Xenopus_tropicalis Locus SLC25A3
snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis SLC25A3
Xenopus_tropicalis
SLC25A3
scaffold_5
SNORA53
3380..3621
6229
GCAGGAGAAATAAAGTGATTCAATGTTAATAGACGTAGCTGTGTTTGCGGGGCTCCCTC
CCCCTGGAATAGGACAATGGTACTGGCCAGAGGCAGGGGATGCCCCGATCACATTGCCGT
ACCCTGGCTACTTAACCTGGTCAAATGGCAAATCTAAGATGGGCGTGTATAGCTGGCTTA
GCCGGGGCTGTGATCGGCCATACATAGGTGTTTTAGAGTGTCTTATTCTTAGCTTTTCAC
TTGCTCTGTATGTACTGATGACCCTGGCAGCTACAAGGATCATTGCTCTGTATGTACTGA
TGACCCTGGCAGCTACAAGGATCATTGCTCTGTATGTACTGATGACCCTGGCAGCTACAA
GGATCATTGCTCTGTATGTACTGATGACCCTGGCAGCTACAAGGATCATTGCTCTGTATG
TACTGATGACCCAGGCAGCTACAAGGATCATTGCTCTGTATGTACTGATGACCCTGGCAG
CTACAAGGATCATTGCTCTGGGAGGCTCCACGTCTTCTCTTAATGATCTTTCTGTTCATT
CTCTCTCTGGTGTTTGGTTTCTAGGGAACTGCTGCTGAAAGTTAAGACTGAGAGCCTAAA
TCCAATTCTAAAGACATAAGATCAGCCGCAGATTCTCTCAGAATAGCACCGCAAAGTTTA
TTTGCAAAGTTCATCTTTAAAAGGGAACAACCATATCAGAGTTTGTAATGTGCAGCGATC
ACGCTTGATGGGAATGGTCATGTCGGGGTTAAACAGTGCAATGTGTTAGAGTTTTTACTT
AGTTTTGCTGTTTGTGAGCACTGCTGGTACAATGGTGTGTATGTGATTTAGCTTTGTAGT
TAATATTAGGAGTGCATGAAGCAGATGTACAGACCTCCAGTAACAAAGTAAGATGCGTGG
TTGTTGGGGGCTAATATAATTCCATCTGCAGTTTGATGTTCTATTTTACGCTTATGGTGG
CTTTTGACACGTTTTTTCTTTCCCCCTCAGTTGCCGCCGAAATGTATTCCTCCGTTGTGC
AGTTAGCGCGGACCAACCCTTTCAATGCTCCCCACTTTCAGTTGGGGCAAGATTCTGTAA
TATCAAGGAAAGGCAATATCCCCCAAACAAAGCCGACCCGTCAGCTTGCTGCTGCTGCTG
TTCAAGAAGGTATGTTTGTTGCATATGATAGTAAAATTATGTAATGAGCTTTTTCAGCTG
CTACAATGTTTAGAATTCTACTGTCAAGGTATAAATGAAGCCATGTTTACTGAGACACTG
ATACTGTAGGTCAGCTGCTGCAGTGCTTTGAGTGTTCTATACTGTGCATGGGTTCTAAAT
TTACCCTGTTTTTTTTATTATAACCTTCAGAATCTACTGCAGTAGCTTTGCACCACATAT
CATTTAGTCCTGGTTGGAACCTGCAGTGTTGGGGTTTGACCTGGTTTTAACTTGGGCCAT
TTTGCCTTGTTTGGTTAAGCCTGCTGAAGTAGGTCATCTGAAGGGCAACCTGTGACTTAT
ATGTATGTAAAGGACAATACTTGCCTTTGGTATTAGTGTGACATAATCATGGCTTTTTAA
ATAATTTCTTGACATGCAAATATTTTTATAGGGGATGAAATTAAACTGATAGAAAAATGA
AATGTTAGGATGAATTAGTATGTGCAATACTTTGCCTATCTCCTTTGTATTTTACGGTAT
TTTATGGTTGCTAGAGCATAATTACCATAGCAACCAGGCAGCTGTTTCTTCATCTGAAGA
ATACTGTCTCCTCCCACTATTGCTCTAAAATACTTTCAAGATTGTTTCCCCTGTTTGTTG
GAAGTAATAAATACATGTCTTTCCTAGTAAAACAATAGGAAAAAAGTATGTTGAGACCAA
GCCCATGTGCCAAACAATATTTTGTACAAAGAATATCTAGTTGAAGCTGGAAAAACAGAC
CAGTCACATTCTTTATCAGAGTTTGGTCCGAGGTCTGTTTTTTTTTTGTTTTTTTTTAAA
CCCCAGTGTAATAAAATTTTGGATGCATTATACTTTCTTAGCATATTTTGCATGGTTACA
GCTGTGTCTAGGCGACATTCACTGTCAGTCACCACTAGAATTTGCATTAGATGTGTCTTC
ATTATGGAGACCTTTACAGCAGTTTGCACACATGTATTAAAAAAAAAAATAACTTGTTTC
AGTTAGTGGCTTGAAACTGACATATTTAGGCCTATTTCATAGACTGCAATGTGAATGAAA
ATGTCACTTTTGATTAAACAGAGGAGTATAGCTGTGCTTACGGATCTGGCAAGTTCTTTG
CACTTTGTGGCTTTGGTGGAATCATAAGTTGCGGTACAACCCATACTGCAGTGGTCCCAT
TAGATCTGGTTAAATGCAGGATTCAGGTTTGTGTCTCGCTTAATTTGGTATGCAGTGTAA
ATTAACCAATGTTTTGCATAAACTAATCTGTTTGCCACCAAACAAGTTACTAAAACATAC
ATTTGACTAACAAGCATGGTGTGTTTTGATTTTTGTGCAGCAGGTGAATTCAGTTGTGAA
TATGGCTCAGGAACGTTTTATGCATATTGTGGCTTTGGTGGCATCCTGAGTTGTGGTCTA
ACCCACACTGCTGTCGTACCACTGGATTTGGTCAAATGTCGTCTTCAGGTTAGTATGGCA
AACATTTAAGGGATGCTCGGTTTTCCTTCCAGCGCAGTTTTTGCTATGCAGAGGTGTTTT
TTTGTTTTTTTTTTCCCCCGCTATTGGCACTTCTTTAAGACCGCAAGGGGAGAGGCAATG
TGCAGAGTGGTGTCTGATTGCAGGCACTGCCTCCATATTCCGTTAACTTCAGGCCACCAA
CACACCAGCACATGTTGAGAGCAAAGCAGTTAATTGCAAAAGTGCCCAGAAGAACACCTT
GAGCAAGTGTGGGTTTAGCTCTCCTCATGGCTATTTTTATTTTTTGGAATGGTGGGTTTT
ATTTTAGTGGTTCCTAATTCACAGGTATTTCTCTACAAAATGGCTATGCTGTATACAAAA
GATCATACAAACAAAAAATATGAAGTTAGAAATCTATTATGGGGGTTTGAATTTCTTTTG
CTACAGGAGAAAGATGCAACTTTCTGATACATTTAAGTGTTGAATTGCATTCATAAATCC
TGTACTTCAAAATTTTATTCCAAAGGGGGGGTACTTAATTCACTATAGAAAAGTCTAACC
TTACAGTATGTAAGCAGTCCCATCACTTATTTATAGGCCTGCCTATTATATTATATTATA
TTATATTGCTGTGTTGGATTGCACACTCGAAATGAAATGTGATTTCTGTAGAAGTCAGCG
GATGCAAGTTCCATTGTACTAATTTTTGTTAGTAATTACTTGCAGTTAATGCATAATCAG
AAGAACCCCTGCCGCACGTTAACATGCTCCCTTAGATCCATCTTTGTGGAAGTCCGCTTA
TGCTGAGTCCTGCTAACTGCTCATTTTGGGCTTTAGAAGTTCCAGCTAAGAGACAACCAG
CAACTTTTTTGGTTGTACAGTCAAAGGTGCTTGAGTCATTGGCATGTGAGACTAATATAC
CTGCACGTTTGTCTTGGCATTTTGATGGCCGTGGTTTCCTAACCACATGCCACCATCAGA
ATTTAGCAAATGTGCGGACATATATATTTAAAGAGTTAACTACTTTTTTTTTTTTTTTTT
TTTTAAGCCTTTAAAAAAAATTTGTTGTATAATACCTTTTTTAAATGCAATTTTTTTTTT
TTTTTTCCTTTTAAGGTTGACCCTCAAAAATACAAGAGCATCTTCAATGGCTTTTCCATT
ACCCTTAAAGAAGATGGTGTTCGTGGCCTTGCAAAGGGATGGGCTCCAACGTTCATTGGA
TATTCAATGCAGGGCCTGTGCAAGTTTGGTTTCTATGAAGTGTTCAAGATACTGTATGCT
AATATGCTGGGCGAGGTAACTAGTGACAGTTTAAAACTTTTTGCCAATGAATATGAATCT
GCAGATATTAGCAAGGTAGAAAATGTGAAATTAAATCTTTATATAGGTATATATTGCAGT
CGTTACAGAAAAAACTTTCTAGCTAGTAAAGGATTATCGTAGAACCAATAAGTAGTAGGT
TGAAAATATTGTATGATGTGATGGTTTTTTACCCACTAAAATGTATGTTGTTCTTTCAGG
AAAATTCCTACATGTGGCGTACTTCTCTTTACCTGGCTGCGTCTGCCAGTGCTGAGTTCT
TTGCTGATATTGCTCTGGCTCCAATGGAAGCTGCAAAAGTACGCATTCAGACACAACCAG
GCTATGCTAATACTTTAAGACAAGCTGCTCCCAAGATGTATGCTGAGGAAGGCATCTGGG
CGTAAGTATTTATACATAAATTTATACAGTATATTTTTTCTCTGAATATGCTTCCTTGTT
TTCCCTGCTACTTTTGAAGTTACATGCTGCCCTAGACCTACCTTTGTGAATATCGGTTTC
TGCTAATTTTACATTGTATGCCTTCAACGGTTCCAGCTTAGACATTTAGAAACTTTCTGG
TTGCACAGTGAAAGGTGATTGGGTCATGTGAGACTAATATACTTGTATTATAACCCTCTG
TTTCTGATACCACTAGCTGCAGGGTTCACTCATTCCATCAGGACACTACTTATTTGCTCA
TGCTTAGAAACTCATTAGAAAAAATGACAAAAGATAACCTTGTGTTTAGTTAAGCTTTAT
GACCTTTCTCCCCCCCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNAGAAAAACACCCTTAAGGCGGCCATACACAGCTCCAAAACAGCCAGCAGAT
ACATTAAGATGTCATTCAGTTTTTATTAATGACCTAATACAGCTATCGCTCCTAACATAT
ATTTATGTTTTGTAGCTGGTGTCTTCTGTGCCATTGTCTCACATCCTGCGGATTCTGTGG
TCTCTGTACTGAACAAGGAAAAGGGAAGCACTGCTTTGGAAGTTCTGAAGAGACTTGGGC
CTAAAGGTATGTGTTATACTCTTTGAGCTATATTCCTTTTCCACCTTGCAAGTTTTGTAT
GTTTCTTACAACCACTTTGTTCTCAACAGGTGTCTGGAAGGGTTTGACTGCCCGTATCAT
CATGATTGGTACCTTGACTGCTTTGCAGTGGTTTATCTATGACTCTGTGAAGGTTTACTT
CAGACTTCCTCGTCCTCCTCCCCCTGAGATGCCAGAATCCTTGAAGAAGAAGCTTGGTCT
CACTCAGTAAACATGGACTCAAATCATGCAAACTCCAACATTTTCAAAAGGCGTTTTTTA
TAAATTCAACTAAAAAATAGGACCTATGGTTGTTTCAGATGTAATTATTGGTTGTGCTCT
CACCTTGCCGCATAGCCTACACATTGTAACTTGGTTTTACCGCTGTATTTATCTGTTGAA
ATAAACAGATGAGAGTTATTGCATTTATGTAATTTAAACTTAACAAACTGATGGTTAAAG
ATTTAATGTACAGAACTAAATATCCATCCCAAACACATTTCAGTTGTATTTTTGTTCGAG
TGGTTGATGCTGATGAATTAGTGGTGAAGAATGTCCATATATGTTACAGTGCTTCGGTCT
GCTCTTCCAAATAAGTTCCCTGTCTTAAGTGTGTTGACTTAAATCCATAGGCAGCTCTGT
TCATTGATACATGTACACTGGCCTGAGGCTTCAGCAGGAATCAACTTTAGAAAAACTGAT
GACAGCCACTCCAGAAGTGGGGACAGGGCAAGGAATATAGTTCCCTCTATAACAGTGCTG
TCCACCTGACAGGCCATATGTGCCCCCCCCCACCTGTCTGGCTTCTATGGCTGCTTACTT
TTTGTGTAAGATTTAAATGGTACCAGTACTGGGATAAACGGCCCCCTGCATTGTTCACAC
CTCCAGATTCAGGCTGTTCACACCATTTTAGTCTCTGTATTGTTCACACCTCAGCCTGTA
AGCCCCTTCATTGTTTACACCTCACATTGTGCCACTGTATGTACTGCCTGTGTGTATGCC
ACAGACAGCATAGGGCAGGCAGAGTATGGCACGCAGGCAGGATATGCACATATAGAGGCA
GTATTTTGCCTGCCCTATGCTGCCTATGCGAGATTAACCTGGCAGGCTTTGCTATGGGAG
TTTGTTAGCATGTGGAACTAGCCATTAAATGGTCCCTAAGGTGTGTATTATATGCTGGAG
GTTGCTGTGCTATCCAAAGGGGAGGAGGCATATGGATTTAAGGGTATATA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1148, 2500..2627, 3735..3914, 4139..4320, 4532..4582, 4601..4628, 4631..4667, 4780..4809, 4842..4985, 5069..5229
1001..1148, 2500..2627, 3735..3914, 4139..4320, 4532..4582, 4601..4628, 4631..4667, 4780..4809, 4842..4985, 5069..5226
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved