Xenopus_tropicalis Locus rpsa
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis rpsa
Xenopus_tropicalis
rpsa
scaffold_109
SNORA62, SNORA62
4349..4503, 5686..5838
9348
ACATATTATGTAGCACTGTACAGTGAAAGGGTGTATACATCAAACATATTGTTTACAGA
ATCATTATGCTTCTATAAAGCATGGTCTTTTAAACCTCGGCTTAAATATTTGTTGCTTGG
TCTCAGCTTGGTGGCTGGTTTCTATAAACCAGTTACATGACATATGCTGCATCTATAAAT
CTGACAGGCAGCAACAAACAATACCCAGTGCTGAAAGTTTTAAAGGGAACTTGTGGTTAT
GACATTTTGGATATCAAGGTCTGTGCAACAAAACCAGCATCCACATATGTAAATAGTATT
ACATTTGGTCACCAGTAAATATCATGCTATAAAACAACAAACTAGTCCCTGACTAGCAAC
AGGTAACAACTTATAAATTGCAATGTAACCCAGCTATGGGAGTGACGCAGTGTGCCTATA
GCCTCTGTGCAAGCAAGACTAGTAAATTATGGAAGCGCTATTTCTGTTATTAGTTACATT
ATATGGCAGTATCTAGCAATAGATTGTTCAACTTCTGTATAAATTATGCTTAATACAAAA
AAGTGGCAATCCTACCTATTTGTGTTGTTACAGAAAAACACCCTCAAACACTAACATTTT
ATATAACGCCTGTTTATAACTCCATGTGCGAAGATCCTTGCCTGTTTCATTGACAATTAT
AGTTACCTCAGCTGTTTGAGTATGTTTATTAAGAGCGTTATTAGCCAGCGAGAACACTAA
AATAAATAAAGCTCCTTCAGTTGAGACCATGTACTATCCGCGCCTATACACCACCAGAAC
TACACCTATGTGCCTGACTACTAAGGCTTCACAGGCGGAGTACCAATGTGGCCGACTCAC
CCCGGAACTTCCTTTCCCAGCACTCTGAATATACCGCCATGTAATTGGACGACTGCTGTC
TCAAAGCTAGCAAAGTAGTGTGTGATTTGTCGGCTCAGAACTATTTAATGACGTCACGAG
CGCCGATACGTTCTCTTTTACTCCAGCTATAGCAGGAGGATCTCCACACGGCTTTGTCTC
CCGTGAGTGGCATATATAGCGGTTGATCGTACAGATTATTTTGTGTAGTTCTGGCAGTAG
AAATGAGCGTAACATTGTCCGAAAGTGTTTATGGGCCGGTTTACAGCGTTAAAGTTGCGA
GGCCTCGGCGCCTGTGTTTGCGTAGTCTGGACAGACGTACATGTGCTTGCGCTCGCCTTG
TTGCTGTGGTAGTGACCGCCTTAAGTTACACAATGAAAGAAGGGTCCTATAAACAATAGT
TTAGTCGTTAGAATGTTGTACAAGTCTTGAAGTTCTATTTGGTTAAACGTTTTCTATTGC
CTGATGGCTGTACTATATGTGACCCGACCAGGCCCGCCCTGTGATTCAAAATAGGAGATC
CTGCCATTTCAAGTACCCAGAGGCCCAAACTGTTCCCCACCAGCCCAGTAAGCAGTGACT
ATGGCACCTTACAGCAGCCCTTCTGGCATTTGTCAGAACTCAGACTGGCAGTTTGGGCCA
GAACCTGACGGGACTTGCCTTAGTACATCATATTAACAATTGGCTTTTTATTAAGTTTAT
GCCAGATATGTTATATGTGCAAGTAGTATTGGTTTTATTGTGCGTTAATAAAATACTTGC
ATAGTCTGCAGTGTATTTCAATTGGAGGGAATGTGCAACCATACACTTAGGGGTATATTT
ATCATGCTATGTAAAAGTGGAGTGAAGCATTACCGGTGATGTTGCCCAGGGCAACCAATT
AGATTTTAACAGAAAACCAAAGCATCTGATTGGCTGTTATGAGCGACATCGCTGGTGGTT
TTACTCTACTTTTTCCACAGCATGATAAATATACCCCTTAGGTTGCATAGAAATACTTGC
CAGTACAGGAGGTGAAGTCTGCTCTGCCCAACAGAGGTTATGGTTTAAATATCTTCAACT
TGTTGTTATAAGTGATGGGTTTTGCAGGTTTACACAGCAGCTTGTAATCTACTGACAGTC
CCCAACTGCTGAACGACCAGGACAGGGACCCACTATGCACTGACCAAACAGGCTTTTCTT
TACCCCCAGAAACTAATCTTTTGAATCCTATAATGTATCCTCATACCTTGGAGTTATGTT
ATTGCAGTTGGCTGACTTAGATTTTCTCTATTTCAATTACACCCCTTCGGCTCCATCCTG
CTTTTAATACTCTTGACCTCTTACTGTTAGCAAGAAGCATTTTATTGCCTGTATTATATA
TATTGGAAGAATGGCCAGATGACATGATTGGAATTGTTCGAATGTAATCAGTTGTAATGT
AATTTATTGTAAGTCTGTTAATCAGCTGGCTTCTGCTGCATTTTCAGGCCACAAGTGCAG
AGAACATAAACTAGACACTAGTTTCACAACTATACAAATGCCTTAAAAATATTGCATGTT
AATTAGTTTTAATTGGTTCCTTTTACATTGGAATCCTGTAGATCTGCTGGTCTTAATACA
AGCTTGGGTTTTTTGCCTTTTGTTATAGGTTCCCCATCGTAGCTTTAAAGGGGTAACTCA
CAATGTCCGGAGGTCTTGATGTCCTGCAGATGAAGGAGGAAGATGTCCTCAAGTTCCTGG
CAGCAGGGACCCACTTGGGGGGCACCAATCTTGACTTCCAGATGGAGCAGTATATCTATA
AAAGGAAGAGTGATGGTGAGTATATGCTATATTTGACTTGCTTAAATTAATTTCTAGGAT
CTATACCCACTGATGCAGTAAACTATAAAATAAACTAGTCCTTGAATTGTTAGGTGTAAC
ACAAGAAAATGCAGCTCATGCCAATGCAAGTTAAGACTGATGGATACAGAGTGTTATTAC
AGTTGTGTGATCAGAGAATGATTTGCTGCTTGTTTACAATACTCAGCTTTTAGGTTAGCC
TAGGAAGGATACTGTACACAGCCTTATTTCTATAATCACAGCACACTGTTAAAGCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTAGTTTGTGCCAAACTTGGCCTGTGTGTGCCATACTCTGCCTGCCCTACTCTGCC
TGTGTGTGCCATACTCTGCCTTCCCTACCCTGCCTGTGTGTGCCATACTCTGCTTGCCCT
ATGCTGCCTGTGTATATGGCACACACAGGCAGCCTACAGTGACACAATGCTGGCACTACT
CCTACAGTCTGCACAATAACTATATTAAAAACGTTTTAATTGCAGTACCACCTCAGTATA
TGTTCTTTTTGTAGTGTGCAGGGTTTATTTGTGGGTTTCTACTGCTCCTGAGGTGTGAAC
AGGGGAACAATGGGGGTGATTACAGCCTGAGCCTGAGGTGTGAACACTGCAGGGGTTGAA
CAATGCAGGTATTAAAAGGTGTGAAAAACACAGGGGATTACATATTTAAACAATACAGCC
TGATTACAGCCTGAATCTGAGGTGAGAACCATGCAGGGGGGGCAGTTAATCACAGTACTG
ATACCATTTAAAGCTTACACAGGAGTAAGCCATCAAAGCAGCCAGACAGGTGGGGGGCCA
CACAGAGGGGGGTCGCGGGCCGCCAGTTGGACAGCACTGCTGTATACCATCTGTTGGCTG
CCCAGAGTATGCATTTTGAAATTGGTTTTTATACCTTAGGAATCTACATAATTAACCTGA
AACGCACCTGGGAAAAGCTTTTGCTTGCAGCACGTGCCATTGTAGCTATTGAGAATCCTG
CTGATGTGTGTGTCATTTCTTCAAGGAACACTGGCCAGGTATGCAGTTCTTTGCATTGGT
GCTGCTTGTATAGTTAGAAAATTACTTGCTTAGTAGCTGTTTTGTCATATATATCAGAAT
TAATCTTGTACTGTTCTACAATTTACAAGTTATGCAAATTTATATTTTGAATTGTCCTCT
AATTGAAAATACAGCTGCACTGTCAGTGTTAAGCATTCTCCCCCTTTAGTGTTTTGTACA
GTGGTGTATGCACTACTCTTAATTCCTTTATTGCACACTGTTAAAGCTCAGATGAAGCCA
TGCTGGCTAATGAACTCTTGAGTGTCGGAAGTGTGCCATAGCATTATTGTGGCAAGATTT
TCGCTAACACCGTCAGAGTCCTTGGCTCAATGATCGGCGTTTGATAGTGATCTCTGCTAC
AGTTTACTTCCAGGTAAAACTAGGCTGTGAATACTAACTGTCTTTTCTCCATAGCGTGCT
GTACTGAAGTTTGCTTCTGCCAGTGGTGCTACGCCTATTGCTGGTCGCTTCACCCCTGGT
ACCTTCACCAACCAGATCCAGGCTGCTTTTCGGGAACCTCGGTTGCTAGTGGTGACAGAT
CCCCGGGCAGATCACCAACCCCTTACTGAGGCTTCATATGTCAACATTCCCACCATTGCC
TTGTGTAATACAGATTCACCACTGCGCTATGTGGATATTGCTATCCCATGTAATAACAAG
GTGAGTAAACCTAAAAGCAACATCACTTTAAATGAGATTTCTCCAGTGTTAAACAGCACT
AGATTTTTTCCTTTAACTAAAACATGTGTGAAATTGCTCAGAATGCTCTTGAGCATTTTG
GTAAATTGTTTGCTTAGCAAGTTACTTATCTAGATTTACATTTTAAAACAGACTTATTAA
CGAGCATTTTTGCAGGTAAGTGTCTGGAAACACTTCTGCATTAGACATGTAACTCTTGCT
TTTTAAATCTCATTAGCATTATAAAGTTGCAAATATCAAGACTAAAACATTTATTGCAGT
GGGCAAATATTTCCCCTTTTTTTTTAAAAGGGAATTTATTTCTAGAATCCAGTTTATTAC
ATTAAAGATTCCAGTTGCTTGTTATGCTACATTTATAATTGTTATATTTAACATAGTTAA
ACATATTCAACAAAATGATTTTGGTCTGCCTGTCTCTAGTTGGAAAGCACATTCAGACTG
ATTTTTGATTTGTGCTTTGGGACCCCAGAACTACAAAGCTGGCACCATAGTTCTACTTGT
TAATGATGACAATCAAATCATTCTGCTGCTAGATTTATTTCTATATACTCAGTCCATTCC
TATTTTTTTTAGTTCAAACAAACTAGATAACATTAAATTCAGAAGTAGGAGGAGGCTGCA
GGGCAAAATTAAAAATTGTTTTAAAGTGTTCATTGTCTACTCTACATCAAGCTTGGAGAC
CTGCAACACAGGTTTGTCCCTCTAAAGAATTGCTATAGCACCCAAGCTTCCCGGTGTACC
ACTGAATTTTGTATGGTATAAATTTCTCTTCTGGCCACAATACAGTATGACTGGCCCGCT
ACAATTTTAGAAGTATTCTATAACTCGTGTAGATACCTGTTTTCGCTTTGCACACAGTTA
GAACTTAGAGCTGAGGCCTTCTCGGCCAATGAACTCTGAGTGTAGGATGTGTGCTACAGT
AACATGGCAGACTTTTCGCTAATGCCACAAGGTGCTTTAAAGCTCCAGTGACTGGTTGTA
AGTAATTCCTGCCACAGCTATTTACAGTGCAACTTTCTATTACCTTTATCTTCTAATTTT
CAGAGCAGTTGTAAGTAAAATATGGAGGTATGTCAAAAGTACATTATCAGAATTCCTTTT
TATGCATTTAGGTATTCTGACAAGTGTTAGGGGACCAACTTTTTATGTTTCTCTGTTATA
TGCTTACACACTGAGCACTTAAAAGGAAAGTTACAATCACTGGGGGTGCCAAAATATTGG
GCTCCCCCCCCAGTGATTGTAATCACTTACCTGGCAGGGGGGACCAACCCCCTGTGAGAT
GGGTCTGTCAATCTGCTGCCTTGTTTTACATTATTTCAAAAGTCAGAGCCACCAGGGTAG
AGAATAGAAAAGGACAGACAAATGTTGCTTTTAATAGCAAATATACAAATAACTTATTAA
ATTGTTATTTACATTAAACATTAAAAATGTATCTTGCAAAGTTGTTTAGAATTGTGTTAT
TAGGCAAAATAATTTTTTGGGTTGACTTTTTTAAAGATTTAGTCAGTTTGCAGGCTCTTG
TTTTTATGGTTACATCTTCTGAATGACTTAAGTTTGGCAAGTGTCTGCTGTTCCATGTAA
TGGCATTATTCTGGAGCTTGGTACAAATGTGAGCTAAAAAGCAACTTACTTATAACCAGC
TCGACTGAGCACCATATATTTATTTATTTATTTTTAAACTTAGGGTGCTCATTCTGTTGG
TCTTATGTGGTGGATGTTGGCTCGTGAGGTTCTGCGCATGAGAGGCACAATCTCTCGTGA
GCACCCCTGGGAGGTCATGCCCGATCTGTACTTCTACCGTGATCCAGAAGAAGTAAGTGG
TTTTGTATATTGGTTTCAACTGCAGGTAAAACTGATGTTTTATCACAAACATCTTTAGGA
ATTGATGGCTTCTAATGCATTCATTGACTGAAAGGAGAAGGAAAGGCTAAGTCACTTGGG
GGTGCCAAAATGTTAGGCACCCCCAAGTGACTTAAATCGCCTACCTTTTAGCCTGGGCTG
GTGCCCCTGTTAGGAGAAACCAGCACCAGCCCGGGGTACCTGCAGCGCTTCCTTCTGGCT
TGCGCACGCATGTGCAGTACAGTAGAGTGAAAAAGCTGAACGTAAACTATAAAGTTGGCT
TTTCACTCTACTGCGCATGCGACTGTCCAGGGAATTAGCGGCAGAACGAAGCAGGAAGCG
CTCGCTACAGGTACCCCCTGCTTGTGCTGTTTCTCTTCTCTTTGCAGAAACTGGCAGATG
TTACTCCTCCCAAGTTTATTTGCACCATTAAACTCATTAGCTGTTTTGCATCAGGGTTTT
ATTCACATGAGTTAGGATACTTCATAAAATAACTTTAGAGGGTTAGTAAGTTTGTCCCCT
AGTCCTGATTTCTAGTCCTTAATGATAAATTTGCCTTATTAATGACTAGCTGGTAGTATA
AGATTCTCCCTTCCTCTTTCCAACCCCTAGATTGAGAAGGAGGAACAGGCAGCTGCAGAG
AAGGCTACCACCAAAGAAGAATACCAAGGAGAATGGACTGCACCTGTGGCAGAGTTCCCT
CAGGCTGAGGTTGCTGACTGGTCTGAAGGTGTACAGGTCCCATCTGTTCCCATCCAGCAG
TTTCCAGCTGGTAAGATATTACTACTTTCAAGAAATTTTCATACTAAAATTAGCATTGAA
GCAATTCTGTACAGTAGAATAAATAGCATTTGAGCCCTCAAGCCAGATTTCCTAGGTTGG
TATAGCCGTAAATGTTTTGTAAAAACTACTACTGGATTGTCTTCAGCAAACTTTTTTTTT
TTTTTTTTCTTATTGAAACTATTTTCACATAAGTTATCCATAATTCTGTTAATTTTTGGA
CAGTTACTGAGTAAATACATTTGCAATAGTAAAAAACAAACATACTTTAGTAGATGTGAG
CCTAATACATTTTATCTATTACAGAACGTCCAGAAATTCCAGCAGCAAAACCTGCAGGTA
AACTTGATTTACATTTAATGCAGACTTCTTATCTCTGCTTTTGGGGTTGTGAATGGATAT
TCACTTTGGTCATAGATTAACTTAATTTGTGATGTATCCAAGTGCAGTGAACATTACTGC
ACCCTTTGTATATAATCTGGCGTCTTTCATTGTAAAGACAACAGTCCCATAATTTGCCAA
CATTATGGCCCCATAATAGAACACTCTGGTATATAGCTTTTAATGCCAGTGTTTATTGGC
TGTACATTGCTACATTTTTAATTACACATTTTAAATTTGCTCAGCTATGAATATGCCCTG
TCTTTACTGGTAAATCCACTTTAGATGTTCTTGGTAGCTTTTTTAAAAAAAATAAACTAA
CCAGTGTTATTGTCATTAGCTGAAGACTGGAGTTCACAGCCAGCTAGTACTGATGACTGG
TCTGCTGCCCCTACTGCTCAAGCATCAGAATGGACTGGAACCACTACTGAGTGGTCTTAA
GAACACATATGTCCCAAGTGTGTAAGGTCATGAAAAGACGGTGAAATAAAATTTCATTTT
CACTTTTCACTTGTGCGTCTGTTAATTTCTTACTGGCACCCATCAGATGATGTAATTAAA
CAGATTAAAAGCATTTTAAGAGATTTTATTATGTAATAGACAAAGTTGCTGCCATGTTTT
CCCCTATACACAAACTGTGCTGGAGGGACCAGATATAAATATTCTACCATTGTAGAGTTT
TGTAATAAAAGCCACTAGTATGAGGAGTAGTAGAGGAAGAGGAATTAAGATCCACATTTA
TACATTTAATGTATATAAAATGTATGAACATGGCTGAAATTTGCAGATAGTAGTTAGCAA
AACGCCTTGGCACTGTTTTGAGAGAGTGCGGGTTCCCCAATGGCCACTTCCCATTGGTAT
ATCTAAGCAAAGACAGTCTGGGACAGCACCACTTGTATTCCAAAAATGCCCAAAAAGATG
TGTGCAATAAAGGCATTTTAAATAAGAATACAAGTGGTGCTGTTCAGGACTGTCTTTGCT
TGAACATGGCTGAAAGTCAAGCCAAAATGTCAACATTTGCAGAAGTTATTTACACAACCA
TCTTCACTTGGGATTTGGTAAATTTTACTAAAAGTTCAGAAATTGTAGCCATCCCCTGCA
CTGTCCTAATCAATGGGTGTATGGGCCACAGTTACTTCACTGCATGTTTGTCATGTATAA
TATGCTATGCATTTCGCAAAACCACCTTAATACTGCCTATCTGCTTTGGGAAGTATTTTG
CTACACCTCCAAGCTTTGCAGTGAATGTCTGAAATACAGCAGAAAATTTTGACCCTCTTG
TGAATCTGTACCCATTACATTAATAGATTTGTGCAAATATACCTGGGCTAGTAAAGCCGA
GCTGACTTTTGGCTCCCCACTCTCTACCATGGAGTTAAAACCCTGCCTATAGCAGTATTA
CTTAGCAGAGGGAGTTGTAAGCTTTGGCCACTACTGCACATGCCCCTTCCTGTTAATTGC
AGTAGTTAGCACTGCTGCTCTTTAGCTGTGGGGTGCTAGGTTCAATTCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1021, 2488..2654, 3999..4117, 4554..4799, 6523..6651, 7290..7449, 7764..7796, 8179..8348
2522..2654, 3999..4117, 4554..4799, 6523..6651, 7290..7449, 7764..7796, 8179..8276
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved