Xenopus_tropicalis Locus rps12
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis rps12
Xenopus_tropicalis
rps12
scaffold_172
SNORD100, SNORD100
3742..3824, 5432..5516
6689
tatcgtattggcaatctgaaagtcatagaattttcgtaccgaaccattgcaaacagcgg
cagagtctttccgaatttttcacacgggcacgcggaaaaaattgcagagaatacacccgg
agcgttcgcatgaacgctccgagcgttcaggtctttgtaaatctccccctaaagctggcc
atacacgtggtgatctgacgatgttttgtgcgaccatcggtcgcacgaaacatcgtcaga
tccgccacacaccattcagggctgaatcggcaggtaagaaggtagaaacaataggatttc
tacctccttctgccgattcagcactgaagggagattttggtcaggcgccttctatggcgc
ccgatcaaaattttcaaactggtccgatatcagcagcttcctgcgatatcggtcgactca
ccgacataccatacacgcaccgaatatcgtacgaaacgaggtttcgtacgatattatcgg
tgcgtgtatggccaccttaaggctaaggtcattgtcatgaaattgtcacagtgattaaca
cgaacacattaacaaaacaaatacatactttgtttacatttaatcgatattgcagttaaa
ttatagtactacagttaaaaatgataaaaaatgaatgagctgctagaccacggtgcataa
ctaccatcagctaaaacaactgcgcttttgaatcattctcaataaagttgttacaaaagt
tgtgccaaggctgtatcctagcaacaaggagtatcgatcccttttcgttagccctatcat
cctttactcaaaacactttagcaactttctacatctcagactcagtatacacacccgctt
tgtctggaaaataaagttgcaaagcggaaaacgaacctatagtaatctttaagccatgac
agaacgtgtccaaagcttccgcatttgcgtgcatagggtagaacgtaagaagggggcgtg
ttttaaaatgcgtagtataaatatgtgacgtcagcgccgttCGTTCTCTTTCCACAGTTG
TTCTGGATGTGGCAGGgtgagtgaatgagtgggaaggttggggatggcatgcaatccgcc
ttatatctttggcatcgctctgtcccgagccctgtcataaggctgcacagaagggcctaa
gtaacgatttcccttttatgtcttcatttcagCGATTTGACGCCTTACTCCCACTCCTGA
TCCAACGATGGCCGAGGAAGGgtgagtgccgaggcccgctgtggcctgctgtgtgaaaga
gtaatggcaacacgttacatttctgtacgtaccggtgtaaagagcgaatgcatctgccct
gtgtcttttctttacttgcttgtatgtgtggctcatgtgtttggggtatgagtgaggcat
tctgggaaggacgctgttgaatttgttcttatacagctagttccttttatgtgcacgttt
aaatgtccagtctcctagttataggaaaagtggaattacacgtagtgatatattcagtgt
gaacatccttttgaatcttgcgcctatattttccttctattatagtgttccttttattgg
gtcattgtaaataaaactgggattttttgtttgacaggaaatgcggttgttataatgcta
taagtggaataacaaatctgagtaaaagcataatgtcttcagttattgctgcagtgtttg
tgtgatgattttactgtaaagtcggataccccttcactctttctgagtgataacttctat
ctgacaaacctgcagcagcctcagatgtatttgtgttgggtgcaactgcagaagatattt
gaccagcatttgttttttagCATTTCTGCTGGAGGTGTAATGGATGTTAACACCGCACTG
CAAGAGGTGCTTAAGACTGCTCTCATCCATGATGGTCTAGCACGAGGAATTCGTGAAGCT
GCCAAAGCTCTTGACAAgtaagccttccaaagttttgaaatccctactgctgtgctgtct
aatacatggccttttctcgatgggtttccaaatgtgaaaatattaaatgaagatactcaa
attgatatttaaacttttgctaattttgacacatcaaaaaactttctgcatctttagctt
tcatgtagaatgaaacttgagcatcttgatgctgttaatttcttgtagcgcatgaaaagt
tctgcaagtgccaaagataatgtaaacttaatttaacacaaggcttcatttgtctctgct
cccacatatccagcccacctttacctatgatgagaatttggctccctcnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaacttcccattgcagatgactg
acacataaattcatatatgttttgttccttacatcagcaatgtccataagcaacatatgg
aatgccctaagcattagggtgggggaagtgtatcccattgacggggtatatattcaacaa
caaaggagaggcaggaacacaaacacagcattcagacactcgcacaaacacagctaagac
acacacacacattcatccactttttagacattagattcatacattcatatattatatttt
atggttttggtaggctgtcgatgatatctccaattggctaaatattttatgatttgtatg
tatttttctgtaacatttccacacattaaagatacttaaaatatcaccatggtgagtggt
gttgattatagaacttacacaaatttgataaatgtacagcaattattatacatttgagca
tatttgttagatatggttctgaaccctaattaaggaaatactttgaagggggtttttcct
ttcctttaaagcactgtgcagaattaaaagggcagttagagcagtgctgtccaatttttg
tggcaccaagggctggaattgttgataacgagggccaataatagaagccagttttgacca
cccctctttttaaatcacacccatgttatcacaagagcttttaagaccatacccacatta
atggtagcagctcagcaaaaacccaaatggttgctgctcactgtagggatatcatccttc
attcatatgtggtattaagacatacccttaaagaagacatatcaaaattaagaatgtacc
agtgaattatactctaaatatattgtgcttaaaaaaaaaaaaagtgtgtttccaactgat
aaagtgaaaccagcaccatatattattcataattacctacaaaataaggggttccccccc
attaaaacaaatatgtctcctttaaatccatatgccaccgccacctcctcccccctgggg
acagcacagcaatgtccagcacaaaaaacaccttagtgaccatttaaccgtttccaaagg
taacaaattcccagtacaaactcctggcagtttcatggcccacaggcagcatagggtagg
cagagtaatgcctgcatgtgccacactctgcctgccctacactgcacacagtatattcaa
taacacaatgctggcaccgctactacagtctgaggggtgaacaggtgaacgatggtgatt
acagcctgaggtgtgaacagtgcagagaattacagccttaaactgatatgttaaccatgc
aggggggggcagttaatctaagtactcatgccatttaaatcttacagaaannnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntctagaggatccccgtctct
gctcccacatatccagcccacctttacctatgatgagaatttggctccctcttctgaaac
tagtgaggaaattgccaattgttacccaataatctctgaggtgcatggggggaatatagc
aaacgttcttagctgaaccaaatatgtgtataggtaactcttagatcttgtcacctatct
gacagataatgtaacttaactatacatcagttctaaaaaaacggtaaactacctttaaag
aataagtaaaccttattttaaaaaactcagaataaccgctaagagctgtggttgagctgc
ttgtgataaaaaaaataaaatggagctgaatgtagggagaaaggtatgttctggggcttt
ttgggctcaaaagacatgctaaaaactactttaaattttttaacatgtatagtcaaagtg
aaaaaacaaatgtgttgcctgagctgttggaacttttttgaagtcactttaattttttgg
ttctcatgaaaccttttttttttttttaagGCGCCAAGCTCACCTGTGTGTGTTGGCTTC
CAACTGTGATGAGCCAATGTATGTTAAATTAGTGGAAGCCCTTTGTGCTGAGCACCAGAT
CAATCTTATAAAGgtaagtaaaaaaaaaaacttaaatgtaaatgatgtgaggaaaaataa
tgctttattacccgaaacggtattttaccatgtgattgcagttaaaatgtgtttcagggg
agtggatatgataaagaaacctgcccaacggactagcaatactatacttgaagattgtaa
gctcttttgggcagggctctccacctcttgtaccggttattgattgctttatatgttact
ctgtatgtccaatgtatgaaacacacttattgtacagcgctgtgaaatatgttggcactt
tataaataaatgttaatactatagatttacagaaacaaggacagtgcaataactagggtt
gtgacattcacacctgagtttgtgttaaagcacaaaggttgatcaaagaagctttggata
ttttgagaggaaaaaactaacccccccccccgatttgaatggggcaattttcctgagtag
attagggcatgcatatatgtaaggtccttccatgtagctagctgagtttaaatagatact
gaactgtgttaaagtagcccttccttgaattttgtctatttgggattatagagaatcttc
tctctaaggattatagcacgcaggcactttgttccatgtgagaaacttagctacctgcag
gtgctgatagtgacagaccttgaatgggaatctttcacctgcggggagtgagatttccta
cagactagtgtgctataagtcatcacccttatgcatctctgcactggtaaactcgctact
tttgaaaacatggagaagccagtaggcaaagtgttctgtactcatggtgagcagtgctca
aacactgctaattgaattgtgttgaaaatagtctttcagtaaagggtaacattgcaacct
tattcagtgctaacttttgtagttggctaatactggcatgcttgatcctatctatgcact
atacagggtgctattttttgctatggaatgtgagatttgggtgtttttacagacttatta
atggtgactataacagttgttggccttttaaatcatgggatcagtcttattctctttatt
ctaaataacttgtggaagttaccttttcagttgtatgctatgatgataacttggctccct
ctactgaatgctatgaggagaaaagcctaaatgttacccaatacttcctgagtttacagc
tagtgctgtctttttttgcttcctctgcatcattgtgactggttaataaaaatatattgt
ctttaagGTTGATGACAACAAGAAACTTGGTGAATGGGTTGGTCTCTGCAAGATTGATAG
AGAAGGAAAACCCCGCAAAGTGGTTGGTTGCAGTTGTGTAGTTGTCAAGGtaagcgctat
tttaacttgctaatgccattgtgagcagctgttggcttaaatgctcttcagacctggctc
aaatcctatggcaataataaagccatcgtacgagccttgaggcctccctatggcattcaa
ggtccctgaaaatggcaacatgtactgctaatacagcaaagttgtatgggatggctggcc
atctatgtttagtgttaaaattactttcatatagtatatcgtgttatagacacagagaca
aaactggcacacctgttgtggttaaaatataacttttacttcaaagtatttaaaaacgct
taaaatagatagaaaataaaagagaggaaatttgtttaaaatgtacacaatcacaccttg
agcctgttacaattctagctcttttactcctgaagattgttacttaataaagtatcttta
gtgtcgtaatttgtttggttacatttgtaacgattctatcatttggtctgcacataatat
cctgtgtggtttatagaggaaagtcgtggttctatcacctaggtaagtgagctgctctat
acagcatatcttttatgatttgtgatcggagtcataatcctgttacccaggtaagtaatt
agtctgcataaagcactttgtaaggtttgtagagagtcgtaattatataacttcggtaag
tcttggtaggggaaagttctcacagagagttggaaataatctcaccatccgtgtaataaa
ctttattccacagtcatgtgttgtgtctttatttgatccacgtttactttatggtgggga
tcagtcaaggtattcactgtgtaaaccggtaagtgtctttataatgctcgttgcatgagg
agtgataaatcacctggctattgcccaatacttcacccaatggtgcgatgtttctagata
gtactcgtatatatcagatttatcaagcgccctgagatagggaattctctgataaatctg
atatatgagtactatctagaaacatcgcac
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1035, 1172..1220, 1820..1936, 4230..4332, 5587..5689
1207..1220, 1820..1936, 4230..4332, 5587..5689
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved