Xenopus_tropicalis Locus C12orf41
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis C12orf41
Xenopus_tropicalis
C12orf41
scaffold_130
SNORA2
9541..9673
13439
GTGGGGTGGGAAGGTACCATTATACGCCTCTGGTAGTGGGGTGGGAAGGTACCATTATA
CGCCTCTGGTAGTGGGGTGGGAAGGCACCATTATACATCTGTGCTCACTAAAACTCACCC
ATTTATTGCATTGTGTTTCTGTGACGCACACATTTGTGCAGTTGGACACAGGGCTGATGC
AATGGATTGGTGACCTTAGGTGCCCACTGACTCCATGTGTTACCAGCTGGGATGAAGAAC
TTTGAATGATCTGTTTACTTGCTAATGAACTTGCAATGGCTGTGCTTTCTGTAAATACAC
AGGTACTTTTTAATGCCTGCCTGTCGAGGATGATCCAACCTACAGCCATGTAGTCCACTA
GTACAATTACTATGGTTTCATGTTTATTGCTTGCATTTATTCTTTTTTTTTTTTTTTTTT
GGCTACAAAAACACTCAAGAAAATAGTTTTTTTGGTTCCAGTAGGCTTCAGTTAGAATCA
TTTACTTGAGGAAGTCCACCATATTATGTAGCATTTGTGTCATTGGGAACTGTGCTTCCT
TTTCACTTGCTCAGCTACCAATGCACAATGTATCTTTTTTACTGTATTATTAGCAAATGT
GAGGCCAGATTCAACTATCTGCATCTGACATTGAACCCTGCTGGGCTTCCTGTCACCTGA
CACAGAGCCTCATGTATGGGGCCCACAAATGCGATGCTCTAAGGCTAATTTCACACACTT
CGTATTTTCATCAAGCCTAGTGCAGGCACCAGTAGGAGAATTTTACAGTACGCAACAGGT
GGCATTAGTCTTAGTACCTTTTGCAGCAAGACCAATAATTACTAATATGAACATGCCTTA
TGCATCCCTTACTGCAGTCCAGCTGTTTTTTATGATAGAGTATATGTTTAAAACTCCAGA
TGTTAATATTTATATTTTTGTTTTACGTAAAGGCATACATGCTAATGTGTATGTATCCCC
AACAACTGTTAAGATCTTTTCTCTTACTGTTTCTTTTAGAAATGAACAGGATTAGAATAC
ATGTTTTGCCCACAAGTAGGGGACGATTGACTCCAGTCCCCAAAGCCAATGAAACACTAT
CCTGCTCTTTTACACACCGACCGTGCTCCCAGCCTCGCATAGAGGGTCATGACTTCTGCA
TCAAACATATCCTGGAAGATAGAAATGCTCCTTACAAGCAGTGCAGCTATATATCTACAA
AGAATGGCCGTCGATGTTCCAATGCAGCTCCTAAACCTGATAAAAAGGATGGGTAAGGGA
CAACAGATGGCCAAATCAAACAAGTGTAATTGTATTACTCTGTCTGCAACAGTTAAGTTA
CTTATTATAATTGTAAAATTGTGTGACTATCCCCTGTTACCTGTGGCTCAAGTTAGGCAG
GCCTATCATACACACATTACTAGTTGCCCTTTCCTATACAGCAACTTGTATTTTGATAAT
AATTTAAAAGAGAACTATACCTGTTAAATGAAAATAATAAAAAAAAAATTATACATATCT
GAAAATATCGCCCCTTTTTTTTTACATCTTTTACCTTAAAGGAGAAGGAAAGGCTAAGTC
ACTTGGGGTGCCAAAATGTTACTTTAATTGCTTACCTTGTACCCTGGGCTGGTGCTCCTG
TTCGGACAGAACCGCACCAGCCCGGGGTACCTGTAGCAAGCGCTTCCTCTTCCTTGTTCG
CGCTTGCGCATGCGCAGCAGAGTGAAAAATTTTAACAAAAAAGTCGGCTTTTCACTCTAA
TGCGCATGCGCCGGCCCAGGGATTTTGCCGGCAGAGCAAACAGAAGAAGGAAGCGCTCGC
TGCGGGTACCCCAGGCTGGTGTGTTTTTTTTTTTTTTCTAACAGGGGCACCAGCCCGGGG
TACAAGGTAACTGATTAAAGTCACTTGGGGGCGCTTAACATTTTGGCACCCCCAAATGAC
TTAGCCTTTCCTTCTCCTTTAAACCACGATTTTGTGATGTTATGTGAGACACATCTCTCT
CCATTTATTTGCTGATGTATCCTAGTACAGGTATGGGATCCCTTATCCGGAAACCCGTTA
TCCATAAAACTCCAAATTACGGAAAGTCTGTCTCCCATAGACTCCATTATAATCAAATAA
TTGAGAATTTTAAAACTGATTTCCTTTTTCTCTGTAATAATAAAACTGTATCTTGTAATC
AATCCCAACTAAGATATAAATAATCCTCATGCAAAATAATTCTATTGGGTTTAAATAATG
TTTCATTGATTTTTATTTTTTTAGACTTAAGGTATGTAGATCCAAATTACGGAAAGGCCC
CTTATCCGGAATACCCTTGGTCCTGAGCATTTTGGATAACTGGTCCTATACCTGTGTACA
TGCTTGCCCATGGCTTGTGTGTGAGCACAGTGCTTTATGACCCAAAAAGATGGACTTTAG
TACTTAAATAGCAGTGTTTCAATATTCACTGGAAAATACTTGTTGTTAATGATATATACC
CTTTGAGAGGGTCAGGCTTGTGCCACATGGGGCTGATTCTTGGCCTGTGGAAAAACACAT
GCTGAGTATCAGCCCCTACACAGGCACCAGCTTTCTACCTTGCTGATGCACTGGATATTG
GCTGGAAATGCGAAAAACATTTTTTGGCTGATATCCGCCACATCTGCCTGAGGTGCAGGC
AAGGTAGCAGGCTGGTACCAGAGTAGGGGCTGATTCTCCGGGCTACTGGCCCAGAACCTT
TATTGCTGTGAATGGATTGAAATATGCTACAGCCTAAATGCAAGGTGATACTCTCTCCAA
TCAGGCAAAGCAACTCCACTCTAATAAAGAAACTGTATTAGGTCAGGAAAAAGGTCCCTG
GCGAAGCATTTTTTTTAGTATTGGAGTCTGGTCAATAGAACGCCTAGCAGCAGTTGCCAT
ATATTATATTTTTAGTTGAGGCATTCTCTAGAAACCAAATGAGCAGCACCGCCTACTGGA
AATTTTTTTTTAAAGTTATAGAGAAATAGTCCTGAAAGCTAATGGGATTGATCTGTATAT
TTGCCTTCTAAATGTTTATTATATAGTGGTGGCCTTTAGATCCAGATGACATGCGCATGT
TACTACATTCCCTTTTACACAGATTACCTAGAGCAGTGCTGTCCAACTTCTACGGTGCCG
AGGGCCGGAATTTCTCTAGCATACATGGTGGAGGGCCGCTAATGGAAGCCAGTTTTGACC
ACTCCCCTTTTTGAAACCACACCCACTTCAAACCACACCAAAATCCCAAATGCTTGGTCC
TTACTGTGGGGATATCAACCATCATTCATATGTGAAAGAATTATGTCATATTAAGATATA
CCCTTAAAGTCCATATGCCTCCTCCTCCCCTGTGGATAGCAGAGCAACCCCAGTACATAA
TTACACACCTTTGGGACCATTTAATAGCTATTTCCAACTGCTAACAAACTCCCACAACAA
ACCCCTGCCAGGTTCACCTCCCACAAGAAGCATAGGGCAAGCAGAGTATGGCACACACAG
GCAGCACTCTGCCTGTCCTATGCTGTCTGTGTGTGCCATACTCTGCCTGTCCTACCCTGC
CTGTGTGTGCCATACTCTGCCTTCCCTATGCTATCTGTGTCTGAGGTGTGAAGAAGTGAA
CAATGGGGGTGATTACAGCCTGAGCCTGAGGTGTGAACACTGCAGGGGGTGAACAATGCA
GAGATTAAAAGGTGTGAAAAACACAGGGGATTACATATTTAAACAATACAGAGGGATTAC
AGCCTGAATCTGAGGTGAGAACCATGCAGGGGGCCAGTTAATCTCAGTACTGATACCATT
TAATGCTTACTCAAAGGTAAGCCATCAAAGCAGCCAGACAGGTGGGGGGCCACACAGAGG
GGGGTCGAGGGCCGCATGCGGCCCGCGGGCCGCCAGTTGGACAGCACTGACCTAGAGATT
TAAGGCTAATGCCCCACAGAGAGATTAACTGCCATGCCATTGCAATGAATTTCTGCTACA
GCAGATAACTTATCTCCGAAATGCCTTTCGAGCGGCAACATTTGAATTGCCTGTGGGAAG
GTATAAGCAGTGCTTTGTTTTTCAAAGTTGCCTGCAGGAGGAAATTTTTGTGCAACTTTC
TTAAAACAAAGTGACGCGTATGCCTTTATACCAGTGGTTCACTTTGGAAGGGTATTTTGG
GGTAAATAGTCGCCTGTGGCAGCAAAGATTTGTTGCGGTGACTAATCTCTCCGTGGGGCA
TTAGCCTAAAGGTGGCCATACATGGGCCGATTGTAGCTGCCGATATCGGTCCCTTAGACC
CGTGTAGGGGCACAAACGAGGGGCCTGCCCGACCGACATCTAGCCTGAAATCATTCAGAT
ATCAATCAGGCAGGTTAAAAAATGTAGTCAGATCGGGGACCGCATCGATTTGACTTCGCC
TATACCTGTTATTCTAATTTGTAAGTTTGGCCCCACGACCGAATTAGCCTGGATTCGCCT
GATATCGCCCACCCGTAGGTGGGGGATATCGGTAGAAGATCCGCTCGCTTGGCTTGGCGA
AAGTGAGCGGATCTGAAGGTATATGGCCACCTTAAGACTGTCTATATTGTCTCTTGTCCA
CTTGACTTCCTTGATTTCTAGCTTCTTGAACCCTTAACTTACAGTACTATGTTGGAGCTT
AAAGGAAAAGTAACACTAACATTTTTTTTAAGTAAAAAAATCTGTTCTACCTGCTCCAAT
AATTGCCCTATCCTGCAAACCACTTAGTATTTTGAATGCTTTGTTAGAAAATACCTGCTA
AAACTTGGCTTTCGGTCATTTGAAATAAGGTGATATGGCGAAGGAAGGAGCAGCATCCAC
TATGCGACGATCGATTGAGCAAGCCTAGTACAGAAGAAAGGCTAGGCTAGATCAATTGAT
CATTGCATAGTGGATGCTGCTCCTTCCTTCGCCGTATTGCCTTATTTCAAATGACCGGAA
GTTTTAGCAGGTATTTTCTAATAAAGCATTCAAAATACTAAGTGGTTTGCAGGATAGGGC
AATTATTGGGGCAGGGTAGAATACATTTTTTTTACTTAAATTTTAGTGTTATTTTTCTTT
TAAGAGGTCAAACAGGGAAAACTGAAGACACTGTGTGTTTGGTTTTTTAAAGGTGGATAA
TTATATTACCAGTGCACAGATAACATGCTGAGTGGGTGTCTGGGCACTGGGAATCTAATC
TGCTTTGCAAAGCTCAATCATGAGTAGCTTTTGTTTCCCTGTTTTTCCTGTTTAGCTCAG
GAAATAAAACAAAACATTGATTGCTCATGATTAAATCAAGAGACAAAGTATGATCAGCAC
AAACAATATTTATTGCATTCACATTAAACAAGGGGGTATACTGCTTTTTATCAAAATAAA
TGCTTCAAAAATGAATATTTTATGTTTTGTTAGTTTTTGTGTTATGATATGTAATATGTA
CTTTTATAATTAGTAATTTCTTGTTCTACAATATTGGCAGGGTTTCATTCTGTGCAGAGC
ATGCGCGTCGGAATGCATTAGCACTCCAAGCTCAAATAAAGAAATCAAACCCAGGACCGA
CTAGTGAGTCTCTGTTGTATCAGCTGAATACATATGCCCGGAGTGAGCTGGGCTCTCAGA
TACAGGAAAGCAGCAGAAGTGAAGCCTGCAGGATTCTTGGTGTGTTCACATTTGTGTGTT
ATTTTTTTTTTGCTTTGTTTTTTCTTCTATACTCATCACTGCTGTTTTTTTTAATAACAT
AGTGAAGTTAATATGAATAAGAAAGCTGAGTTACCAAAATGTTTTGTAACTGATTTAAAG
GATGTCTTATTTCTACTATTATTTAATGAAAATGTAGACTGTGGGCAGCCCATGTGCATA
GGCAACCACTGCCCTGTAGGCTAGTGCCACACGGGGCGGATTCTCTTGGAGTGATATCTT
CCTCCTCCCAGCAGCCAATCAGCAGAACAATGGGAAGGGAGCAAGATAGCAGCTCCCAGT
AGAAATCAGAATAGCACTCAATAGCTAGAAATCCAAGTCCGTCTTGGGACTCCTCCAGTT
CCATGGGAGTTGGAGAGACAATAGGTTACTTGAAAGCAGTTCTGATGTATAGCACTGGCT
CCTTCTAAAAGCACAGACTCGGACACAATGCACTGAGATGGCACCTACACACTAATATTA
CGACTAAACAAAATTACATTTGTTGGTTCAAGAATAAAATTTTAAATGGTAGTGAATTAT
TTTCAATATAAACAGAGTAATTTAGAAAAAAAAAAAAAAAGTATACCATCAAAATCATGA
CACTATCCCTTTAAATAAACCAAAGCACCTTAAACGCTGCAGTATAAGACTACATGCATG
TATAAAGTTGTGTATTGATTTTAGGCAAATATGATGCGGTAGAGGAGATTTATTGTGGAC
GACTAATCTTTGTATCTCATTTCCCCTATGGTTCCCTAAATAGCTGTAATCAGTGTCTAA
CTTTGTCCCCTTACCACTGTCACTTCATCTCCACGGCTAATAACCCAAACATATACTGGT
CAAAAACACACATGTAATAGTCTTATTTTTTCTGACCAGATGAAGACAGCTTGAGTGAAA
GTGACCAAGACACTGTAACAGTTGATCAAACATGGAGGGGAGATCTCGACAGCGAGGCAG
ACAGCCTGGACAGTGACCAGGAGGACCCATTAAAGTAAGCAAGAACATGTTCTCTGTCAA
GGCTATTAACTTGGTAAGACTGGAATAAAATGTGTTTTCCCACACAGTGTTCTCCCACAT
CAAAGAAAATGCCACCTGTGAAATTACCCACAGTGGAACATCTATGTTTGATTTAATTTC
CCCTTGGATTTGTCTAATGGAAATATTAGAAGTTATTACTGGTTTATCCTTTAGTTATGT
GCAGTAGCTACTCTTCACTTCCTGCTTTTACTCCAAATGAGTGTAATAATAGTAAGTAGG
CTAAACATTTCTGCAAGGATATGGTGATTCCATTAATCTTTAATGCTAAGGTGCGGTACA
TCCAAATACTTCCCAAATCCTGTTGCTTTCATCTGCGCAAATTTGCCCAAATGCAACCTT
ACCCTCTGCTTAGATACAACTAAAACACAGTCTCTTATTTCCCGCTTTTACTGCTCCCCA
TCAGCGTTCCCATATGCATATTGCTTCACTGTCTCCCAGTCTTCTCTCAAATCTAATTCA
CATTACTAAAACTTATATTCAAGGTCCTTAACTGTGAAGCACCTCCCAATATTTCATCTG
ATCTCAAAATATACCCCGTCTTCACCCCATTCCTACCTCTCTACCTCTCCTACCTAACTT
TCTTTTAAACCTTCTTTTTCCTGTAGTGTTGAGAGCAAAAATGTGTACTTTAGCAGCATT
GCCTGTGTGAATAGTCTTAGTCAAATATACTGAAAGAGCCAGAGCAATATGTTTTTACTA
TTGTTGCTACATCAGTGTCATATAGTTTGTAGTTGCAAGGTGTAGGCTTGTGTTTCAGTA
GGATTTGGGCATTATAACCCTTTAAGGAAACAAAAACTGGATGACTCTTCGATGGAATTA
CATAGAACAGCATTTGTTACTGCAAAGACATATGGAATGTGGTTTAATACTGCATCTTCA
TGCAGCCAACACAGTCCCCGTCATCTTGTAGCAAATTATCCATCTAGTCAAACCAAGAAA
TAAGACAAGACCTTACTCACATCAGTTTCTGATGATGCTTGCGTTAATTTCAGACATGCT
GGAGTATACACAGCTGAAGAGGTAACTTTGATCATGCGAGAAAAGCTAATTCGCCTGCAG
TCCCTGTATATTGATCAGTTCAAGAGATTGCAGCACTTGCTGAAAGAGAAGAAAAGGAAC
TACTTGCACACTCTGAAAACAGAACATGAAACTGTTGGTATGTTAATTGAAAAATAATAT
AAATAAATATGAAAAATTAATTTAAAAGTTAGGTGTGGTGTGTCACTGCTAGCATTACAA
GAGTGGGATTGTAAGAAGCATCCTACTAAGTGTAGCTGCATTATACGCAACATTGTCTGA
CAAGGCACAGTAAGGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCCTCTCTTTATAAGCATTATGTTTAAGTGTTAATACACTTTCTGTTTTTACT
TCAACAGTTTTGAGCTACTATAAACATCTTTTTTGAGTTCCGGAGTGCCTGCCTTTCATT
TGTTTTGATTTCCTAGATTGGCTCCCTTAAGCTGAAGGTCTGGGGCATGAGCACCCAAAC
CTTTATTTGATACAGGTAGGATTTCTACCTCAGCTACTTAGTTTATGTGACTTTATTGAT
TCCACACATTTTATATGTATAATTAATTTTGGCAAATTTCTAGCCTAGCATAAATTCTGG
TGCAAACATAATTGTTAGCATTCATGTAACTTTGTTTAATAGCATTTATACAGCTCTTCA
CTGCTTCTTCCCACTGACTTTGACTGGCATTAAAAAAAAAAAAAAAAAGAAAGAAAATGC
ACACTTATAACTACAGGTATGGGACCCTTTATCCAGAATGCTTGGGACCTGGGGTTTTCC
GGATAAGGGATCTTTTCGTAAATTTGGATCTCCATAACTTAAGTCTGCTAAAAATCGTTT
CGATATTAATTACACCCAATAGGCTTGTTTTGCCTTTAATAAGGATTAATTATACCTTAG
TTGGGATCAAGTACAAGGTACTGTTATATTATTACAGAGAAAAAGCAAATCATTTTTAAA
AATTAGAATTATTTGCTTATAATGGAGTCTATGGGAGATGGCCTTTCCGTAATTCAGAGC
TTTCTGGATAACAGGTTTCCGGATAAGTGATCATATACCCTGTACTATAATTTGCTGCTT
ATTTCTCTTGCCTCTCTTTGACTGATTCAAGGACTAAAGGGGGTGGAACAATTCTTTTAG
ATAGTGACCACTTTCGTGTAGCTTTAGCACTATAAACAAACGCATTTATACAGTATTTCT
GACACTTGCACTTTAATTGGTAACCTAATGGTAGTGGTAATCCTATTGCATTTGTTTCAC
CAGTTGTTATACTAAATTCAAATGTTGCAAGCATTATTTTATTTTAATTTTTTTTACATG
CCACATTTTCCCTTTATAATACAGTTTCTCTTTTGGACCCCATTTTAAGTCAGAAAATTT
TGAGTCAGGTTTGATGTTAAAAAAAAAAAAAAAAAAAAAAAATCTTAAAAATTTGTTGAA
TTCACAAAAAATAAGTCAAAACCTAGGAGAAACAAATTTTAGAAATGTTATGTAGTCCCC
AAAGTAGCATTGGTATACTTGTCAACAAATGAACTTGTTTTGAAACATATTTTTGAAGAT
AAAACAAGGCTTAGTCCGTGTTCTTTACTGTAGAAATAATCTCTGCTTCTTACATGCAGG
CTCACACAACCCGCTCCAGTCAGAGGTGCATGGCATTCATTGATGATGTGCGCTGTTCTA
ACTCTTGTCTCCCCATGACAAGACACTGCGTTTCTCGTATCCTTTGGGGGAAATGTAATT
TAAACGGGACTTTTTCTTAATTGTATATCCACTTGATATCAGATTGTATTCATTGTTACC
AATGGCCCTGAATCAAGGCTGGCTGCTTGTTGTAGCTGTGAGTTTCAAACAGGAGCCTAA
ATCAAATTCTTCTTGTGGTCTGTTGGCTGTGCCATTGCAATAGGGCCCATCCTATTCAGT
TGGAAGAAACAAGCTATGATAAAGAAAGGGCTTATTATATTCAGTTGTTCCCAAGTTTTT
TTCTTTTTCTTACTATATATGCACAAACTAAAGTTACTCCTACTAGTCATATGTGCTAAA
ACAATGAACAAGCTATTGTAATGTGAAGTAAAGGTATAGTATAAAGAGGAGATATTGGTG
CAAATAGGTTTTAATTTCCTCTCAAAGACATGACATAAACAAAATATAAACACACCATCC
ATATGATGATACAAATAAGAGGTGTAATGTTTAGCAAAATATAGACGCTCATCAATTGTA
AGCACCAGTCAGTGGGTATGATTAACTAAGCAACATTAGGCAGTCATTTTGTGTCTAATG
GGACGCCTTTCTCCTATAAATATGCAGACTTTTATGTAGTTTAGTCCCTTCCTTCTAACT
TGTGAGGTTTGTGCCAATGAAATGCCTCTTGCAGTGTTTAACAGCCTATTGTGCATATGT
TTGGAAATGTATTATTCATACTTATTGCTTTGCAGCACTTCTGACACTAGAGGGCAACAT
TTAAAACCTTTCTGTGTATGCTTGGGACAAGGGTAGTAAAATCAAGTATTAGCAAATCCT
GCCCTTGGTTTTCAGCAGTGTCTGCAAATAGCACAACTGCTATTTATTCTTTAGAAGTAG
GGTGGAGGGAGTGCCAGATACAGGGTGCTGTGTGCACCAGGGCCCTCCGAATATTTTTTG
CCGGGAAGGGGGGTGGTCGGGGGTCAGGCACTCTATTGTTATCCACTGCTTTTGAGGTCC
ATGTTCCAATTTTTTTTTTTAGTTTTCTTTATCTTCCATATAATCAGATATATGTCAGGA
CAGCAGTCAAGTTCTATTCAAGCTGTGCTCAGGCTCAGAAGATGTAGCCTGTAATAAGCC
GGTTCCTTTAAGCCTTTCTGAAGAACCCTGCTGTCTGTTACATTACCGCTTACCATCCCC
AATGTACAAGGCAGAACCAGTGCTGCCCGTGCCAGAGCCCATGGATGTGACTCCTGTAGA
ACTTTACCTTAGCACTGCGGAGCTGCAGCCCACGGAAAATTTACCCTTAGAATTCAGTGA
TGTAAGTATCTGTGCATTATTTTTGCTGTCCTGTCATTAACAAAGTTTTCTTAATTTCAG
GCTCTGATCTGATATTTTCCCTGTTTTCCACAGGACCTTGATGTTGTAGGGGATGGAATG
CAGTTCCCACCATCTCCTCTTCTATTTGACCCTTCTGCTGACATTTCAAGGCCACTAGAC
TCACAGGAGTATGAAAAGCACAGGACCATGGCAAGCCACTTGCTTCTGACAGCAGATTCA
TTAGTAGGGTCTGCAGGACAGGTAAGCATCTCATGTATATATACTCTTTTAACAATATCT
GCATTAACTCTATAAATCTGTGTTGTGTTTTTAGGGGGGATTTTATTGCTTAGATGAAGT
ACAAAAACTACACTAAAAAAAAAAGTTACACAACTGTTTTTTGTTTTTTTAATTTCTTTA
GATAATCTCAAGTGCTGTTTTGCCAAAGTAAATGGGTGTTGGTCTCATTAATTTATATCA
GAACATTACAAAAGATAATCATTTGCAAGTACTGAAAGTGGCATCCATAGAGTGCCCGTT
GAAAGAACTGGGCAGTGAATCTTAAAATCTGTAAACTGCATGGTCATATCATTTAAGTGT
TGTGCCATCCAGCTGATATGCACATTTGGTGGCCGCATAGTCTGTTATAAGGCAGCGGTT
ATGCACCCTAGCTTGGGTCAGTTCTCCAGTTTGAGTGCCTATGGCCAGTAAAATTTACCA
AGCACAAATCATAGTTAAATGTAAAACACAGAAGTACTCCACACACTGTTCTATGATTAT
TTTAAACTTGCCCTGTCCAGGGGGGAAAAAGTATTGATGTGTGGCCATCTTACTTACCTT
TCCTAGTCGTGCTTTTTGAAAGGTGTATTTTATTAAGTTTTCATACAAACAAAACACAAA
ATAACACATTTAACAGTGCAATGAGAAAGATGCATTAGTCCTAGTCGTGCTTAGTGCCAG
GCTTAGATTAAGATCCCAAGCCTGTACTTTTTGTTCTACCTACACTTCTTTCTTTTTAAC
AGGCCGCTATACCCTCTGTCAAGTTAATGACGCACAGGACATTGTCCAGGTGGTTCACAA
ACCCCTTTGCCTAATGTGGTTCCTATTCACCTCAGTGGGAAACTTGTAGTAGTCCACACA
CTTATTTGTATGAATGCCTCTTAGCATTTTCAGGCCAAAAAGCGCTTACATCTGCCCTCC
CTTTTGTTTCCAGTTTAGATAAATAGGAACCGCAGTAGTCCGTTACGGGAGTTATCCATT
CAGTTTAAAGCAATATTGGCCTAAAGGTTACAGAAAGAAATATTTCAGGTAGTCTCTGCT
GAAGAGGGTGCTCTGTTCACAAGTAATACACACGCGCATATTAAACAGTTACTTTTTATC
CCTTGAATAATCTGGCCCTAAATCAAGGCTGGTGGCTTGTTGTGGCAACTGGCTTCAAGC
AGGCGCCTATATAAAGCTCTTCTCGTGGTCTGTTGGCTGCTCATGTTTACACTGTGGCCC
AGCCAATTCAGTTGGAAGAAACACTGGTGTGAGGGGTTAGTGGTGCAAATGGAGTCGGAG
GATATGTTCTAAACTGGGTTTTTCTGTTTCAGGGTCAGGTTCAGACCGCAGCAGCCTCCT
CTTTGCATCTTACAGACAATGCCACAGAAAGCTCTTTGTCTACACCCAATGGAAACGCTG
ATGCCTCATTTGTCAGCTAAATTTTAGGACTGTTTTAATCAAGTTTTATATGCTTAATTT
TCTTACCAGCATTATCAAAGGAAAGACTACCAGGCTGCCTCAATCTACATTGCCTTATTC
CTTATGGAGCTTTCGTTGCTTTAATGTTACTTCAGAAACTTGCATGTATTTAACAAAAAC
ATGGAGAGAACCAAGAACCTGCTCTTTTGTTTTCTATGTAATAATATATATGTGTGTGTG
TGTATTATACACATATTATACATAAATGCAGAAATTGTCTCTGTTAAAAGGAAAAGTTTA
CCTTAATTTGTATTTTTGCACCATCCAGTTTGGCATTTAACCACCTAACTGCAACTGCTT
AGTAAGGCACTGGAGGCTGTGTATCCGCACAGCTTTAAGTACAAATAAAGCTCAATAAAA
TGAGTGTAGATATGATAAACTGTAAAATCTTGTGGGGTTTTTTTTTTTTTTTGCTTCTGT
TTTTGCCTATTTCTCCAAACTAGAGTACAAATACTAGGCGTTTAGCTGGTTCCTGCAGCT
CCCATTTGCCATGGATTGTGCATACTCCTCTCACTCCTCCCTCATTTAGTAACTGCTGTA
GCTGGAAAAATTACCAAGTCCTCCCTCTAAGCCGAACGAAGCCCTGGACATTTGTGCAGT
AGAGCGAGTTTGTTCCTTGTGCATTACTTTCTGTGTGTTTGAGTTGTATAGGCATGTGTC
GGTATTACCAGTGAATATAAACATTTTTCATTTTTGTGCCGTTGTGCTTTTGTCTTCAGT
GTTTTTTGCCTTAGTTTGTCCCTATCATGTAAACTTTGCGAAGTCAAATGCCCCACAGTA
TTCCTAGCTTTTACTTTTTGAAAAGTTCAACTTCACCACTGCCAAAATGAAGGTTATGTG
GTGTTCATTCCTTGTTGTATTATTTAAATGCTCAGACATGCATGCAGACTGCCCCAATAC
CCGTAGTAGATGTGAATGGTGGGTAAAGCCTAGTGAAGCTTAATTGAAGCCTTTCGGTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1251, 5440..5618, 6519..6633, 7673..7840, 7935..7950, 8211..8265, 9128..9193, 9333..9455, 10487..10740, 10833..11000, 12332..12439
1001..1251, 5440..5618, 6519..6633, 7673..7840, 7935..7950, 8211..8265, 9128..9193, 9333..9455, 10487..10740, 10833..11000, 12332..12436
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved