGTCTTGGGAGTTCACTGCAAAGAGCATCTGGTTG
GGGTTGTGGCACAAAAAACAAGTAGGGTGGAGAAAACTTAGCAAGCTGAAGTACACTGCT
GCAGAGATGGATAAAGATCAGCCTCGTTTATATAAAGCATAGGCCAATTGCATGAAAACT
ATTGCTCTGTGAGGCTACAGTTTTATTGTTATTGCTACTTTTTGTTATTTATCTTTCTAC
TTGGGCCCTCCCCTATTCATATTCCACTCTTGCATTCAAACCACTGCCTGGTTGCTAGGG
TAAATTGGATGCCAGCAACTAGACAGCTGCTGAGCAAAAAAATAATCAAAAATAATGAAT
GAAACCAATTAAAAATGATCTCAGAAGATCAATCTCTACATTCAAAGTAAGTCTTTAGGT
AAACAATCCCTATAAGCGATGCCACATCAGCGATTATTCACCAACAAGTGACAGACCGCT
GCATGAGGCATAAATCATCGGATTAGAATTGAGAGTGCATTTCATAGATCCCATAAGAGG
GAGACTGTTAAGGTGGCCATACATTAAGAGATTCGTGTTTGATGAGGTTGCCAAGCAAGC
GGATCTTCTCCCAATATGCCCACCTACGGGTGGGAGATATCTGGCTAATTCTATCATTTG
GCCCTAGGACCTAATGATCGAATTAACACGGGGGCATAGGCACCATTGGTTCAGGGAACC
GTATCAAGAAGCTGATACAGTTCCTGATCCGAAGGACAAATCAAACC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1050, 1461..1501, 2862..2898, 3384..3429, 3515..3583, 4468..4572, 4769..4892, 5369..5493, 5639..5706, 6278..6365, 6446..6506, 7509..7567, 8130..8156, 8333..8474, 9197..9247, 10834..10923, 11908..11936, 12297..12403, 12972..13050, 13144..13234, 13429..13514, 13716..13864, 14344..14385, 14530..14688, 15099..15186
1001..1050, 1461..1501, 2862..2898, 3384..3429, 3515..3583, 4468..4572, 4769..4892, 5369..5493, 5639..5706, 6278..6365, 6446..6506, 7509..7567, 8130..8156, 8333..8474, 9197..9247, 10834..10923, 11908..11936, 12297..12403, 12972..13050, 13144..13234, 13429..13514, 13716..13864, 14344..14385, 14530..14688, 15099..15183
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved