Xenopus_tropicalis Locus ENSXETG00000001209
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis ENSXETG00000001209
Xenopus_tropicalis
ENSXETG00000001209
scaffold_125
SNORA73, SNORA73, SNORA73, SNORA73, SNORA73, SNORA73
1875..2096, 3115..3336, 3708..3929, 5452..5673, 7310..7531, 11325..11546
12781
CCTAAATTGAATTTGCCTCAGGGCCTAGTTTCATTTAGTTATGCCAGTTTGTAGGAGGG
AGTGCCAGTGGCTGTAGGTAGTGTTTGTGGCTCAGTGACTGCTTCTACAGATGTGTAAGT
GGCTGTATGCAGCTGTATGTGGGAAGTGGCTGTATGCAGCTGTATGTGGGAAGTGGCTGT
ATGCAGCTGTATGTGGGAAGTGGCTGTATGCAGCTGTATGTGGGAAGTGGCTGTATGCAG
CTGTATGTGGGAAGTGGCTGTATGCAGCTGTATGTGGGAAGTGGCTGTATGCAGCTGTAT
GTGGGAAGTGGCTGTATGCGCTGTATGTAGCTGTATGTGGGAAGTGGCTGTATGCAGTTG
TATGTGGGAAGTGGCTGTATGCAGCTGTATGTGGGAAGTGGCTGTATGCAGCTGTATGTG
GGAAGTGGCTGTATGCAGCTGTATGTGGGGTAGCATGAGAAAAAACCCAACAAGTCTCCA
TACAGGTCATGATTCCCCAATTGCCGATGAGATAATTGTTCCAGTACTTCAGGCTTCTCA
TATACCTCCCATGTCAGTGCTGGAGCAGCCTAACGCTCTCGCTCCTCCTGATAAATTACC
GTCCGGACAGACATACAGCTTTCTCTCCAACTCTTCTTATTGGCTACGGTCTCCTTGACT
CCCTCCGCATTGGCCGTCATGAAACGTCTACGGAACGTGGCAGGGACAGAATACTTGAAA
TCGCGTTATTAAATGCAAGCCTGTGGAATATTACTAACCACGTTTCACATTGTTATAGCG
TCCATATCAGTTAAGTAACTAGCCTTTAGAGCGTAATTGTCATATGGAAATATAAAACAT
ATTGCTAGTTTATTAAAATCAACTATAAAGTATTTCTCAAGAGGGTAAGGCGAAAGTCTT
ACTTCCGCCCTTAAGCGACTTATGGGGCGGAGCGTCGATCAATATTACCCATCCTCCCTT
GCGCTCAGCCGAGATCTGGGCCGCTCTCGCGGGATTTCGCCCTCTTCCTAGGCCGTCACT
GAGACAGGACGGTGAGTGCGGCAGAGGCTGCGGACTTTCGTGTTTCTTTTAATCTAACTA
CCCTTTCACTTGAGCGATGAAATGGGCGCAAATGATGGCAGCGCAAGGTCTCTCCTCGAG
TGTGGTACGCGCGGCTGGGCGCCACAAGCCGTCAGGGGGAAGGATTGCTCCGGATAGTAG
AACATTGCTGCCGGTGGCCGGGGAATGATGCGGGCTGTGGGGCAGCGAGGGGGCTTCTGG
GAGGCAGAGCACATGATATCGGCGTGTTAGTGTTTGGCAGTATATGCGTATGTTAGCGGG
TATATATACAGAATCATATGGCTGTTGCTGTAAGTGAGTTAAATACAATATATGTACAAG
GTATATGACTTAAATCATGGCTAATGCATAGGGAAGGCTGTAAGTGGCTGCCTAGTTTGT
ATTAATGAAGATGTAAAGTGCCATACTGCTCTCTGCCTTGGTACTCTCCTTAGCCATTAG
CTCTACTCACCAACCCACCCCCTGTGTGTGTGATCCTGAAAGCATGGGGAAATGGGTAGG
TTAGCCATCACCTTAGAGCTGAGATTGGGGCCTGCACCTTATAGTAACGTGCTTGGGGGA
GAGATGGGCAAATTGCATGTTCCATTATAATGGGCAGCATGGCGGCACAGTGGCTAGCAT
TGCTGCCTTATGGCACTGGGGGGTTTAGAGTTTGCAGGATCTCCTAATATCAGGGTGAAA
CCCAGAGACAGTACTGTTCCCTCCTATGCCCCAGCTACATGCACATGGGTTTACTGGCCC
ATTATTGACCCTGGTGTGTGAATGTGATAGGGATCTTAGATTGTAAGCTCTGCTGGGGAA
AGGACTAATGTAAAACCAACGTGGATATCCCATGAGTTTGTTCTTGTGGGCTCTGTCCTG
GTGGCGTATGGGAGCATCGCCCTGTGTGGCGCAGTGATGTATAATCCCCTTCCACAACGT
TGGAGAGCAAGCATGTCCCCGGCCTTTAGGCTGGTGTGGGCAGCATCCTGTATATTCCTA
TAGCTTCCCAGAGCCCTCGGGCAGTGACTGGGGAGACAAACCATACAGGGTACATTATGG
TTAATCTCTGAGCACAGTATAGGCTTTTGTATCTTGAATTCTAATGCCCAAAAGCCTTGT
GCGCTTCTGCCATAAATTCATGCATTTTTCTGTAGAATGCGTGATATAACCAAAGTCGTT
GGATGAGGGTTTAACTATTGTACCCAGAAATCCTCTGTCCTTGGTGGGATTGGCAGCGAT
AGTGTGTGAGATGTTATTAACCTGATGGGAGTTATAACTGTACTGCTGATTACAATGCTG
AAAACTGACAAACTTGTGTTTTGTTTCCAGAAAGGCCATGTTCAGCACAAGCGCTAAGAT
AGTAAAGCCGAATGGCGAAAAGCCAGACGAGTTTGAGTCGGGTATTTCCCAGGTACGTAA
AAAAACCCAATCACGTAGTATTACAGCCGTAATATTAATAATAATGGTCTACAGGCAGAG
AGTTGCACAGACCATAATTCAAATATTGCACATTTCGTCTTTTTTTCTGACGTGGGACAT
AAGTGAACCCACATGTATGTAGTAACCAGCACAAATGGGATCCACCTGTCTGTGCCAAAA
GGAGGTACTTTGGCCAGAAAATACACTTGATATGTTTTGATCGAAAGCCATGCTGTGTGA
CAGGCTGATCCCAGGCGGCATCATTGTTTTTTTTCATTCGCTAAGAGAACGCATTGTGTG
GCCTTGGAGGATGAATCAAAAAAATTCTGCTTATCTCTTTGAAAAGTTTTTTGGCAATAA
TATGCTATATTTAGAGTTTAACCCCAAAAGTAACTTTCCAGATTTTTCATAAAAAATAAT
GAAGACTGACTAAAATTGAAAGCATTTTAGACTGGTAGGGTTGTTAAAATGGTGACCCAT
TTTACAGGCCCTGTAGTCAGTCTTTATATTCAGTAATTGTAATTTGGTTTAGTGATTCAA
TGTGGATATCCTGTGAGGCTGCTCTCACGGGCTCTGTCCAAGTGGCGCATGGGAGCGTAG
TGCTTTCTGGTTCAGTGATGTATAATCCCCTTCCACAACATTGACTGATGTAAAACCAAC
GTGGATAACTCATGAGTTTGTTCTTGTGGGCTCTGTCCAGGTGGCGTATGGGAGCATCGC
CCTGTGAGGCGCAGTGATGTATAATCCCCTTCCACAACGTTGGAGAGCAAGCATGTCCCC
GGCCATTAGGCTGGTGTGGGCAGCATCCTGTATATTCCTATAGCTTCCCAGAGCCCTCGG
GCAGTGACTGGGGAGACAAACCATGCAGGATACATTTGTTTCAGCTTAGTAAGACATCTA
AAGGTCTCTTGTTTGCTGGAAATCTCTGCTGTAGTTGGGTGTAAAACACTATAATAAAGT
TCATGCAGTAGATTCTTAAAAACAGTGTCTTGTCATTAACCAAACTCTGATGGTTTCTCT
TTATTCTATAGGCTCTCTTGGAGCTGGAAATGAACTCTGACCTTAAAGCTCAGTTAAGGG
AACTTAACATCACAGCTGCAAAGGTATTGTTGTACTAAATGCCTGATGTAGCACTTTGCC
TATGGGCACCTCTTAATGTTTAGCTTTAATGATTATGTACAGCTAATTGTACTGGTAGAG
CTAATTATGTATTGTGTTATAAATTGAATAGGTTATTTTTTTTGTTACCCAACGTGGACA
TCCCTCGAGGTTGCTCTCTTGGGCTCTGTCCAGGTGGCGTATGGGAGCATAGCGCCTTAA
GGTGTAATGATGTATAATCCCCTTCCACAACGTTGGAGAGCAAGCATGTCCCCGGCCTTT
AGGCTGGTGTGGGCAGCATCCTGTATATTCCTATAGCTTCCCAGAGCCCTCGGGCAGTGA
TTGGGGAGACAAACCATGCAGGATACATTTGATTCCTTGTGCTCCCGGTGTTGGAATGTC
CCTTTAATAGTACATATAGCACCTGTAAGTTGTTTTGCCATAAAATGCATGTGGTTGCCC
AAATTATTTTAGGATGTAAAAGCAAATAGTTTCCAGTAGATGGTTTGGGTTTTGCTGCAT
GTCTCTCTGTATTTAGCACTAAGGCCATGTTTCGTTTCTTCAGGAAATAGAAGTTGGAGG
TGGTAGAAAAGCAATTATCATCTTTGTTCCAGTTCCTCAGCTGAAATCTTTCCAGAAGAT
CCAAGTAAGGCTAGTGCGCGAGTTGGAGAAGAAATTTAGTGGCAAACATGTTGTCTTCAT
TGCTCAGGTGAGTGGAGTGAAGCTGTGCGGTAAATGCACAGTAACTACATTGTGCTCTCG
GTTTGCTTATATGTATAGATGTACCTTTATGTATCCTGCCAGGGCTATGCTGTGTGATTG
ATCCACTGCAGAAATTCCACCAGCATGTTTAGGTCGCTTACAGGCCACTGATTTTAGGAG
TTACAATCTGAGTTAACATGATGTAGTGTTGGACCGTTTAGGTCTGTAAGTGTTCTTTAT
AGGTATAAGGTTCTTCCTTGAGTCACTAGCTGGAGTGTTATTATTACCAGTATATAAAGC
ACTGTCTTATTTTGCAGCACTGTAAATAATTGACAAACTGATACCTTGGGTAATGAGCCC
CATGCAGCAGGGGAAAATCATTTATACACTGAACTGTGAACCCTTATTTGTTTGGTCACC
CAGAATTATAGAAAATGAGAGCTGGAGAAATGCATTCTTCCTCCTTAGGTTATCTTTTAA
TTAGGGTTATCTAGTCGACTTAAGGGGCTGAACTTGTTGCTTTTTTTTTTTAATCGCAAA
AAAATATATATTTAACAAAATGTAGCAGACGGGGAAATTAAAGATACTCCATGTTTGGCC
CAGTGCATGGATTTTCTCAATGCATAATGGACCCCTGCTTATCTGTGCAGCAGTAGTCTA
ATTACCTCCACATGGACCAAACATAGCTCAGCATCAGTTTTCACAATTAACCCTGTTTCA
CAAGAGAGATCACAAACCGTAGATCTTTCATGTTAAAACAATAGGCAAATGGTACATTCA
TCTCAAGTCCTATTCATTGTACTCATTGAGTAGAGGGTATACTTGCTCCTCTAACTAATA
AAAGAAGAAAGCAGTGTTTCCCTGATCATGATGTTGTCATGGGATCATTGCAGAAGCATT
TTATGTTCTCCAGATGGCTGGACAGACTCATTTTGAAGTATGCCAGGTTACTAGAGCAAT
GGTATAGGCAGCGTGGGCAATGCGTATACCATATATCTTTATTATATACTGCAGCTTATA
CAGACTAAGCCCGCCTGTTCATTTTATATATTGCCATATGCACACAAGTGACCCAGAAAC
ACTGTTCTTGTATATTGTGTCTAGTAAAGGCTTATGAGACCTGTCTAGACAGCTTTCTTT
AGTAATAGTTTACTATCTTACCTCTAAATAACCACCTTAATGTAAATCTGATCCAACGTG
GATATCCCATAAGGTTGCTCTTGTGGGCTCTGTCCTGGTGGCGAATGGGAGCATCGCCCT
GTGAGGCGCAGTGATGTATAATCCCCTTCCACAACGTTGGAGAGCAAGCATGTCCTCGGC
CTTTAGGCTGGTGTGGGCAGCATCCTGTATATTCCTATAGCTTCCCAGAGCCCTCGGGCA
GTGACTGGGGAGACAAACCATGCAGGGTACATTATAGCATTTCCCTAAAACATTTTTATA
AAGAGAATTAGAAGTTAATATGTTAGATTTATGTAAAAACTTCATTTTGGGTAGCTGTGC
TGCAAGCAAAATTACTTAGCCAGTTTTTTGTCTCAGGGTTTTTTTTTTCCTTGCTGGTAA
ACACGTGGCATAGGGTTGGCATTAAGGGGGGACAGTATTTGTGTTTTTTTTTAACCTGTG
TTGTAAGATATTATAAGGTAAAATCACTGGGGGTGTCATAGTTAGGCACCCCCAGTGATT
GTAATCACTTACCTTATACCCTGTTTTGGTGCTCCTGTCATCTTTCTTCCCGATCCTGGG
GCTGATACATGTGCAGTAGAGTGAAAGTCGGGTTCTTGGTTTAAGTTCAGCTTTTTACTC
TACTGCGCAAGCGTAGGGAAGACAGAAGGAAGAGGATTGCTCTCGCAGCTTCCCTGGGCT
GGTGTGGGGCCCTGGGGGTATAAGTGATTATAATCACTGGGGGTTACCTAACATTTGGCA
CACCCCCATTTATTGTACCTTTCCTTCTCCTTTAAACTGTTTGTGTGTAAAGGCTACTTT
GTGCTGTTAACCTCAATCAAACATCTGTTCTTACAGAGAAGGATTCTCCCCAAGCCAACA
AGAAAAAGCCGCACGAAAAACAAGCAGAAGCGTCCCAGAAGGTATGTACCTGCCATAGGA
ACCTGAAAACCCTACTTAAACTTTGTGCTGGCCAAGGGTATTCAGTTGTGGTTGGTCAGA
TTTTGTATTATTTTGCCCAAAGATGTTTGCCATTGACCATAGTACCATGTTATCCAATCA
TTCAGCCCAATTTTTGGAGCTCTTCTGTGTTAAGGGACTGTTTTGGCAGACTTTACAGTC
TTATATGGGCAACTATAACTTCAGGGATATAAAAGTTGTATGTTCATGTGTAGAAGTCCG
TAAGTAGTTACACAGTACAGGTAGGGGGACCTGTTATCCAGAATGTTTGGGACCTGAGTT
CTTCTGGATAAGGGGGCTGTCCATAATTTTGATCTCCATGCCTGAAGTCTAACAAAGAAA
ATAATTAAACATTAAATAAACCCAGTATTGTTTGCCTCAATGAGGATGAATTATCTTAGT
TGAAATTAACTACAATGTCCTGAGAAAAAGGAAATTATTTTTTTAAAACTTAAATTATTT
GATTAAAATTAAGTCTATGGCAGCTGGTTATTTCGTAACTGGAGCTTTCTTGACTAGGGG
TTTCAGAATAACTGATCCCATACCTATTTGTCTCTGGCACTGTAGACCTGTTTCTTGATT
ACCAGGGAGAATATCAGGTTCTTAAATGGGCAGTATGTGAATTCTGAGTGTGATGCCACA
TACTTTTTTACCCGTTTCAATCAAGAAAAATCAATGGTTTATTGAGCTAAATGGGGGAAT
TGGAGCTACTTTGTATGCACTAAGAATATATTTATCTTCCTTGCAAGGGCCAAACGTAGA
ATAGCTTCAGTTTACAAAAACATACTTTTGTTTTAATCATGAAAAATGGTTAAAACAAAT
GCACAAGCCCTATTCACTGAACTCATGTTTGAACAAAGTGTTAAATCAATAGTGCCCAGA
TAGAAGTAGCAGTGTATTTTATTTCTACATGTGTTCTATGAGCTTAGCACCCAACGTGGA
TATCCCATGGGCTTGTTCTTGTGGGCTCTGTCCAGGTGGCGCATGGGAGCATCGCCCTGT
GAGGCGCAGTGATGTATAATCCCCTTCCACAACGTTGGAGAGCAAGCATGTCCCCGGCCA
TTAGGCTGGTGTGGGCAGCATCCTGTATATTCCTATAGCTTCCCAGAGCCCTCGGGCAGT
GACTGGGGAGACAAACCATGCAGGGTACAAAACTATTTCTCTAAAGTGTTTATTTTATTT
TGCTAAGGTAAGTTGACAGTCCCATTAAGCATCCTAAACTGAGTTCTGTCTTTAGGGTTT
ATAAGGGTTCATGCATTTGCATTAGAACCCCCATTTTACTCTTAGGGGACCAGAAAATGG
GTGTAGAATCAGGAAATTGCATTGTTATATATTGGCGGGACCAGTTACAGTTGCATTTTG
TTCGTTTTGTGCATTTAAACGATTATTGCCTAATCAAATGTTAGAGGTACAGTATCCAGA
AAGCTCCGAATTACAGAAAACCTGTCCCCCCTAGACTCCATTTTAATCAAATAATTCAGA
TTTTTAAAATTGATTTCGTTTTTCTCTAGGAAAATAACAGTACCTTGTATTTGATCCCAA
CTTAGATATTAATCCTTATTGGATGTAAAACAATCCTATTGGGATTAATTTTTTTTATTG
ATTTTTTAGTAGACTTAAAGTATAAGGATCTAAATTGCGAAAAGACCCGAGCATTCTGTA
TATGTAAAGGTTTAATAGTCAAAAATATTTTTTGTCCCACAGTTAAACATCTGCAACTTT
TCTTTTTGTGGTGTGTTCAACTGCAACAGCACAGTCTGTGCTTCCTCTCCATAGTATTCA
TTGGTAACCATTAATGCATATATTGAATATTCAGCATCAAATGCATCCCCATCATTTTAG
AAAAATCACCAGTGACACAGTTGTTACTCTTGTGTTGCAGCCTTAGAGGAAATGCTAACT
TTTCAAAATGTAAAAATTGCTCAGAGCATATTTAAGCACTTCAGCAATTGATTTTTTTTG
TAGTTTTCCAGCTATAAGAAATTAATAAACGGCTAATGTATGAGATCCTTTTTCTGGAAA
CTTGTCATTCTGAAAGCTCCTAATTACAGCAAGGCTCCCCTGGAGTTCATTTTGAGCAAA
TAATTTTAATAAAAAGGACATTTTTAAAAATGATTTCCCTTTTCTTTGTAAGAATAGTAC
CTTGTACTCATTGGTAATTAAACCATATTGGTGGCAAACAGTCCTGGGTTTGTTTAATTT
TTTTCTTTTTTAAAGCAGACTAAAGGTGGCCACACACGTGGCCATTTGCGATCTTTGGTC
GCTCGAAAGATCGTACAATCAGCCACAAACCATTCAGGGCTGAAACGGCAGATAAGGAGG
TAGAAACAATAGGATTTCTACCTCCTTCTGCCGATTCAGCGCTCCAGGCAGATTTTGGTC
AGGCGCCTTCTATGGTGCCCGATCAAAATCTTTTAACTGGCCCGATCATCGAGTCGACCA
ATAACAGCAGCCTCCTGCGATAACAGTCGACTCGCCGACTTGCCATACACGCACCGAATA
TTTTCGTATGATAATATCAGTGCGTGTATGGCCAGCTTTAATGTGTGGTGATCTGATATA
CAGAAAGATCCCTTATCTGAAAAAACCCAGGCCCTTAGTATTCCAGATAATAGATCCTCT
ACCTCAGGGATCCTCAACCTTTTATACCAATGAGCCACATTCAAATGGAAAAAGTTTGGG
AGAGCAACACAACCATGAGAAAAGTTCCTGGTGGTGCCAATGAGAGCCTATAATTGGCTA
TTTGGTAGCCCCTATGTGGACTGGCAGCCAATAGGAGGCTCTGTTTGGCAATTACACTGC
GTTTTTATGCAACCAAAACTTGCCTCCTAACCAGAAATTCAAAAATAAGTACCTGCTTTG
ACGCCACTGGGAGCAACATCCAAGGGGTTGGCAAGCAACATGTTGCCCCTGAATAGGTCG
GGGATCACTGCTCTACCTGTATGAAACAGTGCCATCTGCTGGTCATTTTGGCTAACTGGC
TGCTGTTGGCTGAATTACCTTTAGTTAGTGAGAGAATGAATGTCTTGTGATGTTGCTCTG
CTTAAATGAAATGTTGAAAGCAGAAGTCATCTGACTGCACATCACTGCAGAATATTTTGA
TACTTTTAAATAAGTTAATAATTATTTGATGTTTGTCAGGTCCGCTCTAAGGAGAGCAGC
GACATGTTTCTCACTACATTTATTTTTTGGCCCCTGTAGCTAGTCTGTTGTAATGAACAG
CAGGTGGCACTGTTAAATCAAATTCACATTGGCTCTTCACAACCTAATATCTTGGAAACG
AGGGGGAAAAAAATCTAAGCACTTCACTTCGAGCGCTCTGAGTAATGTTACATTAACTTG
TTTTTCTATCTAAATTTCTTTTGAATGTAAACTAATTGCTATGAAATAATGTTCTTTATG
TGAGCTCTTCCAAAATATTTACTCCCTCCTTGCGCCAGCTGGTGTAAGCACTAGCAAAAC
CACATGAGAAAAAATTACCCTGTTCAGACCTTGCTGGTGGCTGTAGATAACACTTTTGTG
TATATACAGGTATGGGGGTTTCTTATCTCGTAACCCTGATATCCAGAAGCCTCTGACAGA
AAGGCAATCTCCTGTTGTTTAACACAAACAATTGTAATTTTTAATTTCCTTTTTCTCTGT
AGTAGAATAGTTAAACTCGATCATGACTAAGCAGCACAAATTCAAACTAGCAGCAGCATA
ATCCTATTGCATTTTTTATCTTTCAGTGCTTTAGGTAGACTATCTATGCAGATCCAATTT
ATGGAAAGATCCCAGGTTGAAAGCGTTGTGGGTAATAGATCCTCATACCTTTATTATATA
AATGAAGAATACAATCAATCAGGGCTAACATCACAAATGCTATGTCCCATTCATGCTTAT
AGTTTTGAAATATTTTTAGCCCTCAGTCATTCAAAAGCATGAAGTCAATTGACAAGTGCA
AATGCCTAGGTTTAACAATGAACCTCAGACGCACATAAAGGGTTATTAACTGGGTCTGCA
CTTCGGTACAACAATTGGATTTCCTAGTGTGTAGGTTTTCCGGCTACATTTTGTGAAAAT
AATCGTAAATTGTATTTATCTGTTAGAATGTATATGCAGGCTAGGAATAACAGTTATAAA
ACATTCTTCTTTCAGTCGCACTCTGACTGCAGTACATGATGCCATTCTAGAAGACTTGGT
TTACCCAAGTGAAATTGTGGGCAAGAGAATCCGTGTCAAACTGGACGGCAGTCGGCTTAT
CAAGGTCCATTTGGACAAGGCACAACAGAATAATGTTGAACACAAGGTAGTAGTTTCAAA
CTAGTGCTGCGCTATCCTTAAAGCAAGCTTTAGTGCCGTTAGAATCCATCTGCAGTTTCA
GGGACATAAGTTGATATGCTACTTTAAAAGGGCTAATATGCACCTTAAATTACCTTCTAG
TATGTTGTAGACATTGCTATAATATGCATTTACATACTATTCTATACATTTTGGCAGTTT
CTGTTTTTTTTGTTCTGCATTTAGACTGTGGTTGCTAGGGCATACGCCTTAGTAACTGCA
ACATTTTGAAGGATGAATAGTAGAAGGGCCCGAGTAAATAAGTCTTTATTTTGGTGTATG
TATGTGGCTTAGCGATCTGCACAAAATGAGTGTTATTTATTGCTCCACCTCTGTGCCAGA
AACGGTGCAGGCAATATATGACAGCTCTGAATTTTTAATGTGTATGGGTGTTTGGTTAAA
AAAAAAAAAAATTGTTTTTCATGTTTGTTTTAAAGGACTTTTATTATACAGATTATTTGT
GAGTGACAGGCTCCTTTTAATTTCAGGTGGGCTCCTTTAATTATTAGTGGGGCAGCACAT
TGCTGTCTGTGTAAACCTTGGTCTGCTTTTATCTAGTATAGAGCAATTTAAATGCTGGTT
AATTTTTGAAGGGGAAGTTTTGCGTTGTCCATGTATTAGAATATCCCAACGTGGATATCC
CATAAGGTTGCTCTTGTGGGCTCTGTCCAGGTGGCGAATGGGAGCATCGCCCTGTGAGGC
GCAGTGATGTATAATCCCCTTCCACAACGTTGGAGAGCAAGCATGTCCCCGGCCATTAGG
CTGGTGTGGGCAGCATCCTGTATATTCCTATAGCTTCCCAGAGCCCTCGGGCAGTGACTG
GGGAGACAAACCATGCAGGGTACACACAGATTCCAAGAAGTACTTAACTTAGTAGCTTAT
TTGCAGAAAAGATTACCAGTGGGGGGTGTATGTTTTGTATACCGACTTCTCTATGAAATT
TCATGTAACTGTTCTGTTTCTACAGGTGGAAACATTTTCTGGTGTGTACAAGAAACTCAC
AGGCAAAGATGTGGTCTTTGAATTCCCAGAGTTCCAGCTGTAATGTGCAGGATTGCATAA
TAAAAAGTACTTCTTGTTACAAGTTTGTCTTTGTGTTTTCTACCATCTACCTTTGTTCTA
TACCAATCCATTGGTCAAGAGGTTTAGCATATGGGCAAGATTTATTTTCCTTTACATACC
TTCCAACTTTCCCGATTTTTGTGGGGCAGTCCTGATTTTGACAGTTCAGCTTTCTGTCCA
AAATTCTTACTGAAAAGTCCCTCATTTCCCTTTTGATCTTCTGCACCGAAGGCCAACAAA
GATACAAAGTTTCTCAAACTTAATTAGATAAGTAGCTTTTGGCAGAGATCCCAGAATACT
CAACCCCTTCACTTAGGCACAATTGTAACTAAAAAGCTAAACAGGTCTCTTGGAACTAAG
ACTTGCTAAAAATGTAAAACTGCACTTTAAGATGCAAAACTGTAATAACTCATAAAACAA
GACCCCAATGCATCTGGAAATGTATTCAAAATTTACATAACCTGCCAAATTGTCTAAAAT
GGAACTAGTATTTAGGGGTGTGGTAACAAAAATGGGTGTGGTCAAAACATTTTCGCACAA
TTGTTTTGTTCCTCTGCACCTTTCAAATCTGAGTGTGGCTCACAAGTAAAGTAAAAAAAG
GTTGGTTGGGGACCCCTGTTCTAGAGACTGGTCCTTATGCAGTCATTAAGACCCCCTACA
AGAGGCGATACTAGTTGAAAATGCATGAGTCACTCGAAGCCAAATGACTGGTTACTCAAA
CAGACAATTAATATCAAGGCAGGAAGGGCAGAAACCTTGAAGGCATTAGCACTTTCAGGA
GAAGTCATTTACAAATTTTTCTCGTCTTTAGGCAACTTGCAACTATTTGCTGCAATTAGT
CTTATTTAAAGCAGACATATTAAAAGATGGAAGGAATCTGAGACCTAATTCAAGTACAAA
TAACCCGGAGAGTACACATCTCAAAATTACACTTTCACTGAGAACATCTCAGACATCTGT
GTTGAGATGTCTCAATAAAATTACACTTTCACTGAGAATATGTGTACTCTCCGGGTTATT
TG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1030, 2370..2451, 3491..3562, 4123..4266, 6276..6340, 10515..10665, 11665..11781
2377..2451, 3491..3562, 4123..4266, 6276..6340, 10515..10665, 11665..11739
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved