Xenopus_tropicalis Locus rps8
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis rps8
Xenopus_tropicalis
rps8
scaffold_261
SNORD38, SNORD38, SNORD38, SNORD38
8075..8145, 10747..10817, 11012..11082, 14769..14836
15836
TTTATTCTATAACATACTAAAATCTAACAAATTACCACCTTAAAGGAACAGTAATACCA
AAAACTGAAAGCATATAAGGGCAGTGACACACAGGGAAATTAGTCGCCATGTGACAAATC
CTTGTTGTCGCGGGCGACTAATCTCCCCGCAATGCCATCCCACCGGCTAGAATGTAAATC
ACCGGTGGGATGGCATACGCGGCGCCAATCTCTAGAACAGTGTGTGAACAAAAAGGATAG
GGGTACTCATTTTTTATGGTAACTTTATTCATGTGGCCAGAGCATTGCAGAGACCAAAGG
ACATACTTAAACTACAACAATTGGAGAAATGTAAGTACCAATAACTAAGCTCTTCATCAC
CATACTGTGCAGGACTTTAAGCTTTAATTCATATATAGGAAAGATCCCATCAATAACAAT
GGCTGCACTGGAAAGAATGTAGTCATACTCATTACGTAGCGAAAGGGAGCCAGCATTCCC
TTAATTAAAAAATGATGAATTTGAATGTTAACGCTGATGCACCATGCCATGTATCATATG
ATGGGCACAATTTAGCTTTACTCATTTAATGTGTATGCTGCAAGAAGTACACATGCATGT
TTAGCACACCATGCAGAGCCAATGGCAGATGGCTAAATTGCACTAATCGTGTAACTTAAC
CTGTTTCATTTTTAATTTTAGCAAATGATGGGGTCTCCCATTTAGGCAGGCACAGAAGAG
TGCATAACAAATGCTGTTTTACTCAGATTGCGTGAAAGTAAGACTGACATTTGTGGGGGA
CATTTACTCTATAACCCCTTAAACTATTGCTAACCTTGTTTCAGGTACAACTGACCTAAC
CAAATATTAGATCTCTGACAGCAACTCTACAATCAAAAACAAAACACGTTTAAAGCAAAG
CGCAACATATTTATGACGTAGCTGCTTGCAATCTCGCGAGATTATAGAAGTAACAAACTT
TCCCGAAATCCTTTGCGTTTCCTCTTTCCAGCCAGCGCCTGAGAATGGGTAAGTCATGGC
GGCTATGCGTCTACGAAAGTCTGCATTGCAATCTATATCCATCTCCTCGTTTGGCGGGCA
TCTGCTGCTCTTTCGTCGTGGGAAATTATAGTTGAGATTCATCGAAACCCATAACCGTAA
GAAGTGGGAGAAAATTGTATAGCTGCTCCGTCACTTACTACACCTATGCCAGAGAATGCT
GATGGTGGCATTTGTCATGGCGGCTCGCGTTGTCAAGTTATACAGTGAAACAGACAGTGT
TTTTTAGTATTATAACTCGGTGCTGGTGCTTTTCCGCGGTGCCAGTGTGTACGGTATTGT
TACAAACAAGACGCTGGTAAGGCCTTTGCGTTGATATAACCAGTATAAGCGCTTTTTTGT
GCTCTTAAAATTTCCCAACATTCGGTCTCGTTAAGTAAAGAGATCCCGCTGCAGACAATG
CGAACTGCTGCTTTTTTTTAACTTCTCCTACTTATAAGTAGGATGCTGCGCAATTAAACC
AATAGAGCCTTCTCATTCTTTGTTTTTTTTTTAAAGTGCCTGCTATTTTTTTCTCCATTC
TAATTCTAATTTTTAAACAGGTATCTCAAGGGACAACTGGCACAAGCGCCGCAAGACTGG
TGGCAAAAGGAAGCCTTATCACAAAAAGAGAAAGTATGAACTTGGCCGTCCTGCTGCAAA
CACCAAGGTTAGAATATAATACAAAAACCGCTTTGTTGCAAGAATGGTGCTATCTTAGTT
TTATCATTCTTTAGTGCACCATAATGTGTATTTGGGTTTGTGCTGGCTACCTGTAACCTC
TTAGTTGATTGCCTTAGCATTGTTATTGCATGCTCTGCAGGAATTCTATATTCTATAGTG
TATGAAATATCTGAATGTATATATATCTTTATATGTAACTAGTCATATTTATGGCAATCT
GTGATGAAAAGCTGTCCTTAGGCATGCAGTTCAGGCTGTTTTGGCCCTTGTTTTTGCTGC
CTGCCAGTGATAGGCCTGTCATAGTTACACTGATGGATTGCCTTTAGATTTATACAAAGA
AACTTGGTGGGTTGATATTCTGTTAACTTTCTGCTGTACAAAATATTTTAGATTGGTCCT
CGCCGTATCCACACTGTGAGAGTCCGCGGTGGTAACAAAAAGTATCGTGCTCTGAGGTTG
GATGCTGGCAACTTTTCATGGGGTTCAGAGTGTAAGTTAAAATATGCATTTACACATTCT
TAGTCTGCATTCTATAAAGACTTGCATTTAGTCCCTGCATTTCAAACTGAAGCAATATAT
CCACTGGCAACATTTACAAGACTGTATGTTTTGTTTATACAAATCACTGTTTAGAGATCA
AACTAGCAAGCACAATAATACTTAAATTATTGCTGCACCATCGTACCAGAATATCCCCTG
ATCAGTGCATTCTTCCTAAAGAGAAGCATGTTCCAGGGCTTAGTGAAGTGGAATGCTTAA
ATGGATAGTTTGCTTTTAGTTTTACTTTTGGTATGATGTAAACAGTGGCATTTGCAGTTG
GTCTTTTTAATTTAGCTTTTCAGTAGCTCTCCAACTTGAAATTTCAGCAGTTATTTGACT
GCGAGGGTTTAATTTACCCTAGCCTCCATGCAATGATGTGAAGAGACTGGAAGATGAGTA
GAAATGGCTAATAGGCTATTTAACATAATAAAAGTAACTAAGTTTAAGAAACATCCTTGC
TGGTTTTATTATATTCTTGTAGGCTAGATACAGCTGTCCAACGAAGACCCAAGAGCCTGA
TCCAGAACTTGAGGTTTTTATGGCCCTAGATTGCTCTTCTCAAGAGCACCATTAACCTCC
TTTGGTTGACATTGTTTTTTTTAATTTTGGGGACCCAACTTGGGCTGGACAAGTACAGGC
AACACATTGTAATTTAACAATGACTTGCTAGGCTCTAGTATTTAGAAACTTTTGCTTATG
GCAGATGTTTTGACTGTCACTCCTTATTCCCCATTCTTTCCCTCCAAAAGAAATTTTATT
ACATTTCAGCAGTGCTAATGATGACAACTTTGGCCTTATGGGGGTTTTCTATGATCTTTT
TGATCTTGAATCTCTCTGTGCTAGGAAAAGTCATAGTTACTCTGACTGCGCTGCAATATT
AAGGTTCAACAGTGCTGTGGTACCCAAGCAAAACATAGTGCACTCAACTCTCTTCAGAGA
AGACTTAACACCATTTTATCAAAGATTGATGGAGGGAGCTAGTGCAAAGTTCTAAAGTTA
CATGCTGAATAGCCCAGCTCCTATGTGTAGCCATTACTAACAAGCTTAATAGACTATTAA
GCTGCAGCAGTAACATACTAAATGCAATTTTCATCTTTATATCTGACTGTGTATATACAT
ATAACACTTGGATTTACCTTTTTTTTTTGTATTTAAAGGTTGCACACGTAAAACTAGGAT
CATTGATGTGGTGTACAATGCGTCAAACAATGAGCTGGTTCGAACCAAAACCCTTGTGAA
GAACTGCATTGTCCTGGTTGACAGCACTCCTTACAGACAGTGGTTTGAGGCCCACTATGC
TCTCCCACTAGGACGCAAGAAGGGAGCTAAACTCGTAAGTGTAGCATGAAGTTTAATACA
TCTTTGGTGTGTGGTTTTCTGTTGATTGTTTTGGACTGTATGGGGAGCAGTGTTAATTTT
TTTTAAACTCACTCTAGTACATCCTTTGCTATGATAATAAATATGGTAGGCTTCCACCTT
ATGCCCAGAATTCACAAGACAAGAGTAGTCTACTTGATAACTTTCCTTTTCTTCTAGCTT
CCAGAAGAATCATTGCATTTGTTTGTAAATAGATCAGTCACTGCTGGTACCTTTAGGTGG
CCAAGTGGGGTCACTTAGGGCAATGGACCATGAAACGGGTAAGGGGCAATTAAAATGAAG
CTGAAATGGATTTGTCACTTTTGATGAATATATACTAGGCACTTTGTGGTGCAAATAAAT
GTGGCCTACACAGGTCCTGTAGTTTTAATATAGCCCTTAAAGCTGGCACACTTTACACAT
TTTAACTTGCTGTCCTGCCATTTATTGGAAAAGCTGTTTAAAAGGCTTGGCTTCTATACC
TCTATTATGATTCAGAATTGTGACACCTGCTTTTCTGTTATCTTCCAAAGAAATTGGTAT
TGACATGAAGTTGGGTTTTTTTTTTTTGTCCCTTTCTATTCATGGAAGGCCTTCCTCTAT
CTGTCGATACATTGTTGCTTGGTTTTGCTTTAATATAGCCACAAGTGATAGTGGGTTTGA
GCACCCATTCTCTATGGACCTCGATTGTTTACCATAGTGTTAAAGTTTTGCTTTCGCTAG
AGCCAGGGGCCCTAATCCAAACCATACAAAACAACCCCAGCCCATTATTTGTCATTAGAC
TGTTTCCAATGCTTCTGCCAGTGTCCTCCAAAGGAGTCTACATCTACACCACTGGCCAGT
GCTTGGCATTGTGTGTGCTGATGTGAGGTTTTGTTCATCATAGTCTTGTCCTAACCTCCA
GAGGCAAATTTGAGTATGGCAGTGAGTGTTAACAAAGGGGAACATCATTTTATTAAGTAT
CCTAATATTTTTGGCAGTATAGTGCATTAATATCTATAGTATGGTGTCCTGTGTATAAAT
ATTTATTTTGCATATTAGTTTTTCTTGTTGAATCTATGCCTGTTACCAATTTACATTTTA
GACCCCTGAAGAGGAAGAAATCCTAAACAAGAAACGATCTAAGAAAACACAGAAGAAATA
TGAGGAGAGGAAAAAGACAGCAAAAATAAGCCCACTTTTGGAAGAACAGTTCCAGCAAGG
CAAACTGCTTGGTAAGTGAGTTGCAATTAGGGTTATAAGGTTAAGATAACCGTTGAATGT
CATAGCTTCTACAAAAGTCAGTAGCATACAGGATTTTGTTCTCAGTCTTCCAACTTGTTT
CAAAACAGTGGTCACTCCTGAACTCCACTTAGATGCAGATTCTCTATTTCATAATCCTTT
AGTCTGACTTTTTGCAACTTCTGCATAATCATAGGCCTATGAATATACATTTACATCAGC
AGGTGAAAAATGCATTAGGCTAAAGGAATATGAACTAAAGAATCTCATTTACCATATCTA
AGTGCAATTACAGAATACATATAATATCTCTGAAAACAAGTTGGGAAGTTTTTCCTTCCC
AGGCTGTCCAAATCGTGGCACCTGGACAACAAAGTTAGGTGTTAGTGGTGATATATATAT
ATCTATCTTCCTGAATAGAAGTTTTGCTTTGGGTTGAAGCACTGCATAACTGAAGTTCCA
GACCTTGATTGTAGCTTCTGTTAAGGGCTTAAGGCATGATGCTTCTGAACCATTAATTAA
AATTTGGTGAGAAGAGCTCTTCTGAAAATACTTTGGGCATTTAACTGTTGCACAAAACAG
TGGTATATTTTTATGCATTGTGTTATGCTCCACATTTTGTAACTTCCTTTTAGATAGCAG
TCTAGTAATTCACTAAATGTTATCCTCTGTAAAAAGACACAACCATTGAGTTCAACCTTT
TTGTCAAAATAAAAAATTCCTAACTGCAAGGTAATCCAGAAGAATGCAAAAAAATCCATA
AATTTTTTCAGGAAAATTCCTGATTTTAAAATGGCATTTGGACCAGTTTCTAGACCATCT
TTGCGCTAAGAGCTTATTTTACTAAAGCTTTAGGCAAAGAATTCAACAAATTCACACTTT
ACTATAAACTTTAATGCTACCTGAACCTATAATATGCACATAGAACCTCATTTCTAATCT
GAGTGGGTGCTGTTTGCTAGAATGGCCATAGGTGAATAAATTTAGTTTATTGTATAGTTC
CTTCATATATTTATAAACTCAAAGGGGATCCTTTTAGTGACTCTTGCCTGTAATAATTAC
CAACATGGACAAAATTTCTTCATTATAAGCGTAATATGCCTTTTCAGCACTAAATGCCAA
AATTGTACTTGCATATTGAGGATGTCTTACCAGTGTTAGGTAAAGGGGTAAAATTACCCT
CCCTCTCTCAAGTCTATGCCATGAGCTGCTTATCCACAAATACCCCCTCCGTTTTGTTCA
CCGTTAAGGATTTGTTTAACCTAGTCCTATTAGGGTGTATGTGGCTTGCCTATTAAATGT
AAGGCTATGCACAGATTTATCAACATTAAATCTCATCTGCCAGCTTACTGGCAGTGCTTT
GTCTAGATCTTTGTTCAAAGATGCCACATCCTTGATACAATTTTTTGGCCTTTATAGTTA
TTAGCAAACACCAAAGGTTAACAACAAATGGGTTTCAGTAGCTTTGTTTTGTTCTGTATG
TCTACAATGTAAAGAAAGTTTCACTTTAGCTGTGCTTGGAGTGTCTGTCCAGGTGCACTG
CAGTAGTGCTTCACACTGTCATTTGCCCTGTATCATGTTGTAATAGTGGAGAATTCCCTC
TCCCTTGTTAAGGCAAAATAGAAATGTACTTAGATGCTGGAGTTAATCAGTTTCCTTGTA
GTACCAGCACAGGGGCACATTGCCTAACCTGAGCAAATAAGACAATTTAATAGGGTTTGT
GATGTATGTTACATTTATTACAAAGCACCTATGTTTGCTTCTATAACCATTTGGTTTTGT
GTGTGTTTTTTTTTTTTTTTTTTTTCCAGCATGCATAGCCTCCAGACCGGGACAGTGTGG
TAGAGCTGATGGTTATGTACTGGAAGGGAAGGAGTTGGAGTTCTACCTGAGAAAGATCAA
GGCCAAAAAGGGGAAATAAACATGTTACCACACTTATCATCAAATAAATGTTATTAAAAC
AAGCTTTTAAATCGTGTATTGTGTTTTCTGCATAATACCAGTAACAAACTGTCAACAAAT
CTGACTTTAAGCAAAAGGAGGTTACTATATATTGACCAAAAAATGGGTGAATACTTTTTT
TTTTTAAGGAACTTTTTGTGGTTGCCTTTATTGTCTACATTGGTAGACAATAAAAGCATT
CTGGCTAACAAAATTGCAAGACAAATTAGCCAGACTCATTTGTCACTGTCAAACTTAACC
AATAAGATGTTTGCTTTTAAACAGGTGACTAGAAATTGCCTGCTGATTGATTGCTGTAGG
TTACAGTGCCTGACAAAATTAAAGTATTTTTATAGATAGTACCACTCACATCATAATGTC
TGAACTTCAGAAAACCCTTTGTTTTCATCTAAAAAAAATGCCTTAGATTGTTTTTTGTTG
GTAGGTCAAACCTGCAGTAAAACTAGAATTCCTTCTGCTAAAACCCTTTGAAAATATTGC
TGAAAACTCTCCAGGCAACAAAGAAACCAGCATGTTTTGCATTCTTACCCAAGGATGAAT
TTTGAACCAATACTGCCCTAGACTTTGCACTGATGACTGCTTCCCCGTCCCAAACAGTAT
AGTATCTGCATGCATGGATTGAGGTATAGGGATGTATTGAGTCCCCGCTACTCCACTGGA
TTTAGCTGCCATGGCAGCTTGGGGGATTTGTACAGATCTGTGCCTTCATATAAATGAACC
TGCTTTTACTGAGAACTAGAATACATTGGATGGAGCAAATTGCATGAAGATTGACTTTAA
CTAAGCCTGACACCAAAAAAAAGTGTGTACCTTTAACGGTGCACAAAAATCCTGTTTTCC
TGTTACCTTCTATAGTTTTTGGTAGTTGAATATATACAGAAGAATACGAAAGCTGTTTTG
TAATGGTTTGTGCTTGCATTTCTGTATAATCTATTCCTACTTTGAGTATTCTATATACAG
GTCCAGATGGCAACTTGAACCAGTGAATTTGTTTCCAGATATTGCAGATTTATACCACAG
TTCTTCATTTTTATTAGGTGAGTGTTTTTTTTTTTTCTATTGAGCCCCTTAAAACACTAT
TTTGTACTAGATGCCAAGAAAGATGTAATGAATCCTTATTGGAGGCATAATAATCCTATA
AATTATGTTCAAATAATTTTTTAGTAGACAAAGTATAGAGATCGATATTATGGAAAGATA
CTTTATCCAAAAAAACCCAGGTCCTGAGCATTTTGGATAACGATCCCTAACCTGTATGTT
TTAAGTTTAAGTGCCATTGTATGCGATTGTGGTGTCTTCTGCTGATGATAACCTTGTCCA
GTTCTGCTACTGAGACTGTACGATGATATTCCTTAATCTGAAGAAGAGTACCTGATTATA
TATTGGTTATTGATGGGTATGTTTTAGGCCATTTTGTAGTCTGCACAACAACCCATGTAA
ACTGTGGGACAGTGCAGGTTCTCCAATGGAGAACACTGTACTATGTACCATTGGTACATA
GAACTGGATACAGCAGTGCTTTTGTTCTTTTAAAATAAAATGCTTTTATTGCATGCTTTC
AGGGCATTGAAGCTGAACAGCTTTACTGTGGTGTTGTTCCAGATTGTATCTCATCCTTGG
GCCTTTTTGTACCCAAATCCATAATGTTTATCCTTTATCCTTCAGATAACCTACAAGCGG
AGAACACCTGCTAACCAGTCTTGTCATATGGAGTAAGTATGCTGTATTTGAATTTGCAAT
AAATGTTTTTAAATGAGGGGTTGATTTTGACTAAATTATGCTTAAATGAGGGGTTGACTA
CTTGTGATGCCTGTCTTTGTAGCCTGTATAGCTAAAGTAGTAACTGTGCTGGTTGTTTGC
TATAGTACTTAAAGGAGAAGGAAAGGCAAAGTCACTTGGGGTTGCCAAAATGTTAGGCAC
CCCCAATTGACATAAACCGCCTACCTTTTACCCTGGGCTGGTGCCCTGTTCGGAGGGAAG
CCCGAAACATTGCCTTTGGCACTTAAGTAAAGATTCACATTTTTCAAAACAACCGGAGTG
CTGCTGTTTTCTTCATTATTTTCATTTCTGTTCGGAGAGAACAGCACCAGCCCGGGTTAG
CTGCAGCGCTTCCTGCTTCGCTCGCGCAGTAGTGAAAAAGCTACAGGTACCCCAGGCTGG
TGCTGTTTTCACCTAACAGGAGCACCAGCCCGGGGTACAAGGTAAGATATTAAAGTCATT
TGGGGATGCCTAACATTTTGGCAAGTGCCTTTCCTTGTCCTTTAACCAGCAATTGTTTAA
AGCGGCATTGTCCTGCTCAGTGCCTGGTAGTTTTGAAGGTTATAGCAGGATAAGGAATTT
TAGCAATTATGCTATACATATGTTTTTGTGTGAGCAACTAATCTCCTGTGTGCCATCACA
CTTGGTTTCAGTTGTATATTTTGATACTGTAAGTGTGCACTGCTATCTTCATGCTGTCTT
CATGGTCCTTTCCTTGACTTTGGAGCCTCATTCCAGTGCAAGAATAAACCCCTTCTTGCA
GAAAGATCAGGTTGTGCTGTAGCCTGACCCTTCCGAGAGTTGGGTACATTTTGTAATTCA
GTCATGCTGTGAGTTTGTCACATATAACAATAGCTGACTGGGCATGTAAAATGAGTTTTG
GTTTTATACTTATACTCACAATGGGATGGTGCCCACCATTAGCATGCAAGAAATTATTGG
GAGATGAAAGGCTCTCCAACTTAAAATATGTATTTACACAATTTCCTATGTTTTGTGGTT
ATAAAAAAAAAAATAGTTGTAAATTCTTAATGAGCCTTCATTAGAGCAGTTTTCTCTATT
GCGTTCAGGATAAAATTAAATGCTTATGGCTCAGCAAAATTTTATTTATGTTCCTAAACT
TTCACTTTTCGAGACCCAAATGTCAACTTACGACAAAACCTATATTTCCTGTATACTGTA
GATTTTTAAAAGACACCCCACTCGGGCATCTTATTTACTCAGTGTGCTTTTTTTTTTAGG
TGTGGAATGTTAACTGTACACATTTGTGTTCCAAGTTATGGGGAGATACATGATCGAGTA
AATTCCTTGAGTCTGAAAGTTAGCCGTTTAATATGGCAGAGTTCACAGGGATGCTGGTGA
GTGTATCAATATGTGCATTAACTTTTTTGTTTAATGCAGTTTTGAGACTAAGGTAGGATG
GGTAAATTTGCATGCTACATATAGAGGGAGGCTAAGCATGGACAGGTTTTGTTTAAGAAA
TGTTCAGGGATGTCTAAACACTGTGTTAACACATGCATGTAAAGCCCTAACACACTTTGC
AGCACAGAGTAATAAAAGGGTGTATACAATTGGATAACAAATACAGTAACTGATTCAACT
TGAGGACAGCTCTTTCAACCTTGTGTATTTAATTGTTCACATTATAGTGATGAGCTGAGG
CAATGTAGTTAGGCCTTATCCCCATCTTTAACTTAGGGCATGAATTCTCTTCAGAGTGTC
AATGATGTAGTAATGCTGCGAAAAAGCTTAACTTTCTGTGTAGAAAACAACCTTGGAGAA
CTGAGCACTCTGTTTTAACACATGGATAGTGTTGATGCTTGTCAAAAGGTGCTATTTAAT
ATTTGCATTTTGTTTGTAGGTCCCAAGATTGATTCTAGTGCAGGTGAAATGATACTACCA
TGAATTCAACATACAGGTACGTTCAGGAAGATGAAGATAGTAGTTATCTTCATTAATTAG
CTGCTTAGTGGTACTCACTGTTCCTCTTCTAAAAATGAGCGATGCAAACACTGAGTTACC
TTATGCCTCCATTTGTTTTTTACATAATTTTTGGGCGAGCCCATAACACTAGATAGGTTA
ATTGCAGTTGGAGGCTTTTCTAGTGATCACATTTGAATCCTTTATATATCTGTTTTTAAC
CCAGGATAAATGGTTTATTTGCCTGTTTGGCTTTTTTTTCTATTGTATCTAATTTGCTGA
GTTACGTCTTCTGCTGATGATAACTTTGTCCAGTTCTGCTACTGAAATTATGTGGTGATA
TTTGTCAACCTGAAGAAGGCAACCTGATCATAAATACATTAGTAATGCCTGTTTGTCTAT
CAATTTAACACATTGGTTTTCTTGTCCCCTTTTAGAGAAATAAAAGTGAAGACCACTTGC
TTGTTTTAACCCTTGCGGTGAGTTTTGTTTTTTTTTGTTTTTAGCATTAACTGATTGGCT
TTTTTTCTAGTGTCTTATTTGCTGAGTTTTGTCTTCTGCTGATGATAACTTTGTCCAGTT
CTGCTACTGAAATTATGTGGTGATATTTGTCAACCTGAAGAAGGCAACATGATCATAATT
TAAGTTAGTAATACCTAAGTTTGTCTATCAATTTAACACATTGATCTTCTTTTACCCCTT
TAGAAATAATAGAAGAGCAGAACACTTGCTTGTTTTGACCCTTGCGGTGAGTTTTCTTTT
TCTTTTTTTTTTTTTTTTAAAGGTTAACAGGTGTACAAAATTGTTAGTAAGCGGTCTTTA
ACTTTTTTTTATCCAGAGTGTAAATGATGTAACAATGTTGCAAAAATGCTTAATTTGCTG
TGTTGAAAACAACCTTGGAGAACTGAGCACTTATTAGCCCATGAATATTGTTGGTGTTTG
TCAAGAGGGTGGGGATCTTAAATATTTCTTTACGTTTTGCTTGTAGATCCCAAGATTGAT
TCTAGCATGGGAGTGAAGAGGCTGTCATGAATCTGACTTGCACATACAATCTACCTTCTT
TACATGCCTGCATATTGTAAGTGGCTTGATAGGCAGTAACACCCTACTTGCACCACAAGT
CTAGACAGTGTTAGTGTACAGCACAAAAGTGCCCTCAGATTGTTGATGAATACACTACTC
TTGCCCTTCCATACCTGCATATTTCAGAATTGGTTTAAAGAGGTCCAGCTGGTATTTTAA
CCAACATCTTACTGATGTGGTAAGTTGGCTTTATTAAGTTTATAGGTTTTTCCCAGTTTA
TAGATTTCTACTAGTGATGAGTGGCTTTAAAGGAAAACTAAACTAATTCACTGGTTTCCA
AATATTACACTACCCTCCCTCCTCCTGTGTAACTTTGAATAACTTTTTTTTTTTTCCACC
ACCAGGCCAGTGCTCCTTTTAGAGTAGTAACGTCAGTGTGGCACCACTGTAAACTTATTA
CCTTTTACTTGTGAAGACTTAGGTTCACAAGATTGTCTGCTGAGGGACCCATAATGGCAG
GAAACTTTGCCATAGAAATGTCCCCAAGGCTGGGGGGAGCATTAGCCTTTGGAAAAAGCA
AACTTAACAGTTAATTTCAGATGGTACTGGAGGGCAGGGGTGCCTAAGGGTTTTAGTGGC
CTTGGTGTGCCATTACCCCTAACATGCTTCACTAGACATTTTAAATTAATCATATAGCAG
GAGGCAATGGGCTGTTTTCAAAAAAAAAAAATTGAATCAACTGTGTCCTAAGAGTAATTG
TGCCACAGCATTTATTTGTACTTTTTGTTTTACGTACTACTGACAAGTTTACACAAACTT
AAGGATTTTGAATCCTTTATATCAGTCTCTGTAACACAGAGCACTAGGGTTTCTTCATGA
ATTGGTTGTTGGTTAGTCTCCCTCTGATACTGGACTGTAGGAGAAAACCAGAGGACTTGG
AGGGAACCCACATGTCCGATACAGGACAGATGCCTGGTCTTGGATGTGTGAAAATGGGTG
GGACGGTTATTATACCAAAATCTAGACATTTAGAGGTGGATACTGTTGATCCTATGCCCG
TCAGCACACATTATCCACTGCCTTCCGGTCCCTGAATGGGTGTAGCATAGGATCAACCTG
TGAACAGTGGGTTTTGGCAGAGTACATTTATCAACACACATAATTACATATATGTTAAGG
ACAGAACAGTGTGTATTTTTTAGGCTTACATGTATCAAAAAAAACTGAGCAGCTTTAACC
CTTTCACTGCCACCCGTTTTGGACAAAGCGGAACTTCTAGTGCCAGACAACTTTCGAACA
TTTTGCACTGTAGCACTTTGGGGGCCTTTCCTCGGGGGGACTTTTAGTTTACCCAGGAAA
ACAATATAATTTCTCAGGACAACCTAAGATTTTAAAATGCTAGAACATACACCAGAAACA
TTAGTTTATGCATGAAAATACAACTGATTTGTATGCAAATCCATGTCTCCTGAACATGCC
AATACCAAATATATATAGGTTTATGGAGATTTGTCACTTGTATAGGTCAAAAACTCCAAG
CAGTACACTACCAAATTTCTGAAGCACTGCTTCAGAAAGCTGCATACTTAAATTGAAATA
GATTTCAAGGCCAAAAATTCCACTAACAGAAGGTTTCTCCCAGAAAATGATACATTTTTA
GAAAGAACAGATTCTGGGGAATCCAGAATAAGTAGAACGGTCTGTCTACTCCAAACTACC
AATTTGCAATGCTTTCGTAAATTTATTGGTATTTAGCAATTTGTGCAATTTTTTTAAAAA
TCACTTCAAAGCTTCCAGTTGATAGTATCTTATCTCCTACAGGTCATAAAGTAACCAGAT
AAAACACTCTAAATTTGAACTCCAGGGGTCAACTTAACAGTTTGATGCCCAATATGTATA
GGTTTACCCAAGTATATGGCATGTAGGAGCCCCAATGTAAACATCCCCCCAAATGTTCTG
TCATTTCAGCTCCTGCGAAATCAACACATTTACATGCTTTATGTGGGATAATGTTTCAAA
ATAGTAAGCTCACCACAGGAAGCAATATATTTTTGGAAAGTACACATTCCCCTGAATCTA
AAATGGGTACCAAGCCGCAAAGCTTTCCTAAATTTGACTTTTAATGGCACTTCCAAATAT
CACCTCAAAACTTCCACTATGCAGCATCTTATTTTCTACAGGTTATTAGGTACCAAGATA
AACCACCGTATATATGAACTCCAGAGGACTACTGGACAGTTTGATGCCCACTGTACATAG
GTTTATCAAAGCACATGGCATACCTCTACCTAATTCATAAACACATAAAAGTTTCATGAG
GGGTAGAAGCTGCAGAAATGTAGAGTGACCCCTAAAAAAACATTTCGAAAGTACACATTC
TGACAAATCTAACATGGGTAAATACTTTCTACACCAAAGTACCAATCTGGAAAGCTTTCC
TAAAGTTTTAGTGGTTTTTATGACATTTTGGAAAATTGCTTAAAAATGTTGCAGTTTGCC
GCATTTATCTCACAATTTCTTGCGTACCTAGTCAAATCACCTAAGGTCTACTGAAGTTTG
ATGCCCAATATGCATAGATATACCAAAGTCTGATATGTACTGACCCCAAAATTAAAATCG
CACATATGGATTTCTCGCCTGCCAACTCAGCTTTTGCATACAGAGCCCCTGACAGCGTAT
TATGTGCAGTAACCCCCCCTAACTATACAGAGACCCCCAGGAAAACCATATATCTTTGGA
AAGTACACATTCTGATGAATTCAAAATAGGTAGTTATTTTTCTACGCCAAAGTACCACAC
GGCAAAGCTATGCTAAAACAGATTAGAAATACTAATACAGGGATAAAAATGGAATAAAAC
CATTGTGTAAATCAATGAAACAACAAATTAAGTCACCCGACAGCGTAACTAGTGGTTAGA
ATATCTGATCCAATAGTTGCACTGCCAAAATAGATGGCTCATTGCCAAGGGGGTTGGGGG
CACAACTGACTCTCATAAGTACCAACAAAATAGGTACTACATTTTTTTTTAAAACAGCGT
AGGTTGTTGGCAGGGAAAGGGTTAAGTTAACTATCTGTTTTGACAACAAGAGTAATTGTT
TATTTGTATTCCTGCTTTTTTTAAGCATTGACTGGCCAGTTGAACTTGAGAAACCACTGA
ATACAATCCAGTGGATGCAGATTTACACCAGACTCTTAAACAGGTGGGTTTTTTTCCTAC
TGAACCCCTATAATGGTAACATACTATAACTTAGTAACAATTTAGTATATACTAAGTGGG
CACTGTCTTCTTCTGATGATAACCTTGTCCAGTTCTGCTACTGAAACTATGCGATGATAT
TTCTGAATCTGAAGAAGACTATCGGATAATAAATAAGTTGAGTTGAATAGGTTTTGGGTC
TATAACACTTTAACTCTAACTTTTTTTTCTTTACCTCCCTCAAGGTAACTAACAACTGAC
ATAGAGAAGCGCTCCTGGGGTGCTGATGCTGTTTTAACTTGCAATAAATTGTGTACATAA
ACCAATTTGGCTGGTATTTTTTTTACTATATTTAGTTATTGACTGCTTGTTTGTAATATG
TTTTGCTATAGTAAATACCCAACAACTGTTTACAGCTGCATTGGCTTGCTTAGGTGCCTT
GTGCTACTGATTAGCTTCAGTTGTATTTCTAGATAAGTGTGCACTGCTTAAGTGTCTTCA
TGGTCCTTTCTTTGACTTTGGAGTCTCATTCCAGTGCCAGAATAACATCCCTTCTTGCAG
AAAGATCAGGCTGTATTGTAGTCTGACCCTTCCGAGAGTTGGGTACATTCTTATACCTTT
TATGTCTAGGTTGTACTGTTCAGTCAGCACTTTCAGGCTTTTTTCCCCCCTATGTAGTGC
TTTTGTTTTATAGACTAGTCAGTGGGATGTTGAATTTTGGCTGCAATCAAGATAGTCAAC
ATCTGTTTGGAGATAGCAATGACACAGAATTTATAATACTGGGGATAAAGGCCAAACCCT
GGCATCCGGGGAATAGTTGGCTGTGGTCTTTTGCTAAAGAAGCACTTCAGACCGAGTCAG
CTGTATGCTACTAAATTTGTCTTAAAATTGACAAATTGTAAATCGAATTAAAATAGGGTT
TGTTGCTGTGATGCATAAATGTATTGCAATTACACCTTTAAAGGAGAAGGAAAGGTAAAA
ACTAAGTAAGCTTGATCAGAAAGGTCTATGTAAATACAGCCATAAGCACTCACAGAAACG
CTGCACTGACTTCTATGTAAAAAGATTAGTTGTGTCTGTTTTCCTCTGCCAGTGACATGC
AGCTTTCAGCTTCCTGCTCCCCCTCCCTTAAGAATGCTAAGAACTCACCCCCCCGCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1010, 1583..1686, 2091..2190, 3398..3573, 4681..4810, 6629..6790
1004..1010, 1583..1686, 2091..2190, 3398..3573, 4681..4810, 6629..6738
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved