Xenopus_tropicalis Locus Q6DEU4_XENTR
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis Q6DEU4_XENTR
Xenopus_tropicalis
Q6DEU4_XENTR
scaffold_217
SNORD58, SNORD58, SNORD58, SNORD58
2753..2823, 4331..4398, 5622..5688, 6355..6421
7712
CTGCGGGGTATGTTGGCGCGTTATAAATAAATGGTTATTGATTGCTTTATCTTATATGT
TACTCCTTGTAGAGTGTAAGCTCTTTTGGGCAGGGCTCTCTTCCCCTCTTGTATCGGTTA
CTGATTGCTTTATATGTTACTCCTTGTAGAGTGTAAGCTCTTTTGGGCAGGGCTCTCTTC
CCCTCTTGAATTGGTTATTGATTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNATGTTATGGGTGTCATAATAGATACGAATCTTATTTTTTT
AATGCAAATCCGGCTTTGTTTCCCGGCTCCGGAGCAGAGTTATTAGCGGCCCCGTGTCGG
GCAGAGCTGGAGGGGTGTTTACTGCCTTGTCAGCGGCTCGCTAAATATGTATGAGCCGGC
GCCTCCGCCAACGCTCTGTTTACTGCCAGCGGCAATAGCCCCGGTGCTGGGGTAAATAGA
CTGCCACTGATACAAGGGCATAGTAAATATGTTACTGTATTGTACAGCGCTGCGGGATAT
GTTGGCGCTTTATAAATAAATGTTAATAATAATAATAACAGTTACATGAAGACAATATCT
ACCACACAGATGTATGTATCTACTTCCGGTCTATAATCTCGTTATACAACATCACTACAG
AACATTCAGTTCTTGTGTCATTCTATTGACTCCTCAGGGTATTGCTTTCTGTTTATGTAG
CACACGCTATGTAAAAGAACTAACCCACAGCCGTACGTTGTAATTAGAGACCCTGGTTGG
CAGCTGGTTGGCAACATGGCCGCCCAATAAGAGGCGCGAAATCTCGCCGTTGATCTCGCG
AGAGTGTAAGCTGTGATACCGCTCCCAGAATGCCTTGCTGTCCCTCTTCCTGCGCGGCCT
GAGGTGAGTGAGACATGGCTGCCGATGCTGGGTGCGGGCTTGGGGCACAATCCGCTTGCT
ATCTCCGCCATCCCTTCCCTCACGGTGTCTGTTTCCATCCGGGAGAATCTGTGGAGGCGC
TAGTATGGGGGAGGCGCTGTTATTGCGGCTAGCTGTGCGGTGGGAAGCGGTTTGTGGGCT
GTTGGAGATGCCGGGGACGCGGCCTAGGGACCGGGGCTTTATACGGGCAGCACCGCGACC
TGTCAGTAGCCGCTTCCCTTCCTCACTTGCCCCGGTGTGGCCGCCTCCTGTTTAGTCGCA
TCCCTAAGGCAGCAACAGGTATTGGCCGGGAACATTACCCATCATGCTGTGCGACTGCAG
CTCCCACTATTGCTTTAACCAGAAGAATGTTGGGAGTTGTAGTTCTATGTCAGGCTTTCG
TCTTTATTTTTTATTTTTTTTTGTCCCTCTTGGTTATACTTTTAGAGCAGTACTGCTGCC
TGTAAATGTGCAGCTCAGGAGGTTTGCCTGTCTATGGGTGCCCAGTGTTGCCTTACTATT
GGCTGCCTTGTCTCATAGCCACACTATAGGGCTTAGACACACGGGGCGATTAGTCGCTGC
GATTCCCATTATAACCTATGGGTGAAATGTTGCTGCAACTGTCTTAGTTAAAAGTTGTGG
TGACTGATCACCTTGTGTGTCTTTGCCCTTAGGGTGAAGACACATGGAGCTACTAGTAGC
AGCTAATTGTGACTACTAAAATAGACAATGCTGATTATTTACTGATATGTCTGTGTGTTT
TAGCAGATGCAATTCTCAGTATTGTCTATGTAAAGGTATTTTCTGGAGTTTAGTAGCTGT
GAAAAAGTAGCTGCTACTAGTAGCTCAATGTGTCTTCACCCTTCGGGTGTAGCTACTAGT
AGCAGCTACAGAAATAGACAATGGTGATCATTTAGTCTGTGTTTTAGTAGAGGCGATTCT
CTGTATTGTGTGGAAAGGTATTTTCTGGGGTTTAGTAGCTGCTACTAGTAGTACAGTGTC
TTCACCCTTAGGGTGTAACTATTAGTAGCAGCTACAGAAATAGACAATGCTGATCGTTTA
CTGATAATTGTCCCTACGTGTGTTTAGCAGAGGCAATTCTCAGTATTGTCTATGGCAGGG
GATTTTATGGTGTTTAGTAGTGCTACTAAGTAGCTCCATGTGTCTTCACCCTTAGGGTGT
AACTGCTAGTAGCAGCTACAGAAATAGACAATGCTGATCATTTACTGATAATTGTCTGTG
TTTTTAGCAGAGGCAATTATCAGTATTGTCTATGGCAGGGGATTTTCTGGAGTTTAGTAG
CTGTGAAAAAGTAGCTGCTACTAGTAGCTCAATGTATCTTCACCCTTAGGGTGTAGCTAC
TAGTAGCAGCTACAGAAATAAACAATGGTGATCATTTAGTCTGTGTGTTTTAGTAGAGGC
GATTCTCAGTATTGTCTGTGTGTTTTAGCAGAGGCAATTCTCAGTATTGTCTATGGCAGG
GGATTTTCTGGAGTTTAGTAGTGCTACTAAGTAGCTCCATGTGTCTTCACCCTTAGGGTG
TAACTGCTAGTAGCAGCTACAGAAATGGATAATGCTGATCGTTTACTGATAATTGTCTGT
TTTAGCAGAGGCAATTCTCAGTATTGTCTATGGCAGGGGATTTTCTGGCATTTAGTAGCT
GCTACTAGTAGCTCCATGTGTCTTCACCCTTAATGATTGTGACTTTTATGGAACTGCAAT
GATGACTTTCTTAGGACACCTTTGGAAATAAAAGATGAAAATAACACTTATAATACTGAG
CAGTTTCAGCTGATAAGTTTCCCTTTGGTTGCTTTGATCTCTACTTCTATTCTGAATATT
TCTCTCTACTTTGTGGCAGATTCTCTCGGAACAATGGTGCGCTATTCTCTCGACCCGGAG
AACCCCACAAAATGTAAGTAAGGTGACAGTCATAACTGAATTTATTATAACAATGTCTGT
AAGTTCCTTCTAACAACATTATTATTATTATTATTATTATTATTATTCCCGACAGCATGC
AAGGCACGGGGCTCAAACCTTCGAGTGCACTTTAAGGTAAGCTTGTAGGCTTTACTTACC
CTTGGTTTGGGGGGGGTAATGGGATCTGCATGGCTGCAATGATGTTGTTATTCTTAGGAG
ACCTTCAGATTTATAGATGAAAAGAAATAAAGAATTCTGAGCAGCCATGTTGATCTCACG
CTGATGCCCAGTTAGTATGTAACATGTGGGGCTGGAATAGACCTGCTCTCTGCCAGTGCC
TCGTACCTGAGCAACTTTTCAACTGGTCTTCCTTTTTTACTACATGCAGTTTTTGAATTA
TTTGCATTTCTCTTCTAACTTTCAATTCACGGTCACTGACCCCGGCAGCCAAAAACTGTT
GCTCCGTGAAGCTACAATTTAATCACTAATTTTGTATTATCTTTCCGTTAAGTCAATGCC
TATATTCCAGTATCATTCGAACCACTGCCTGGTTGCTAAGATAACTTGAAACCTAACAAC
CAGATAGCTGCTGAACAAAAGCCAAATATTTCAAAATCCACTGAAAATAAAAAGTGAAGA
CCAATGGCAAATTGTCTCAGAATATCTAGCTCTACATTATAGTAAGTTCATTTTCAGTTG
AACTTAAAGCAACTCCAAGCAACAATGTACTAACATCTAGTGGGAGGCTGTTAAATGGCC
CCGATAGAAACACGAGGTGGCAAAATAGGTTTATTTGGGTCAAATAGGCAACGTTTTGGG
CCCTTTCTCCAACCTGTCTGGTAATAGAAGTGTTATATCCCCAGGCAGGTTTGAGACTGG
GCCCAAAATGATCTTTTCTTTTTTAGGCTCCTCGCTAATTTATCAAAGATTTTTAGATGC
CAGTATCTCCCTGGGTTACTAGACTTAGAGCAAATGGTTTATTTCCCCTTAAGTGTTTAC
TTTGTTTCACTTATTTAAATGTAATATTTTTGTTACTTAGGTTTCAGTGCTTGGGTTGGT
GTTCCTTTGGGTAATTGGCCTTAGGCTTTAGTGGGTAAGATGGGTTTCTTTATGGGGTGA
GAGACTCATTTATTTGCCCGTGGATGTTTCTCAGATTTGGATTTGTCTTCCCTAGAACAC
TCGTGAAACTGCTCAAGCTATCAAAGGCATGCACATCCGTAAGGCCACCAAATACCTGAA
AGACGTCACCCTGAAGAAGCAGTGCGTTCCTTTCCGCCGCTACAACGGGGGTGTTGGAAG
GTGTGCCCAGGTATGTGTTGTGTTTTTCAAAATGGCGGATTTGGTGGGGGGTGTGGAGCA
ATGACTACTGGTTGCAGTGATGACTATCTTAGGACACCTTTGGAAAACCCATGAAACAAA
AAATTTTATTCTGAGCGACCTTGATATCCTTCAATTTAGAATTTATATTTGTGTATCTGT
AGTGGGGCAATGCATATACTCCACACACAATTCTCTCCATGCCTGGAGCACAGATGTTTC
AATATGGACATTGATAACCTTGGAACTTTGCTTCTTTGTTTTATATTTTAACTTTTTTTT
TTTCTCCTTGCATACAGGCTAAGCAGTGGGACTGGACACAGGGACGTTGGCCAAAAAAGA
GCGCAAACTTCCTCCTGCACATACTGAAAAATGCTGAAAGCAATGCAGAAGTCAAGGTAT
GGAGGTATCTTAATACTGGGGTTGTGTTCCTACTTTGTAACCTACCTTGCACAAATAGTT
AGGAAGCCCAGTTGCATAGCAGTCTTAGCTTTTCCTTTTTTTTTTTTTTTGACATCCTAA
ATAGTGTGTGGCATGCAGTACATGAGTTATAGGGATGCACCGAATCCAGAATTTGGCCAC
ATTCCTAAAATCACATGACTTTTTTTGTCACAAGCAGAAGTTTTTCAGTATGCAGTTTAA
TGCTTCCTTATCCTTATTTATATATACAAATTAGGGTTTGGGTTTTGTGGTTAAGCCGAA
TCCTAAAGTAGAGAATTCAGTGCATCCCTAGTATTCAATGGCTGATTACTGGAGACAGAA
TGCATTGACTCCTTAGATCACTTCAGCCTCTGTTGCTAGTCTGGCCAGGGTTTTGTGTGC
CTATTCCTTAGGGCGAGGGCAGACAAAGCATTAATACGCTTCTCTCGGCCCTGCGCTTTT
CTGCCTGGCTGAGAGAAACAGATCCACTTTCATGGTTTCTAGGCCAACCGCCGATCCGCT
CTGCTCTGTGCGCTCACACTGGCTGTTGCCATAACTTTTAATAGGGATGCACTGAGCCCA
GTTTTTTAGGTTTGCCCCAACCCATCCCCAATGTATTTACTAATTCTGATTCAGTTTGGC
CAGGACTGTGGATTCAGCCAAAGTTGAACCCTGCCAAAAAAAGCCGAATCCTGGCCAAAT
ACCGAACCGAATCCTGGATTCGGTTTAATGCGCACACACGGGGTAGCATAACTAAGCGGA
TCCGCTTCTGAGTCAGACAGAAAAGCCGCCTTTTCTCAGCCCTGAGCTTAACGCTGTGTC
TGCCCTTGCCCTTAGGCCAACCCAACCATTATAGGCTGAGACCATAAGCTTCTGTCTTGT
AGCCGGTCTCCTGTGATTGTGTTATTGTAGAACATTAAATTGTGGCAATGATGACTATCT
TAGGACACCTTTGGAATCAAACATGAAACCAACCTTAATTCTGAGCCACTATTTTCCTAA
TGTAAGTAGAACTCTTCTATGAGGGGAATTTTGAAACATTTATTGTATCCATTGTATTAA
AAAGAGGCTGGTTGTCAGATCTCATTCTCTCGTGACATATTTTGAGACAATACAACAATA
CAAGTGATGTATTTTCCTAAATTGTGTTTTTGTTGGCACTGTGCGACTATAACTTTATCC
ATCTGCTTTAGGGTTTGGATGTTGATTCTTTGGTCATTGAGCACATCCAGGTGAATAAGG
CCCCCAAGATGCGCAGGCGTACCTACCGTGCTCATGGTCGTATCAATCCCTATATGAGCT
CCCCATGCCACATCGAATTGATCCTTACTGAGAAGGAACAGATCGTACCAAAACCTGAGG
AGGAAGTCGCTCAAAAGAAAAAGGTAATAACACTGCTATAGAACCTCTTTAATGAGAATA
TTAAACTATCAAACCGATACAATATAGCAGTTCATAGAGCTGCAGTACTGCGTCCCCATG
TTTCTCCGTGCCCCTCGCTACCTCCAGGGCTTTGTACATGGCTCACGTTGGCATGCCATG
CGTTTTGGTGCCTAGTCTGCCTTGAACTTCGTTTCTCTGGTGCGTACCATAGACATGGAG
GAGGGGGTTTAAAGGCACTACATACATAGCCGTGTTGCCGTGAAGCATTTATTGGTGGCA
ATGATGACTATCTTAGGACACCTTTGGAATCAAACATGAAACCAAACTTCATTCTGAGCC
ACTTTAATACCGTACCCCACTGATAAAGTAGCACGTTATGTTTTTGTGCATCCTTTTACT
TTAGACCTTGACCAAAAGATATCGGCTGCATACAGACCAATATTGCTGCTTGTGTATTTA
CTGCCCCCCTCCCATGTATACAGTGTGGCCAATGTGTATGTAAAATGGATGAGAACTGTT
ACTAAACTGGTAATTTCTTCTTTAGATCTCTCAGAAGAAGCTGAAAAAGCAGAAACTCAT
GGCTCGGGAATAAATACAACCTGTACAGAAATAAAGTCCCAAAAAACTGTTCATTTGCTT
CTACGCCTCATTCTTTAACTTGTGAATTGGCAGTTTACGCTTTTGGAACTAGTGTAGATC
TGAAGATCATGGTGAGAATTTCCTGTGGGGTTAGTTTTAAAGGCTGCATAGTTTTGTCTG
CTCTTTAATGTTAGACCATGTGTGTAAAATGGAATTGTGGCCAAAGACTATTGTTTGACT
TGTGATCTGGTATTGCAGCCTTAGAGAAGCCTGCCCTTAGACCTTGGTATGATAGGGTGA
TTTGTATTATTCCTGTATCTTATCACAACTGGTAAAAAGTCCACCAACTTCAACTGAATG
CTGGGAAAAAGACTCCCCAAGAGAGTACCAAATCCATGCAAGTTACTTCAGCCCAAGCTT
AACGTGTTGGTGACACAAAAAATTACTCTTTAAAAATATTAATGTACATTTAACATTACC
TATAGTTCATGTTGATTTTCACTGCTTTTGTTAGTACAGATATGGAATCTGTTATCTAGA
AACTGTTTATCCACAGTTACAAACTACGGGAAGGCCATCTCCCATAGGCTCAATTATAAG
CAAATTCTATTTTATAAAAAATGCTTTCCTTATTCTGTTATAATGAGACAGTACCTGGTA
CATAATCCCACTAAGGTATTCTTATTGGAGGCAGAACAATCCTGTTGGGTTTCAGTAATG
TTTAAATGTCTTTTTAAAGAGCTTCTCCAGCAGAATCCTGCATTGTAATCTGTTTTTCAC
ATGGGGCTAGCCATATTCTTCATTTCCCAGGGTGCCACAGCCATGTGACCTGTGCTCTAA
TAAACTTTAGTCACACTTTACTGCTGCGCTGCAAGTTGGAGTGATATCCCCCCCCCCTTA
CCCCCGGCAACCGATCAGCAGAACAATGGGAAGGGAGCAAGATAGCAGCTCCCAGTAGGT
ATCAGAATAGCACTCAATAATAAAAAATCCAAGTCTGACTTGGGACTCCTCCAGAAACAA
TAGGTTAGCTGAAAGCAGTTCTAATGTGTAGCG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1022, 2899..2952, 3055..3095, 4135..4269, 4577..4675, 5891..6082, 6625..6712
2904..2952, 3055..3095, 4135..4269, 4577..4675, 5891..6082, 6625..6669
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved