Xenopus_tropicalis Locus rps3
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis rps3
Xenopus_tropicalis
rps3
scaffold_277
SNORD15, SNORD15, SNORD15, SNORD15
3807..3949, 5726..5872, 7129..7275, 8431..8576
10585
agtacatgggggcaatatgatggggcaataaaaaggctgctggcagcctggcacaggta
catgggggcaatcaggaagggggggggcactcattgaagcccttgcctagggtgccaaaa
taccttggcccggccctgccgcatcggctcgttgatgaggttcccgaaacagctgcatct
attgccggcattcttattcaattgtttggccccagggccaagtcagatattcttcaggac
tgctaatcatctgccctgctgctacatagtttcaggagtcagaaccaccatggcagataa
tataaacagcaacagcaagagggatactactttcaatagtaattacattcacaaataact
gaaaaatatcatgaatttgtaaatataacatttttttaatcttcctgaagtaaattttat
ttctataaggacctttggagaactgtcaaatgccagtggtgggggggcctatatgattgg
acaagggggaagggcttcctcagaatggggcaaggggggtccctagtgggaccagatccg
acattcagaggtgacaggcagtttccatgtatctacatgagagatggcacacagtgcttc
ctgcagactgaaatgttacctgagccatcggcctttattatttctgattatattaaccct
ttacatgagtggttattgcactttgctgacagacgactaaatggcaaagtacaggaagtg
ttaggcgtacattgtttggctgagagttgtagtacaacaagagctgttgagatatatcta
taaagtaccaactactaagaaaggcaaatttagaaatttgggaacacattttcaagaaaa
tcaatattttttgcaaaatgtttcccctacggcaaacaatttcctacgcaaaaatcaccg
gtgaaactcctatgcgctaaaactacatatcccgtggggcattgcgcgctgaacgcacac
tttcctgtcacactctaggtatatagcagcttccgccggaaGTGGCCTCCCTTTCCTTCC
AGCGGCGCTTCGCAAGATGGCGGTGCAGATCTCTAAGAAGAGGAAGgtaggcttaaaaaa
agcgctcttttatagtgtgcggtgggacattgtagggcaatacagttagcgctgggtcca
gggggctccggagggtgcagggaagcatagagcgggcagatggctgtgcctgcggggtag
atggatggagattgagtcgggcctgagagtccggagctgacatggctgcgcgctgtttgg
ccccaggcaagccgggtatgtgtgtgggactgtgatactgagataggaacgtctgtttcc
tattggctacacctagttggtatagatagggttaatgagactctctgtaccaactatttg
tgtgtaagttacccctgtattactgtctgtctgtctcctattcactattactgccctgta
ccccaatgtctctatctgtaaccttgttatgggctaagggggcccagcctgaaggccagt
tagggggggatttggggtgagtgcttatttgtgccctgggtacccctggaactatagcag
ggtgactgttaccccaatgtttctatatatctgtaaccttgttatgggctaagggggccc
agcctgaaggccagttaggggggggatttggggtgagtgcttatttgtgccctgggtacc
cctggaactatagcggggtgactgttaccccaatgtttctatatatctgtaaccttgtta
tgggctaagggggcccagcctgaaggccagttagggggggatttggggtgagtgcttatt
tgtgccctgggtacccctggaactatagcggggtgactgttaccccaatgtttctatata
tctgtaaccttgttatgggctaagggggcccagcctgaaggccagttagggggagacttg
gggtgagtgccactaatggaactgtatatatatatcgggcaaatggcaggtgttattggt
aagggacatgtgcgaggagttagtgacatttgtatattaattaatggctctctttgcagT
TTGTCGCTGACGGCATCTTCAAGGCTGAACTCAATGAGTTCCTTACTCGGGAGCTGGCTG
AAGATGGCTACTCCGGTGTAGAGGTCAGAGTCACCCCAACCCGGACTGAAATCATCATTC
TCGCTACCAGgtaacaagttggatctttatttcaatcacttttatattatctcacattat
ctgtagttgcattcattttggtgatggtgacgtatagatatgatatataggatacaaagc
caagacctgttattatcctgattagaaactgtgcattagaatttactgcaggtaggataa
tggctgcgtagggtttatcatccttccagaagactaatacacagttctcccaggattgtg
ggtataagtagaatatatggcgaagcaagctggcagtgatattcactatggggatatcca
caatttcaaatagttcccttccagaacagcttgtgtttggttgtgtgcattgctgctttt
gtaactccgttccgtttcccacatgcagAACCCAAAATGTTCTGGGTGAGAAGGGCAGGC
GCATCCGTGAGCTGACTGCAGTTGTTCAGAAGAGGTTTGGATTCCCTGAAGGGAGTGTTG
AGgtaagtgatctctctgcccgtattaactacagagcatttaaagggtaggagtgtgcta
tttacataagggcccctgtaacagccccctttccccaccacaccacccacactcctccaa
cccactaccccccataccttataataaaaggcagagtagttggtggtgggcattgcttga
caagtcagggctggatcagctgcaaatgtgcctggccctgggcagccatcccccccagag
agcaaagcagtgtcggcagtcaactcttctactcaactctgcctttcaaacagggtagag
ttggggtccgtataagagagttaacttttcatgtaatagaacagtgatccccaaccagtg
gctcaggggtaacatgttgctccccaaccccttggatgttgctctccgtgcccccaaacc
agggagttatttttgaattcctgacttgggggcaagttttggaagctgatagtgtgcata
gaggttgcctaatagccaatcttagcccttatttggctcctccataaacttttatgcttg
tgttgctctcagtctttttacatttggctgtggctcactagtaagaaaggttggggatcc
tttttatagaatgtccttcccttagcaaatctcaatggttcatgattttgagtacttttg
cttactttacagttttcatattggtgtctgaccccaacagaaaactctttgaggctatac
ttttattatgaaatgttatttttctttgtttagccactttcctattcactgcctggttac
tagggtaaattagaccctagcacagggctctccaacctttttcatccataagccacattc
aaatataaaaagattcagggagcaacagcataaaaaaatgtcctgggaatatcaaataag
ggctgtggactatgtacactttttttttttttttttgggaacatccaagggtttggggag
caacgtgttgcccccgagccactctccagattggagagattttgtacaaatggcaaaacc
acaagtgaccaatcgcagattgtttcagaatatctgtccagataattgtaaaaacttcaa
agatgcactttaatagggttagctgtagctcgactgctagcccgcaggcaagcagtgttc
taatgcagtggttccaggtataggattcttcagtgatgatttgatgacgagtcggacatt
ctcctctcgtgccccagtcggcggaaggagctgcgttctgccgctgcttttgctgttggg
ttctcatgagaaagttgtgtgaagagtcttgaggcatttgtctgagaagaaaaccttttt
ctgtgttatgatcctgttgccagtgaatggactccatgtttttgtttaaatctggaagta
cgtggctactaaaatgcttaaggggcccttttactaaaaaaaaaaaaaaaaaaaacagac
attattgatgcagtctgataaattgcagttttctctgtccccattccttcatttactctc
ttatgagcccaggacctcggacggtgcttaatactctttgaaagcagtgggttttaccca
acgagctgcagacactgctagttgctacgcactggctcattggtacagtgcattctgtct
taaggcatttttgggtttggttctggtgggaaagtcacataatcttcctgtaacaggaga
taaactataggggagatcaactgatgggggttcagtcatggggcaacagtgcgtttgatg
gcaagcaaccaatttccaacctacctaaaaagaatttaatgtacatgtaaatttgaataa
actcttaacagaatcttaactgagaggctcacaaataaaggtcatctcaccccctgcaga
gtggttttcggcctgatccctcgagagtgatatttataaaccaaatacagttttatctgg
aattttatttgctttttcacagatttagacaagatgatttactggctcagttctcctgag
cttggggatttatttctgtatctgctcacggtgatggttttctctttgtagCTCTATGCT
GAGAAAGTTGCCACAAGGGGTCTGTGTGCCATTGCCCAAGCCGAATCTCTCCGTTACAAA
CTCCTGGGAGGTCTGGCTGTGAGGAGgtgagtctcatttgaggaaaggggatttattaaa
gccaatgggttgtggtttttgggagcagtttctcttttatttccgctctcaattaaatca
cccttggagctgtgcattgtaaaggaatcaaccctactatagtttatataaataccccgc
tgtgtagcccgggggcagccattcctgcactggtacagctggggtgtttgctacagaaac
cctactatagtttatataaataccccgctgtgtagccccgggggcagccattcctgcact
ggtacagctggggtgtttgctacagaaaccctactatagtttatataaataccccgctgt
gtagccccgggggcagccattcctgcactggtacagctggggtgtttgctacagaaaccc
tactatagtttatataaataccccgctgtgtagccccgggggcagccattcctgcactgg
tacagctggggtgtttgctacagaaaccctactatagtttatataaataccccgctgtgt
agccccgggggcagccattcctgcactggtacagctggggtgtttgctacagaaacccta
ctatagtttatataaataccccgctgtgtagccccgggggcagccattcaagctgcagaa
aaggcacaggttacatagcagataactgataaactctgcagaatacaatggagttttatc
tatctctgtagcctgtgccttttttcctattgaatgctgcctccatggctacacaaaagg
gtttatatagaaactatatagtagggtttctgaagcaaacacaacttttaccaatgcagg
gcaacagtacattatacttttgataactcattttactcattttttaggtgttacccttta
acttggctatcttcccagagacttgaattgagttttgctctggttttcattcttccctgg
ttcttttgccttgtcctgtatcagcccttcagtgatgagacgatgacgagtcagacagga
caagcaatgtagtgtttcctgcacgggggcacgttctgtgtcgctgggcttggctgcact
gcatgagatttgtccttcttactgatcgatattgaggcatttgtctgagaagggttggca
tttgttttaaataagcggctcagtttttattttaagggggagaaaaggtgcaggttacac
agcagataacatataaactctacagaatacaatggtgttatctatgtaacctgtgacttt
tctccttttgaatggctgcccccaaggctacatagaaaggtttatatagaaactatggga
gtctttctgaagcatacacacaacttttaccagtgcagggcaacagtacattattaatta
gtttgatacatttacattttttggtcttactgttccttaacttagttagacttcaattgc
tgtaacccttaacctgccagcagtgccacccacagagggaagaaacattattcctattgc
aacagcaatttaaacttatagtaatcttcatatcttaatcgtatgtatatagtgcatccg
ctccgggcctcccatagtgtagcttctgaaaatgcggagcagcctcatagatggatcagt
aactggattggtactttttattagaaccacttatgttttagcactttagccaaatctgta
ttgcagctccagaggaatggtacagacttgatagcaattttgtgacaaattttatcccat
tatgccatgtagaaaagcctccagctttctgcgttttgtttggtttcagtaaaggttata
tgtagtaactaagcctgactctctcccctcactagAGCTTGCTATGGTGTCCTCCGTTTC
ATCATGGAGAGTGGAGCCAAGGGTTGTGAGGTTGTCGTGTCCGGAAAACTAAGAGGCCAG
AGAGCCAAGTCCATGAAGTTCGTAGACGGCCTGATGATCCACAGTGGAGATCCAGTTAAT
TACTACGTGGATACTGCTGTACGCCATGTGCTCCTCAGGCAGGgtgagtgggtagaactt
gtgcgctcctatgtccctaggcacacagtggtttctctgcttctctcagcctgtggaacc
tgtagttttcattgcagacacatggagcagcgcagggaaaaacgtggctgagagaagcag
acaagcagttccatgtacccagggccttaatgaaagtgtgttaactattgattagccagc
agtgagtttaattttgggcttgattttccttgtttccatttttggttctttactttggca
gtcagtttcttaggtcagtgcatttagcaggaaggaggtctctaacagactggaaagttt
agctctgtcttcattctactctggttcctttgccttgtcctgtgcagcccttcagtgatg
agacgatgacgagtcagacaggacaagcaatgtagtgtttcctgcacagaggcacgttct
gtgtcgctgtacttggctgcactgcatgagatttgtccttcttactgatcgatattgagg
catttgtctgagaagggttggcactacctaattgtgggcaaaaactttgttaccctcctc
ctggttgctatgggactagcggtactgctaattaatcatagcccatagcttcacacaaag
actaccaaaaatgattaaaaccagtagctcactaagtaatttaattggtccgggtttgaa
acccccagaccctcctcatccaattcaatgttttatgcaatatcaacaaaatcaaagaaa
atccgcacttaccaaaaaaatatagtggcctgggtgaagctccccaaaccagtagcttgg
gggtgtagcatagaaccgaactgtagaaagctggcaatcctttatccactataaaacatg
tctttttattttaaaggtctagcacaaaattgtgttttcttttagacctacaataaagac
atgttttatagcagataaaggtttgcacgccagttctgtacagtttggttctatggaatc
tgctttgctgtgttttgggtaggatcctcaatagtttaatgtacagtgctttatatttac
tctaaaggagggttttgtttataaaacggtatcataagggacatgaactgtgtaaaagtg
cccacctgtgtccggcaattgggggtaaaggggaatatgtccacaaagaaactgtccagt
cattgtaaaggatatagtggtgcctggcagtgtaaattgtctatcaaagcttcatggcac
tgggtagcacactggatatagcaaaatgcacagctgttgagaagtgtcacttatttgttg
tagcccgagtcctaatcattggtttaggttttttccataaagtctcaatcttggttcttt
agtttaaaaatgcatttttatttttaactgcagGTGTCCTTGGAATCAAGGTAAAGATTA
TGCTTCCCTGGGATCCAAGTGGAAAGATCGGACCCAAGAAGCCCCTGCCTGACCACGTCA
GCATTGTTGAGCCCAAGGAAGAGATTCTGCCTACAACCCCCATCTCTGAGCAGAAGGGAG
CCAAGCCAGATCAGCCACAACCACCCGCCATGCCACAGCCTGTGCCCACAGCATAatggg
tatgccttactgacctgtgcaaacataaattccattttattataccctaaacatatacag
tacaggccatagccatatttgaatgagagcccttctgtgatgatacgatgacgagtctga
ttgggtaaatccttttccagtggtccctgtctgcatcacgttctgtgctgtaggctgaag
cccactgagtcaaggttgccctttgcttgatgtccatgaggcatttgtctgagaaggtga
aagtattgggcttttatatgggtcgtgctctctgctccagcatggcggccagctattact
ggcattctccccttcaactgggaaatagtgtttggctcatacagacagtggaaatctgtc
ctctttcctgtgcattgttacactgagctgccatctgtctgtttgcaacgttctctggta
aattttgccactgaggaaatgtaatatggcagctcaaattctatttgcaaatacacagtg
aaggcgtttgtgctctgacttgtacacttataatttgctaagtaaagggatgctctacag
cagtgatccccaaccagtggctcaggggcaacatgttactcaccaaccccttgggtgttg
ctctcagtgcccccaaaccaggtagttatttttgaattcctgacttgggggcaagttttg
gttgaataaaaacaagatttgctactaaataaagcccctgtaagctgatagggtgcatag
aggcccctaatagccaatcgcagtccttatttggctcctccatgaacttttatggtgctt
gtgttgctccccaagtctttttatgtttgactctggctcacgagtaagaaaggttgggga
cccctgctctacgggtatgggatctattattagaatgcttacaagctggtgttttacctc
ctaccagggctgctaacaatcatttaaacattaaataaaccaaataggatgattttgcca
ccaatatgatttgtgcagcttagttcctataaagtacagggtgctgtttataataaaaca
aaattttttaaaattagaattaattgctttaaatcagctttggaaggaataatggaagat
aaatgtcatttgtatgttgatacattgagtcgctgatctacgatgtgcagcctatttgta
agaattaaagttgtttttttttttttattATAGGCTGAAGTCCTGGATTCAAAGATTTTG
GATACAGTATCAGAACATCTAAAATAAAAAAATTAAAATCCAAATTgtggtatttgtgtt
attgtctgtgtgtatgcatttgtgttgggcgcccaaatagcaggatttacggtttcctta
accttaaaggtatattacagcatgacgtgtaatgcagcagtgagactttatcattcgctt
gtgtattgggcattaaaaattgacacccccctacccccagccccaatcttcagtggtttt
acattcatttgaaattgctactgaaagtaatctgtgtcctttcccagtcactgcactgtg
ggttgggattacttgaaccattcaaaggggttttctgccttaaaataaacttctagtatg
atgtagagctttgtattctgagacaatttgcagttgatctttactttttattttgtgatt
taattatttagctgttggttcagcagcctttcagtttgccattttggctggtatctggtt
gctagggtaaaattaccctagaaaccaaggagtagtttgaatgagaaactggaatatgaa
tgagaggaaggataggtaataagtattacaataaaactggagcctcacagagcaatagct
tttggctgctggggtcagtgacccccatttgaaagctgcaaacagaagaaggccaagaac
tataactactcatgtagtcagaacctgcagtgcagacaatagaaagggacaggccagtta
gtgctttccactgtaattaacctttaatgtgtggtgttacttacaacaaagtgctttctt
tttgtaccttttgtgtttaaaaaccccaaaagcaaatctttagaggtcaaaataattctc
actttttttttctccaaaatgagtcaattttattttttttctgacctactttgcccctga
ccgtcccattcttttccctgcatcagtttagccctatagcaatctcactttcacttccaa
tggttattggttaaaataagtgatgtatcgaaataacagattctgatttgacaatgtaaa
acaaagccagtttgcaatttttttta
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1065, 2039..2169, 2548..2641, 4671..4765, 6575..6762, 8133..8334, 9509..9585
1036..1065, 2039..2169, 2548..2641, 4671..4765, 6575..6762, 8133..8335
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved