Xenopus_tropicalis Locus atp5b
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis atp5b
Xenopus_tropicalis
atp5b
scaffold_101
SNORD59, SNORD59, SNORD59
3246..3315, 4096..4171, 5707..5775
8052
CTCCCCATCCCACCGGCAAGACTGTAAATCGCCAATGAGATTGCATCGCTGTGATTTCC
GGATGTCGCCCAAAGATTCCTCTCAATGCAGCTTCGGGAAATTTTAGCGACAGGTATGCC
ATCCCACAGGCGACCCAGAAAAAAAAGCCTTGCGAGTCTTTTTCGGCGATTTCGGGAAAT
CGCGCTGCCACGTGTGCCATCCCGCCGGCGACTTACATGTTCGCCGGTGGGATGGCAGGG
GAAGGTAACTCGGAGAGACTAGTTGCCCGCGAACATGGAGTTTTGTCGCGGGCGACTAAT
CTCCCCGTGTGCCAGAGCCCTTAATGCAAACTGCTCTCAGTATAAATGCCTCAGTGTGGG
GACAGTTTGCTCTTAGCGCCATTAAATGTACCAGTGTGGTGACGAAGTGTCATCACATAG
GCTTTAAAATTGAAAATAAAATAATGGGAAAACCCAACGTTTAAAATGTTTTAAAGTTCA
ACCTTTCTTAAATAATTATGGATAGGAAAACTAAACCATTAAAACTCATTTAAGTTCAAC
CTTTCTAAAATTATTATTAATATAGTAATTATAATTTACGTGTTCTAATTCAGTTTGGCT
TTTAGGTTTGTTTCTAAATAACATTATTTATTAATGTTGATGTCTATTCGGCCTATAAAT
GTGCACTAATTAGACTAGGCGCTTTATGGCTTATACCAAAGTCAAAGCATAAGCACAAAA
GGTCCCGGCACCACGTTGCTCCTCACACTTCCTGCTCGCAACCTGAAAGACACTGAAGGA
CATGACCGCGCAGGTCACAAAGTCTCTCAAGTCCCGCCTCTTTAGTCGGACGGGTACGCC
TACATCCCTACTGACGTTCCTGTTCCCAGAATAGATATCTCATCCAATTGAGAGACGCGA
AATGCTAGAGCGACGTTAGAACTGGCTAATCACTATCTTGACTCCTCCCTGTGACGTTAT
TTTACGCGTACTCAGCGGCCCCTTCTTGTACCCGCCCCCAGAGCTACAGCCTCTGAGTGC
TCCTTCTGCACTGCTGCTGCTCTCCGCTGCTGACGCCGCCATGTTAGGGGCTGTAGGACG
TTGTTCTGCGGGGGCACTGCGGGCTCTAAAGCCAGCATCTAACCCAGTTCAGCTCGGGCA
GAACCTTCTCAGATGTTCCCCTGCAGCGCTGCACTCCCGTGAGTACTAAGCGAGCACGTA
GTGGGTGTATGAGAGTGTGACCTAGCTGTGTCATTGAGCGGCGCTTAGGCCTCTAGACTT
GCCGGCGGGGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNAATGTCGTCTGTGCTGCCTTGGGTGCTTTGCCCCCTGCCCTGGGGAATAGCCCCCCT
GACCTACCTTCTGCCATGGTGATTGTAAGGGGTAGGAGGAAGGGAAGACCGTGCCGCCTG
TCAGTCCCCTTTTTAGCTGGAGTGCTGCTGTAGACAGAGAGGCTGCAGCTGTCTGGAGCG
CCGTGGGAGGAAGTGGGATGCGTTCCACCGGTTGGCGCCAAGTCAGGGATGCGCGTCACT
TCCTGCATACGCGCTGGTATGGCAGGCGGAAGTGCCGTTGGGGTGACTGCGCTCCATCTC
CCGCGGCCGAGGCGGTGAGCGGTATCTACGTGAGCGCGCGCGGGCAGCGCGCACCCAGTC
CGGAGGCAGCTTGCAGAGCGGGGAACCCCCCATTTCCCTGCGCAGGGTGTGCGCCCCCGT
CTGGAGCCAGCCTGCAGGCTGGGGGAAGACCCCCCCTTTCCATGTGCGGGCTGGGCGAGT
CAATCTGAGAAGAGGGACGGGGTACTTACCGATGCACCTCACCGGCCAGAGCCTCTGCTA
TGCTCTAGGTAGGGGGAGCGGTCGCAGGGAATGTCTGGGTGGTCTGTGTGTCCCCTAAGG
GATAAACGTTGACCCCGGTGGGTTTCCCTCGTAGGGGGCTAACCATTTAGGTCACAGGTA
ACCCTGCTCCTGGTGTCACCCCGGGTGTCAGGGCTGGGCCCTGACCGAAGGAATCATGGA
AGGTCACGCTGGGGACCTAGCTGTCCATCCTCCTGGTAGCAGGACACTTTAAAAACTGAT
TGGATTGGGTACAGTGGAGGGGTAAAGCCGGCACCTGGCATGCCCCTTTAATTTGTTAAT
CAAGTGTCCTGCCTCCTGGAGGGTGGAGCTATACCCCATACGTTCCCTGTGTCCCCCTGA
GAAGGCAGAGAAAAAAAGCCTTGCGAGTCTTTTTCGGCGATTTCGGGAAATCGCGCGGCC
GCGTGTGCCATCCCGCCGGCGACTTACATGTTCGCCGGTGGGATGGCAGGTGTAGGCAAC
TCGGGGAGATTAGTCGCCCGCGAACAGGGAGTTTTGTCGCGGGCGACTAATCTCCCCGTG
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGCCAGC
ATCTAACCCAGTTCAGCTCGGGCAGAACCTTCTCAGATGTTCCCCTGCAGCGCTGCACTC
CCGTGAGTACTAAGCGAGCACGTAGTGGGTGTATGAGAGTGTGACCTAGCTGTGTCATTG
AGCGGCGCTTAGGCCTCTAGACTTGCCGGCGGGGCTGCACCGCCCTGTCAGAGATTCATA
TAAAGCCGGCATTATTGTGGACTACGGTGTTCGCTCCATTTTGGGTTTAGTTGCCGCGGA
ACTAATTCCTGTCATTGAGCTGCTTGTGCTGCCGTGCCGGCTCCTCACATGGCTGCTGAC
AGGCCTGAGCGCTCCCCCAGCTCGGTTATTCTCCTGTGTGTGCCTGACCCGTGTGAAAGC
TTGTGTGTCTGCCCGGTTTTGTTGAGGTTTCTAATGCTCTCATGATTGAGGTTAAATCGC
AAGGTCATGTTCGCTGGAAATATCTTGCGACTGCTGCAGTTTCGGAAATAGTTTAATGCC
TTAATATGCAGAAGGTTTATTATGTTTCCCTTATTAAATGTGTGCAGTGGGACGTGCATG
TAACAGATTTTCCTGTATGTTGTAGGGAGAGATTATGCAGCTCAGACTTCCGCAGCAGCC
AAGCCTGGAACAGCAGTCGGCCGCATTGTGGCAGTCATTGGTGCTGTTGTTGATGTCCAG
TTTGATGAAGGCCTCCCACCTATCCTGAATGCCTTGGAGGTCCAGGGCAGAGACACCAGG
CTTGTGCTGGAAGTTGCACAGCATCTGGGTAAGTACTGTTATATGTGGCAACAAGTCTCT
TGCAGTACTTCCATGACGATTCTCATTGACTTTTGTTCTTCTGAGGTTTCTGAAGCAACT
TGATTTTCTGAGAAGTAATGTTGAACCATAAGTTTTGTCCTTATGTTCCTCTGACTGCCT
GACACCATGCTTTTATTTATTTATTTTTTTCAAGGTGAAAACACTGTCCGAACAATTGCT
ATGGATGGCACAGAAGGTTTGGTCAGAGGGCAGAAAGTCCTTGATGCTGGCACACCAATC
CGAATTCCTGTTGGTCCTGAGACCCTTGGAAGAATCATGAATGTAATTGGTGAACCCATT
GATGAAAGAGGGCCTATTACTACCAAACAGTAAGCGTGCTGTTCTTTCTTTGTGTCCTGT
GTCGGTATATCTAATTTAATACGCCCTGAGCTTGAGAAGCTCTCGGGACTTAACACTGTT
TGCAATTTTATACTATATAAACCAATTGTAGACTGAGTTGAATGTTGCGCCTTTGCAGGT
TTGCAGCCATCCATGCAGAAGCCCCAGAGTTTGTGGAGATGAGCGTTGAGCAGGAAATCT
TGGTTACTGGCATTAAAGTTGTAGATCTGCTGGCGCCCTATGCCAAAGGAGGAAAAATTG
GTAACTTTTTTTTTTTTTTTTTTTTTTTTTGTCCATTTTAACCTTGGAAGTGGTGCCCTC
TTTGCCCTCAAACTTGACTTCTAGAGACTGACATGGTGAAGTTCACTGGGGCCAACCTTT
TAATACAATAAAAAAAAAAAAATTTCCTCTGGATGTTATTCAGTTGACATGCATAAACCC
CCCCCCAGTGAATTTCACTTCAATATTTTTTTTATTTTTGGGGGAAACACGCTATAAAAT
CATATCCTTAAGTTTTCCTTCTATGATGATTTTTTCATTTGACTTTCGTTCTTCTGAGTT
ATTCTGAAGCGATTTTATATAGTCTGAAAAGGAAATGTAAAGGGACACAACTCTTTTTTT
TTTTTTTTTTTTTATAATTTGTAACTTTAATTTTGTTTGTTTTAAAGGTCTGTTTGGTGG
TGCAGGAGTAGGTAAAACTGTGCTAATTATGGAGCTGATCAACAATGTAGCCAAAGCTCA
TGGTGGTTACTCTGTGTTTGCTGGAGTTGGAGAGCGTACACGTGAAGGAAATGATTTGTA
TCATGAAATGATTGAATCTGGAGTAATCAACTTGAAGGATACAACCTCAAAGGTGACAAA
TGTTTGGAAAATGCTTCATTGATATTAAACTTACCCTGGGTCGTCATTAGGTATCAGAAT
GCATAACTGTACCTGAAGTGACTTTAGTTGGGTCCCCAAATGGGTTCCAAATATGGAAAT
GAGTCTGAAATAGCTTCCTTAATTTTATTTCTGTCTACAGGTCGCACTGGTATATGGGCA
GATGAACGAGCCCCCAGGTGCCAGAGCTCGTGTTGCTTTGACTGGTCTGACTGTTGCTGA
ATATTTCAGAGATCAAGAGGGACAAGATGTGTTGCTTTTTATTGACAACATTTTCAGGTT
TACCCAGGCTGGTTCAGAGGTGAGAACACTAGTTAGCTGCATCAGTAACCACTTCTGGGT
CTGGCTTTAATGGAATTCTGGCTGGTCTGTTTTAACCCCTTAGGGTAATGGCAAAAGGGA
ACCTTTGGGGTACAGCCAGGAAATGTGTAACCTCCAGCAAGACAAGTCTGTAAAATCTGC
TGGTGTTTGTTACATTGTTTCAAACGCCAGAGCCACCAGGGTAGAGAATAGAAAGGACTG
GCAGACACTGCCTTTAATAGCAATTAAATATACAGAACTTAAAAATCATTACAAATATGT
AATGTTTATTGCGAAGTTGCTTAGAATTAAGTTTTATTTTATTGGGCAAAAAAATATTTT
TGGGGTTTACATGTCTATAGCTAAACCCCTTTTAAGCACCTGCACTCTGAATACTTTTTT
AAAGATTTTTTTTTTTTATTTTGGCAAAGTGGTGTCTAATAAGCTAAAAGGCTAAAATAT
ATTGTGCTAAGTGTAGGATAAGGGTATGGATTATCAGCAGTTAGACTATTGCCAAAAGGA
TACATGCTTTTTTTTTTTAACTGATATTTGGCGTAAATTTTAATGGTTTTTCTAAAGTTG
TGAAACATGGCCACATTATATACCTTTTTATTAAAGGCAGCCTCCTGCATAGTCAGTGAC
GAATAGTGCTGACCAGTGATGCTTCTTTGTTTACAACTGTAACATTTTCCAGTTATGAAA
TACAAAATTTAAATTTTTAGGCAATCGTTTAAATTATTTCTTTCCTTGAAGGTGTCTGCC
TTGCTGGGACGTATCCCCTCTGCTGTCGGTTACCAGCCAACTCTGGCCACTGACATGGGT
ACCATGCAAGAGAGAATTACAACTACAAAGAAAGGGTCAATTACATCTGTGCAGGTAATC
TTCCCTTTATAGACCTTTTGCTTACTGGCTGATCTGCTCTAATTTATTGGGGGAGGGGGT
TTACATGCCTGCAGTGATGAGTAAACTGACTTTCGTTCTACTGAATTTGCTGAAGACATA
TTTTTATCTGAAAAGGCAGTAATGATCTTGTGGAGGGTTGTGTGGCTTTTATTTTTTTTT
TTTCTTTAACTGTAACTTCATGTGTGTGGTTTGTTTGTTTTTTTTGTTTTTAGGCCATTT
ATGTACCTGCTGATGACTTGACTGACCCAGCTCCTGCTACCACCTTTGCCCATTTGGACG
CTACTACAGTATTGTCTCGTGCTATTGCTGAGTTGGGTATTTATCCTGCTGTGGATCCTC
TGGACTCAACATCTCGTATCATGGATCCCAACATTGTGGGGCTGGAACATTATGAGGTTG
CTCGTGGTGTACAAAAAATACTCCAGGTAAATGACTGCATAATTGAAATAAGCTTCAAAT
TTGTACTGTTTATTCCCCAATGAGATGACATGGATTTTTTTTTTTTTTCCTTCCCTCTTC
ACAGGACTATAAATCACTGCAGGATATCATTGCCATCTTGGGTATGGATGAGTTATCAGA
GGAAGACAAACTGACTGTAGCCCGTGCTCGCAAGATCCAGCGTTTCCTCTCCCAACCTTT
CCAAGTAGCTGAGGTCTTCACTGGACATCTTGGTAAACTGGTCCCATTAAAAGATACCAT
CAAGGGATTCAAGCAGATCCTCCACGGTACATATTTTGACCGTTTATATGACTTTACTAA
TGTTTACATTTTAAGGGTCTGTTAAGGGGTTTTTGCTCTTATATTTATTTTTTCCTTGAT
TTTTATTTTCCTTGGTTACATTAAATCCATTATGCCCTGTCCAAGGTTCCAAAATGTTTT
GTGGGGGTTATGAATGCTGTCAAGTAACGGAGACCTGTATGTATTTCCACCAGAGCGCTT
AGCCTTCTGCTAATCTTATACTGCTCAAAACAGTACTCTGTACATGGGTCATAATAATTT
CTCCCTCTGACATAAATAAGCTAGTAACTAAAGTGGGGTAAGTCTTTATTTCTGTGTCAT
CTGGTTACTAGAGGGAGAACTATATAAATTTAAGTTGTTGTATACGTTAACAAATTTGAA
AAAAAAACTGGATATGTTTATAATGTATGTATTCCTTTATACAGGTGGATATGATAATCT
TCCAGAACAGGCTTTCTACATGGTAGGCCCGATTGAAGAAGCTGTAACAAAGGCTGAAAA
ACTTGCAGAAGAGCACTCTTAAAGACTTATTTCTATTTTCCTCATGCACTTCAATGAAAC
CTTCATCCTCAAAGTAACACTTAATGCCTGTATCTGTCTTGAGTTATGTTGGCAAAGTGT
ATTTAAAGTTTCCAATAAAACATCCATGTAAAGACCAACTTGTGTGGCTGTTTCAACATA
AATGGGGTTAATGTGATAAGTGGTGCAATGTCTGCAACTGATATACTGTAGTAACCTATA
ACCAATCAGTTGGTAGCACTTACTGGTCACCTGTTTAAAAGCAGGCATTGGTATTGCTAT
TTTTTACTGCCCCTTGGCAAACTTTGTGTTATTGCATTTTAGACCTGTCATTTCTGGTAT
ATCTTGTGTGGGTTTTCCAAGCATTCTACCAATTATATTTTGTCTTATGAAGGTATTTGT
TGGGTTTGTGTTTCTTCATGAGAATGTGTCAGGTACACCTGACCAGCAATGTTACATTGC
ATTAAATTGTAAACTTATTTATCCCCCAGACTTGTGCTCCTGTTTAGTAACAATTGAACT
GTTGTTGATCTCACTAAGCTGTGCACTGCCACCTTAGTAGTAGTTCTCAAGGCTCCCTTG
TGTATTTGACTGCACGCTTTTAATAATAACATACCATTCAGTTGCCATGTGCAAATCTAG
ATGGCTGTAAGGGGAGTCTTGGGAAACATAAGGAAGATGAAGGGGTGGAACTAGGATAGA
TCACCTGAACTGGTGCAGCTTTCAAAATAACACCGGTCTAGAGAAAGTTAGTGATGTAAT
ACACTGGCACATCTCCTTCCCCTCCTCAGTGTATTAAAGGAAAAGTAACACTAAAATCTA
TTCTACCCTGCCCCAATAATTGCCCTATCCTGCAAACCACTTAGTATTTTGAATGCTTTA
TTAGAAAATACCTGCTAAAACTTGGCTTCCGGTCAATTGAACTACAGTGATATGGCGATG
CAGGAGCGGCATCCACTGTGATGATCGATTGATCAAGCCTAGCCTGACTCCTTCCTATAT
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTACTT
TTCCTTTTACCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1177, 3025..3207, 3394..3568, 3718..3839, 4247..4431, 4600..4758, 5511..5633, 5873..6085, 6184..6385, 6824..7052
1060..1177, 3025..3207, 3394..3568, 3718..3839, 4247..4431, 4600..4758, 5511..5633, 5873..6085, 6184..6385, 6824..6918
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved