Xenopus_tropicalis Locus rps3a
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis rps3a
Xenopus_tropicalis
rps3a
scaffold_60
SNORD73, SNORD73
2395..2464, 5296..5367
7888
ACTGGCCCACCGTTGTACTAGGAGAAAGCCCAGTGGACCCTGGTCCCAGGGTCGGACTG
GGCCGCCAGGACACTGGGAAAAAGCTTGGTGGGTCCCGGCGGCCCAGACCCAATCCCTGC
AGGGTACTATACTGAAACGCAGGTCTCCCTGCTGCCTCCCCTGTCGCACTGACCATAAGT
TTAATTTAGGCCTGCTCGGGGGAGGTGGTCGAATGGGTGGGGGGCCTGCAGGGGGGGTTT
GAAAGGCTGCAGAAAGGGCCATTGGGGGGTGCAGGGGTGCCCAAGGCAGAAGCCTTGCCC
GGTCCTGTTGATTGCCACCTGCCCGAGCACCCCGGCAGGTTACATAGTGGCGTACTATGG
GGGCAGGAATGCTGATGGGTTTTTTTTGGGGGGGGGGCCTTAGTTGTGGGCCCTACCTCC
CCAGTTTTGCAGCCACAGCTGGATTTCAGCATGTCAAACATGTATTTATACTTTTTTTAA
AGGAACAGATTACAGTGATAGGTATATTAGGGGTTTCTGTGTTGTATGTTGTTTGGGGCT
CTTTAACAAATTGTGGTGTCTAAGCCAGAGTTCCACTTTAAATAAATTTTTTGCAGGGGT
GTAAGCCCAATAATCCTCCATGCTTATACATTTTTCAGCTGCCATGCTTCTCTGAGATAT
TACACTTTCTGCTGGCGTCTATGTAGAATACAGTTCTACTCCAAGCAAAAATGCATTCAA
GAATAAAAAAAGTTCACTGCTACATTAAATACTGGATATTCCCCTTAATGTTTGAGAACT
AAAGTTGGACCTTTAGCAAAAACAAACACAGTACGACGCCACACCACCATAGCCAACCAC
AACATGCAGCTGGAACAGCATTAGCGAAGGAGCCTTACAGCGCAGTTCCGCCGTTGGCCG
CTAGATGTCCTCGTTCTTCTCGGACACTGCACGTCTCGCTGGTATCCAGCGGCTCTGAAA
TCTCGCGTGTTGGGCCTGCGCTTCCTCTTTCTCTCCCAGCTCTGCAAGATGGCAGTCGGC
AAGAACAAGAGGCTGACTAAAGGTGGCAAGAAGGGTGCCAAAAAGAAGATGTGAGTAGCA
ATAGTGCGCGGAGATGGAATGTGTCACTGTTGTGCTCTATCCTTACAATTTTCATACTTT
GTTGGGTGCCGGATGGCAGGGATTCAGGGCGGATAGTGGTGAGGGGGTATGCCGGCTTGG
CGAGTAGCCGGGGCGGCCTGGCTGGTTTATGGTTGTTACTGTTTGTAGCATTCTGTCTCT
CGTCTGAGAGTATGAATAGTTATAGGCCCTAGCCAGGTATTCATGTACGCCAATGTGTCG
GCTTCCTGTTTAATGTGCACTCCGTGTTGGAACCCGCTGTCCCCTAAGTGCCGACTGTGT
GAGAGTGTTGGGAAGGAGCTTGTTGGCGGCGCATGTGTTTGACGGGACACTACCACTGGG
CTGCATTTTGTGGGGGGGGGGGTGCCACTGGGCTGCATTTTATGGGGGGGTGCCACTGGG
CTGCATTTTGTGGGGGGGGGGTGCCACTGGGCTGCATTTTGTGGGGAGGGGGGGTGCCAC
TGGGCTGCATTGGGGTCATACCGGGCTTTGAGGCCTGCTTCTTCCTGCTTTAGTTGGGAT
CCGCAGAGCAGTTTTGGCACAACATGGAGATTGTGATATCCACTTCTAATTGCTCTTACA
CAGGCTGAGTTACTTGAGCTATTCGCCTCTGTCTGACTTGGCTCTCTATAAACTATAAGC
TGTCAACTGGGTGCGTGTGTGGTACAAATATTAAGGGTATTCTATGATGGGCAGCTATAG
TCACATTTGTTGGCTTCTGTGGAGCTCTCGGGAGAGGCAGCTGAGACGCTGGCAGTGCCA
TGTGCACAGTTCTGTTAAACATATAATCCACAAACCATGTCTCCTTAATTGTTGTGTATG
GTGCTGCTAATGGGGTTTGACAGGACCAATGACTTTTTCTGCTTTAATCTTAGTATGTTT
TGCTTGGGTTTGCTAATTGTCAAGCTTAAACTGAGAAGCTTCTGCATAACTGATCCTCAA
GATTTAACACTATAACTAATGCAATACTTTCTTATAGTGTGGACCCCTTCTCCAAAAAAG
ACTGGTATGATGTCAAGGCACCAGCAATGTTCAATATCCGCAACCTTGGAAAGACTCTTG
TCACCAGAACGCAAGGAACAAGTAAGTAGAATTATACACAGCCCTTTGCAGCCTTAGAAA
TATTATAGGAGGGACTGGTGTGTTATCTGTACCTGAAATCTGCATCCAGTGTATATTTTG
TCCCTCTTTATTGTATTGTAACAGTACTTGTACCTTTATATGTCCCAGTATTTTGTAGGG
AATGGCTTTCTAATTTTATTGGTTGGGTGGGAGTTAAAACCTTTATGAGCTCTGGAATGA
ATGATGACAAAATGTTTCGGTCCCAAATGATTTCTATGATTACTCTTTGAGATCGTTCTG
ACATTCCACCACTCTTTATTTACTGATGTAAATCAAGTAATTTTTTTTTTTTTTTAAGCA
TTTGTTGCACTTTTTTATTCTATGGTATTATCCAGATCTAATGCATTCACAAAGCTTTCT
CCTACCCATTTTAAAATAGAAATTGCCTCTGATGGGCTGAAGGGTCGCGTCTTTGAAGTA
AGCTTGGCTGATCTGCAAAATGACGAAGTGGCTTTCCGTAAATTCAAGCTTATCACAGAA
GACGTTCAGGGCAAGAACTGCCTGACCAACTTCCATGGCATGGATCTCACTCGTGATAAG
ATGTGCTCCATGGTCAAGAAATGGCAGGTAAGCTAAGCAATTAAAAAACTGACCTAAAAT
ATTAATGATGTTACTGTAGGAGCAGCAGATACAAATATAGGCAACCTCTTGGTGCTCAGG
CTCTGGATGTGCTTTCTGTTTAAAATGGCAATTTAGAAGTCACTGCACTCTGGCAATCAT
GCTTTGATTTGTGTATAAACTCTTGTCCAGGCGCTTCATCCCTCTAAGAAGTCACTTTAG
TCATCTTTTGTATCTACTCATTGGAGAGTTATTGTAAAATGTCCAAACACCTTTTCTGCA
AAAGCCATATGTGACTCTTAATATTGGTTATTAAGAAACAGTAAGTTTTGTTGTAACTTT
ACCTAAAAATGCCCTCAAGCTAGTCAGAGGGTGAACATATACCTGGCTTGCTTAAAGTTG
AAAAAAAGAAAAAAAACCTAAAAGTTTGATATAAACCTTTTTTGCTGTAATTATATAACT
GGCTGCCTGTTATTCCACTGGTCCTGTTTACCAAGCGGGAATTAAGTTTAAAGTCTCAGC
GGTAGATGTGGTTTTTAGGCTGACTTACAGGTGAGTGTTGCAGTGGATCAGCTCCCCTGG
GTTACCTGCTATAAACCACGTAACTTGCAGCTTGAAGGTAGGACTTTCACATTTTGCTCT
ACTAGGGGCTGTGCTGGACCTCTGTAACTTGTTGCGTATTGGGCAGCTAGACTGAATCAA
GCTCAGTTATTGTTTATGAATGCAACACCTTTCAGTGATACCAACTAAAGCAAAGGGGTT
GAGGGTAATTCACCATCCCTCACCGGTTTCATTTTTACAATTAGTACACCAGAAAGAGAA
TTAAAAATGCTTTTGATATGTGAGCTGCCACTGCATGCTGTTGAATGAGTTTACTAAATA
TACCAGCAAGAACTGAATTGTGCTTTTCAAATACAGAATAGTAATAATTGGTATGTAATT
GAAATATATATATATATATATATATATTAATATATATATTAATATATATATATATATATA
TATATATATTAATATATATATTTTTTTTTTTTTCCCTTTGGTGTTTGGTCCTTTAAAATA
AGAGTTTAATTGCACAATCAGCTCCACCTTTGGGGTGTTTGCTAACAATGTGTCCTGCTG
GCTCTGGAGAACTAAGGGAACTTCACAGAGCATTTTTCCATAGGCATTTGAATGTGAATC
TATTGAACATAACATATATTTTAATGCAGGTGTATTTTGAGAGTACAACATGCAGTCCAA
AACACAAGTAGATGTATGAAAATGCTGCTTTCTCTGTGTTTAGGGGTACAACCAGGCAAA
CCATTAGCTCATGTGTTTAGGTGTGTTCAAACCTGCACCTCCAGTGTTCTGACACTAAGG
GGTATATTTATCATGCTGTGTAAAAAGTGGAGTGAAGCATTACCAGAAATGTTGCCCAGG
GCAACCAATCAGCAATTAGATTTCAACAGTTAGAAAATCAAAGCAAAGCATCTGATTGGC
TGCTATAAACAACCTCACCGGTGATGTTTTACTCCACTTTTTACACAGCATGATAAATAT
ACCCCTTGGAGTACAGTCTCCAGCATGCTTCAAGTTTTGCTAATATTTGGTAGCCGAGCA
CCATTTAAAAAGACAAACACAGAAGATTGTCTCCTTTAACATTTTTCTTAGCTGGTGGTC
TGACTATGCAGATCTACAGATAAACACATGAAACCAGTGTCCATGTGCTTCACTCTATGG
GACAGTTGCTCTCTCAAAATCATTGTCAGTTCCATTCATTCTTGAGGTTTATTTACTTGT
TTGTACATAGATAAAATAGAATGTTTGAACTGTGCTAAGATTAAAATCAAATAGTTTAAT
ATCCTTCTCAAAATGGATTATTTTTATAAAAAATGTATAAATGCAGCAAGTATGGTTAGA
ATTGGTGTATTTTCTTGAAAACTGACACTTTATGTAACGTAAGGGCTTCCATTATTGTCT
GCCTGGAAAATTCAGTAGGACTCTTTATTGTATAGTTTGCCTTTTTAATAATTTTGGACC
TTCCAAAGTGCCTGTAATGTTCCTTTGATGCACTTCTTCCTGTTTTAATAAGCAGCAAAT
AATTTACTTTGCCAGTACATGCAGCAGTTGCTTTCTAGTTATTTCTGGAATTACTTTTTC
CAAACTCACCTGATGTGAAAATTTACATTGAGTGCTGAGGTGAAATATACGCTTAAGTTC
TTTAAGAATGGGTTAAATGCCTTGAGATCTGACTTGCTTAACTCTTTTCAGACCATGATT
GAAGCACATGTTGATGTGAAGACCACAGATGGCTACTTGCTCCGCCTGTTCTGTGTTGGA
TTCACTAAAAAGCGCAACAATCAAATCAGAAAGACTTCCTATGCTCAACACCAGCAGGTC
CGTCAAATTCGCAAGAAGATGATGGAAATTATGACCCGTGAAGTGCAAACAAACGACCTT
AAAGAGGTTGTTAATAAACTGTAAGTTTCCACGAAGTGTGTATATATCCTGTGAGTTTTA
TGGTTTGGCTTCTGGGAATGAATGATGACAATATGTTTCGGTCCCAAATGATCATCTGTG
ATTATTGCTTTGAGATCGTTCTGACTTTCCTTTGTCAAACCAAGTTATTTTTGAAAACCT
GAGTTCATCATGCGTAGGCCAGCACTTTTGTCCCAGTGGATGGATACTGCATGTGGGGCC
ACACAGTATGGCTACCTTTTTAATCTGTTTGGACTGACAGCCTGAATGATTGAAACGACA
GAGGTCGAGAGAGAGCTGCGGCTCCTCTTCATTTCTGATGCAGCATACACTGGCAGATAT
GGTGCCTCGGCAGATAATTTTAAGTTACAATTGATTTTATTGATGTATGGCCAACTTTAG
ATTGGCAAACTTGATATACCATTTTTATAACACATTTTTCAGGGTAATACAGATTATTTG
CAACTTTTTAAAGACTTGGAACAATCCTTTTTATTTTCTCATGTTTTAGGATTCCAGACA
GCATAGGCAAAGATATTGAAAAGGCCTGCCAGTCAATTTATCCTCTCCACGATGTTTATG
TCCGTAAAGTGAAGATGCTGAAGAAGCCAAAGTTTGAGCGTAAGCTAATTTTCAACTTTA
AATCTATCATGAGATTGCTGTCTTATGGCAACACTTCGTGAAATTCTCACTTTAAAGTTA
TTTAGGGAATATTGTTCTAATTAGTTGTAACTCTGTGTTCATAGTTTAGGATCGAGGATT
ACTCTGAGCATTAATTTAATGAATGTGTTGAACAGCAGATTTGAATAAATATGTATTTAA
CTGCTGTGGAAACATACTTGTTTCATTGACTTTTCTGTAAAATGTTTACTGATGGTAAAT
ATGGCCAGAGATGTCATAAGCAGAGGTTTAGCAAAGTGCAATCTGGGATGGAAGTTACAT
GTACACCTTTACCAAACTTGCTTAAATTCAGGAGTCCGTTTTAAACCAGACCTAAAGGGT
AAAGCACACCCCCAACTGAAGTGTGGTCAAGCAGAGATGTGCCCTAAGGTGGCAGAATGA
CCTCTTATTTCTCCTGATTTTTTTTTATTCAGTTCCAGCTTTGCTGAACATATCTATAAA
ATCATGTCTTTTACAGAATGTTTGTGCCAAGGTGTATTGTATTGTTACTAAAATGCCCCA
CTTTATCAGGAATTATATGGTAGAATCCTTTTAGTGTAGAAAATAAGCCTGCAGTCACAT
GCAGCCTTTCAGATAGCTTAGCTCAGAACATACATTTTTGTTCCATGCTTTTATTTTATG
TGTTGATTCACTTTTCTTAACATTTCTGGAAACATGATGACAAACTGTTTCGGTCCCATA
TGAGTTCTTGTGATTACTGACATGAGATCGTTCTGATGTTCCTTTATTTACATTTACTAG
TTCTTTTCCTGTGTATGCATGGCCTTTTTTTAATATTACATACTTCCCCCCCACAGTGGG
CAAACTAATGGAACTTCATGGCGAGGGTGGAGGAGCTGGAAAACCAGCAGGAGACGAGAC
TGGTGCCAAAGTGGAACGTGCTGATGGGTATGAACCCCCAGTGCAGGAATCGGTCTGAGT
TAAAGAATTCTGATTTAAAAACTGTAAAATAAACCTAAAAAAAAAAAAATGGTGGTCCTC
TGTGTGCCTTTCTATTACCTGAAAAAAATCTGCTTCTCATAGGGGTGTGCATAGAAATGG
TATGTTTAAATGGAACGTTACCTTAATTAACTTGTATGTGCTGACATGGATATTTTTTTT
TTTTTTTTTGGACTTTTTACAAACAAATCAAAACTATTCTGTGGTTGTCATGTTCCTAAA
ACATCCAGTCTAACAACTGTCTGGTCACTACAGTCAGTGATTTAATACATTTACCATTTC
ATCCTATTTATAACAAATTCCAATTAAAGTTACTACTTTTAGTTTAACTTAAGGCAAACT
AGCCTTTTAACTGCAGTGCTTTTTGTAGCCAAAAGGCCGCTAATGGTGATGATAGCTGTA
TCAGATTAGGGATGATAGAGTACTGGTCAACTAAAGTCCAGAGCCAACTCTATTTAACTT
TGCATGATGTCTCTTACCCAGAGTATCTGTACTATGTTAAGTGTTTTCCAAGAAAACTAC
CTGCTCAGAACTAGAATGGGCTTTGTACCTGCAACAGCTTCAGCAGGCTTGGCATTTGCA
TCTACGTAACAGCCTCTTACCAGCAGATTGAAGAATCTATATATAGCTAACTGGCTGCCA
GGGTCTAATTCTCCCTAGCAACCAGGCAGTAGTTTGAATCAGAGACAATAATGAAGATTA
ATAGAATAGGGCCCATAGAAAGATAAGTTAATAGAAAAAACAGAAAATTGTTTTTTAAGA
AGAGAGGCATAAAGGACGTTGTACAACTTTAACAGTTATAATAACTTTTAGTATATGCTA
TATCCAATGGACTGCATATGTGAGCTTTGTCTGTAGAACCTTAAAGGGGATGTTTGCCTC
CCTGTATACCACCTTGTTTGTCATGAGGGAAATGAGTAGGACTTTAAAGGAACAGTAACA
CCAAAAAATTCAAGTGTATAAAAGAAATTCCAATATAATGCACTGCTGCCCTGCACTGGT
ACAACTGGTGTGTTTGCCTCAGAAACACT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1069, 2077..2180, 2599..2786, 5031..5239, 5749..5858, 6716..6888
1008..1069, 2077..2180, 2599..2786, 5031..5239, 5749..5858, 6716..6834
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved